• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
J Immunol. Author manuscript; available in PMC Feb 1, 2013.
Published in final edited form as:
PMCID: PMC3262922
NIHMSID: NIHMS340915

Regulatory B10 Cells Differentiate Into Antibody-Secreting Cells After Transient IL-10 Production In Vivo

Abstract

Regulatory B cells that are functionally defined by their capacity to express IL-10 (B10 cells) downregulate inflammation and autoimmunity. In studies using well-defined IL-10-reporter mice, this rare B10 cell subset was also found to maintain a capacity for plasma cell differentiation. During a transient period of il10 transcription, the blimp1 and irf4 transcription factors were induced in B10 cells while pax5 and bcl6 were downregulated as a significant fraction of B10 cells completed the genetic and phenotypic program leading to antibody-secreting cell differentiation in vitro and in vivo. B10 cell-derived IgM reacted with both self and foreign Ags, whereas B10 cells generated Ag-specific IgG in response to immunizations. Moreover, B10 cells represented a significant source of serum IgM and IgG during adoptive transfer experiments, and produced Ag-specific, polyreactive and autoreactive antibody specificities that were consistent with their expression of a diverse Ag receptor repertoire. Thereby, B10 cells not only limit inflammation and immune responses by the transient production of IL-10, but may also facilitate clearance of their eliciting Ags through an inherent capacity to quickly generate polyreactive and/or Ag-specific antibodies during humoral immune responses.

Introduction

B lymphocytes mediate humoral immunity through their production of secreted antibody, but are also central regulators of CD4+ T cell activation by serving as APCs and providing co-stimulatory molecules and cytokines that regulate cellular immune responses during T cell expansion, memory formation, and cytokine production (1). However, B cells and specific B cell subsets can also negatively regulate immune responses (2). The absence or loss of these regulatory B cells exacerbates disease symptoms in diverse models of inflammation and autoimmunity, predominantly through the production of the regulatory cytokine, IL-10 (311).

A specific subset of regulatory B cells was recently found to inhibit inflammation, autoimmunity, and innate and adaptive immune responses through the production of IL-10 (8, 9, 12, 13), a potent and pleiotropic cytokine (14). We call these B cells “regulatory B10 cells” because IL-10 is required for their negative regulatory function (2) and additional B cell subsets with unique regulatory properties also exist. For example, IL-12-producing B cells regulate intestinal inflammation (15). In mice, regulatory B10 cells are functionally identified by cytoplasmic IL-10 expression following in vitro stimulation with LPS, PMA, and ionomycin (L+PI), with monensin (L+PIM) included in the cultures to block IL-10 secretion (8, 9). Spleen B10 cells are found at low frequencies (1–5%), where they are predominantly found within the phenotypically unique CD1dhiCD5+CD19hi B cell subpopulation (810). Regulatory B10 cells share overlapping cell surface markers with multiple other phenotypically-defined B cell subsets (B1a, marginal zone, and marginal zone precursor cells), potentially consistent with their localization within spleen follicles and marginal zones (16). B10 cells are presumed to be functionally mature since they are competent to express IL-10 after 5 h of ex vivo stimulation, and they proliferate rapidly following in vitro or in vivo activation (12, 17). Additional B cells within the CD1dhiCD5+ B cell subpopulation acquire the ability to function like B10 cells during 48 h of in vitro stimulation with either agonistic CD40 mAb or LPS (17). These B10 progenitor (B10pro) cells are then able to express cytoplasmic IL-10 following L+PIM stimulation for 5 h. Regulatory B10 cell functions are Ag-restricted in vivo (8, 9), with B10pro and B10 cells requiring diverse Ag receptors (BCR) for their development (17). Spleen B10 cell numbers increase significantly during inflammation and autoimmunity, with the adoptive transfer of Ag-primed CD1dhiCD5+ B cells suppressing inflammation and disease in mouse models (8, 9, 11, 17, 18). Human blood B10 and B10pro cells that parallel their mouse counterparts are equally rare, and represent a subset of the circulating CD24hiCD27+ “memory” B cell subset (12). Thus, the capacity of human and mouse B10pro and B10 cells to express IL-10 is central to their regulatory function.

IL-10 reporter mice have been developed to examine regulatory T cell IL-10 expression and cell fates. In Tiger mice, an internal ribosomal entry site-GFP construct follows the genomic il10 coding sequence, resulting in cytoplasmic GFP expression during il10 transcription (19). Similarly, 10BiT mice express Thy1.1 under the control of il10 BAC-transgene regulatory elements, leading to cell surface Thy1.1 expression following IL-10 production (20). In the current studies, IL-10 reporter expression was used to track regulatory B10 cell induction and fates in Tiger and 10BiT mice, with the findings that regulatory B10 cells only transiently express IL-10 prior to their terminal differentiation into clonally diverse antibody-secreting plasmablasts and plasma cells that contribute significantly to the serum antibody pool. Thereby, regulatory B10 cells not only limit inflammation and immune responses by the production of IL-10, but also contribute to humoral immunity.

Material and Methods

Mice

C57BL/6 and Rag2−/− mice were from NCI Frederick (Bethesda, MD). Tiger mice (19) were from The Jackson Laboratory (Bar Harbor, ME). A gene dose-dependent decrease in IL-10 production was not observed in homozygous Tiger mice, which occurs with T cells (19). Hemizygous 10BiT mice were as described (20). Mice were housed in a specific pathogen free barrier facility with end-point analyses carried out between 8–14 weeks of age. Mice were given (i.p.) sterile LPS in PBS (25 μg, E. coli, clone 0111:B4; Sigma, St. Louis, MO), CFA or IFA (200 μl of 1:1 emulsified mixture with PBS, Sigma, St. Louis, MO), Imject® Alum (200 μl of 1:1 emulsified mixture with PBS, Pierce, Rockford, IL), or alum with TNP29KLH (50 μg/200 μl; Biosearch Technologies, Novato, CA). All studies and procedures were approved by the Duke University Animal Care and Use Committee.

B cell purification, cultures, and immunofluorescence analysis

B cells enriched (>95% CD19+) from single cell tissue suspensions by MACS selection using CD19-microbeads (Miltenyi Biotec Inc., Auburn, CA) were cultured in complete medium (RPMI 1640 medium containing 10% FBS, 1% HEPES, 1% L-Glutamine, 1% Pen/Strep, and 0.1% 2-ME). Sterile LPS (10 μg/ml), goat F(ab')2 anti-mouse IgM antibody (5 μg/ml, Jackson ImmunoResearch, West Grove, PA), and CD40 mAb (2 μg/ml, clone HM40-3; BD Pharmingen, San Jose, CA) were added to cultures where indicated.

Single cell leukocyte suspensions were stained with pre-determined optimal antibody concentrations as described (21) with cytoplasmic IL-10 expression assessed as described (22). Antibodies included anti-mouse IL-10 (JES5-2A5), CD138 (281–2), CD43 (S7), CD38 (90) and GL7 (Ly-77) mAbs from BD Pharmingen; CD16/CD32 (FcBlock), FITC-, PE-, PE.Cy5-, PE.Cy7-, Biotin- or APC-conjugated anti-mouse B220 (clone RA3-6B2), CD19 (eBio1D3), CD1d (1B1), CD5 (53–7.3), Thy1.1 (HIS51), Thy1.1 (OX-7), CD21/35 (eBio8D9) and CD23 (B3B4) mAbs from eBioscience, Inc. (San Diego, CA); anti-mouse IL-10 (JES5-16E3), CD19 (6D5) and CD16/32 (TruStain) from BioLegend (San Diego, CA); and goat anti-mouse IgM antibody (Southern Biotech, Birmingham, AL). In some instances, Streptavidin conjugated to PE.Cy5 or PE.Cy7 (eBioscience) was used to reveal biotinylated antibody binding. Anti-mouse IgG1, IgG2a, IgG3 and IgA antibodies were from Southern Biotech. Anti-mouse Blimp-1 mAb (3H2-E8) was from Novus Biologicals (Littleton, CO). Data were collected on a FACSCantoII™ flow cytometer (BD Biosciences, Franklin Lakes, NJ) and analyzed using Flowjo Software (TreeStar, Inc., Ashland, OR).

Adoptive transfers of syngeneic spleen B cell populations were as described (22). For some experiments, purified spleen CD19+ B cells were first cultured overnight with LPS in complete medium, then washed twice and suspended in sterile PBS prior to i.v. injection through lateral tail veins.

Transcript quantification

RNA extracted from enriched spleen B cells was used to generate cDNA, with relative transcript levels determined by reverse transcriptase quantitative real-time PCR of triplicate samples as described (9). Thy1.1 transcripts were amplified using forward (CGTTGGCGCACCAGGAGGAG) and reverse (TGGAGAGGGTGACGCGGGAG) primers. Other primers were as described: gapdh and il10 (9); xbp1 (23); bcl6 (24); blimp1, irf4, and pax5 (25). Cycle conditions were as follows: 1 denaturation step of 94° C for 2 minutes followed by 40 cycles of 94° C for 30 seconds, 60° C for 30 seconds, and 72° C for 1 minute. PCR products were controlled for purity by analyses of their melting curves. Expression threshold values (ΔCt) for each transcript were determined by normalizing to gapdh expression within each sample group.

ELISA and ELISPOT assays

Sera were collected weekly, with Ag-specific antibodies quantified by ELISA using DNP-BSA. Serum IgM and IgG levels, autoantibody levels, and TNP- or DNP-specific antibodies were quantified by ELISA as described (21, 26). ASC frequencies from cell sorter purified B10 and non-B10 cells were determined using ELISpot assays as described (27).

Ig sequences

Purified spleen B cells from three individual mice were stimulated with LPS (10 μg/ml), PMA (50 ng/ml), and ionomycin (1 μg/ml) for 5 h. IL-10-secreting cells were identified using the Mouse IL-10 Secretion Assay Kit (Miltenyi Biotech Inc., Auburn, CA). Individual IL-10+λ-CD19+ cells were sorted into single wells of 96-well PCR plates using a FACSAria II cell sorter (BD Biosciences). cDNA was synthesized with Ig H and L chain transcripts amplified using nested PCR primers as described (28). PCR products were purified (QIAquick PCR Purification Kit, Qiagen, Valencia, CA) and cloned (StrataClone PCR Cloning Kit, Agilent Technologies, La Jolla, CA) before sequencing (Duke University DNA Analysis Facility). Productive Ig rearrangements were compared against germline Ig sequences according to the Ig Basic Local Alignment Search Tool (IgBLAST) database (National Center for Biotechnology Information, Bethesda, MD) and analyzed using the Immunogenetics V-query and Standardization tool (29) to determine V(D)J gene family usage. Mutation frequencies were determined using germline V, D and J sequences from IgBLAST. When light chain sequences obtained from adjacent wells were identical, only one sequence was reported. VH-D-JH and VK-JK transcript alignments and phylogenetic trees based on average percent identity were constructed using ClustalW2 (30).

Statistical analysis

Data are shown as means (±SEM). The two-tailed Student's t test was used to identify significant differences between sample means.

Results

B cell GFP IL-10 reporter expression in Tiger mice

Spleen GFP+ or cytoplasmic IL-10+ B cells were not observed in Tiger mice at frequencies significantly above background levels in monensin-treated wild type mice and their IL-10−/− littermates (Fig. 1A–B, not shown). However, GFP+ and cytoplasmic IL-10+ B cell frequencies increased significantly after ex vivo stimulation using L+PIM for 5 h. GFP+ or IL-10+ B cells represented between 2–3% of spleen B cells in both Tiger and wild type mice. Furthermore, 72±3% of IL-10+ B cells from Tiger mice expressed readily measurable GFP in these assays. Likewise, the majority of GFP+ B cells expressed IL-10 (Fig. 1C). In comparison with spleen, significantly fewer IL-10- or GFP-competent B10 cells were found within peripheral or mesenteric lymph nodes after L+PIM stimulation (Fig. 1D). Thus, GFP mimicked cytoplasmic IL-10 expression by most B10 cells during 5 h induction assays.

Figure 1
B cell GFP expression in Tiger mice parallels cytoplasmic IL-10 expression

Agonistic CD40 signals provided during 48 h in vitro cultures render B10pro cells competent to express IL-10 when subsequently stimulated with L+PIM. Under these conditions, similar frequencies of cytoplasmic IL-10+ (7.3±0.2%) and GFP+ (6.3±0.1%) B10+B10pro cells were enumerated (Fig. 1E). By contrast, LPS induces both B10pro cell maturation and B10 cell IL-10 secretion during 48 h assays (17). Under these conditions, the frequency of GFP+ B cells (9.3±0.1%) was consistently higher than the frequency of cytoplasmic IL-10+ B cells (7.8±0.5%), while BCR ligation did not induce B10pro maturation into GFP-competent B cells. Thus, GFP expression was more durable than IL-10 expression following prolonged (48 h) LPS stimulation due to IL-10 secretion and/or relative differences in protein turnover.

B cell Thy1.1 IL-10 reporter expression in 10BiT mice

A small fraction of spleen CD19+ B cells (0.16±0.02%) from 10BiT mice expressed cell surface Thy1.1+ ex vivo relative to background staining in wild type mice (Fig. 2A–B). However, significantly increased Thy1.1+ (0.9±0.1%, p<0.01) and IL-10+ (1.8±0.4%, p<0.05) B10 cell frequencies were found after 5 h L+PIM stimulation. Only 30±2% of IL-10+ B cells from 10BiT mice expressed measurable Thy1.1 in these assays, while 47±4% of the Thy1.1+ B cells expressed IL-10 (Fig. 2A–C). Mesenteric lymph nodes had the highest frequencies of Thy1.1+ B cells (2.1±0.2%) when observed directly ex vivo (not shown), as shown for T cells in mesenteric lymph nodes of 10BiT mice (20). Mesenteric lymph node Thy1.1+ B10 cell frequencies were also higher following 5 h L+PIM stimulation, but the highest numbers of Thy1.1+ B cells were in the spleen (Fig. 2D). To determine whether the il10 and thy1.1 genes were transcribed with similar kinetics in 10BiT spleen B cells, their transcripts were measured after in vitro LPS stimulation. Both transcript levels rose congruently in CD1dhiCD5+ B cells and peaked at 24 h relative to CD1dloCD5 cells (Fig. 2E). Thus, the temporal delay in cell surface Thy1.1 expression relative to cytoplasmic IL-10 was likely due to Thy1.1 processing and cell surface transport during the 5 h assays.

Figure 2
Divergent IL-10 and Thy1.1 expression by 10BiT B cells

CD40-induced B10pro cell maturation did not induce nascent cell surface Thy1.1 expression or change the kinetics of Thy1.1 expression induced by PIM stimulation. A normal portion of B cells cultured with CD40 mAb for 48 h expressed cytoplasmic IL-10 after L+PIM stimulation for 5 h, while Thy 1.1 expression was only modestly induced (Fig. 2F). However, a higher fraction of 10BiT B cells expressed Thy1.1 than expressed IL-10 after 48 h cultures with LPS plus 5 h PIM stimulation. Thus, cell surface Thy1.1 expression served as a more durable marker than IL-10 induction, with a large portion of the B10 cells having terminated IL-10 expression during the 48 h LPS cultures.

LPS drives B10 cell expansion in vivo

To evaluate B10 cell expansion in vivo, wild type mice were given complete and incomplete Freund's adjuvants, alum, or low-dose LPS, with spleen B10 cell numbers enumerated 3 days later by IL-10 staining after 5 h monensin or L+PIM treatment. Freund's adjuvants did not drive B10 cell expansion, while B10 cell numbers increased 2- to 3-fold after alum and LPS treatments (Fig. 3A). When Tiger mice were given LPS, ex vivo IL-10+ or GFP+ B10 cell frequencies and numbers remained low, but expanded 2- to 4-fold relative to their frequencies in littermates given only PBS (monensin treatment, Fig. 3B). Following 5 h of in vitro L+PIM stimulation, there were 2- to 3-fold increases in IL-10+ or GFP+ B10 cell frequencies and numbers relative to control mice, with most B10 cells expressing both IL-10 and GFP. Thus, GFP served as a reliable reporter for IL-10 expression in Tiger mice.

Figure 3
B10 cells expand after in vivo LPS treatment

After 3 days of LPS-treatment in vivo, Thy1.1+ and IL-10+ B cell frequencies and numbers in 10BiT mice increased by 4- and 2-fold, respectively (Fig. 3C). However, the higher frequencies and numbers of Thy1.1+ B cells relative to IL-10+ cells demonstrated that Thy1.1 expression served as a more durable B cell marker than IL-10 expression since half of the cells had already lost the capacity to express IL-10 following in vitro L+PIM stimulation. Thus, ongoing and terminated IL-10 production in vivo was reported by B cell Thy1.1 expression in 10BiT mice.

B10 cells differentiate into ASCs following IL-10 production in vivo

After in vivo low-dose LPS treatment for 3 days, the phenotype of spleen IL-10+, GFP+ or Thy1.1+ B cells remained predominantly IgMhiCD1dhiCD5+CD19hiCD23lowCD38hiB220hi (Fig. 3D), consistent with the ex vivo phenotype of B10 cells from untreated wild type mice (8, 10). However, variable frequencies of LPS-induced B10 cells also expressed the CD43 and GL7 activation markers (31), suggesting that LPS drives a subset of the reporter-positive B10 cells towards an antibody-secreting cell (ASC) phenotype.

Spleen ASCs are predominantly found within the rare CD138hiB220int/lo B cell subset (27). However, CD138 staining is lost under the conditions used to visualize cytoplasmic IL-10+ cells. Therefore, Tiger and 10BiT mice were used to determine whether in vivo LPS treatment induced B10 cells to differentiate into ASCs. In Tiger mice, GFP+ B cells expanded in vivo after LPS treatment, but predominantly remained CD138low (Fig. 4A). Rare GFP+ B cells (<2%) were found within the CD138hiB220int/lo B cell subset in untreated Tiger mice, with LPS inducing significant numbers of GFP+ B cells (16%, p<0.01) that peaked 1 day after LPS treatment and subsequently declined (Fig. 4B). By contrast, a significant portion of Thy1.1+ B cells (17–40%) in 10BiT mice expressed CD138 after 2–3 days of LPS treatment (Fig. 4A). Before receiving LPS, 14% of CD138hiB220lo B cells expressed Thy1.1, with almost half of the CD138hiB220lo B cells expressing Thy1.1 2 days after LPS treatment (Fig. 4C). Thus, Thy1.1+ B cells contributed significantly to the ASC pool following LPS treatment.

Figure 4
B10 cells differentiate into ASC in vivo

Since some pre-B cells, immature B cells and plasma cells express CD43, GL-7, and CD138 (32), an association between B10 cells and ASCs was more rigorously tested. Thy1.1+ B10 cells purified from LPS-treated 10BiT mice spontaneously secreted IgM in ELISpot assays at 5.5-fold higher frequencies than Thy1.1 B cells (Fig. 4D). IgG-secreting cells were not detectable within the Thy1.1+ or Thy1.1 B cell subsets under these conditions (not shown). Furthermore, Thy1.1+ B cells from LPS-treated 10BiT mice expressed transcripts for the plasma cell-associated transcription factors blimp1 (also known as prdm1), xbp1 and irf4 at 2- to 6-fold higher levels than Thy1.1 B cells (Fig. 4E). Likewise, pax5 and bcl6 transcripts were markedly reduced in Thy1.1+ B cells relative to Thy1.1 B cells, suggesting that reporter-positive B10 cells adopt an ASC or plasma cell fate.

B10 cell Blimp-1 expression was also measured during IL-10 induction. CD1dhiCD5+ B cells (B10 cell-enriched) from wild type mice expressed significantly higher il10 and blimp1 transcript levels relative to CD1dloCD5- B cells after 5 h of L+PI stimulation (Fig. 4F). Similarly, CD1dhiCD5+ B cells cultured with CD40 mAb for 48 h expressed significant il10, blimp1 and irf4 transcripts relative to CD1dloCD5 B cells following 5 h of L+PI stimulation. Independently, blimp1 transcripts were significantly increased in purified IL-10+ B10 cells when compared with IL-10 B cells after 5 h of L+PI stimulation (Fig. 4G). Measurable B10 cell intracellular Blimp-1 protein expression was confirmed by immunofluorescence staining in comparison with non-B10 cells (Fig. 4H) using described methods (33). Intracellular Blimp-1 expression increased when purified B cells were cultured in the presence of LPS for 24 h, with ~2-fold higher Blimp-1 levels in IL-10+ B cells than in IL-10 B cells (Fig. 4I). Thus, B10 cells expressed Blimp-1 before initiating the ASC differentiation program.

IL-10 is not required for B10 cell ASC differentiation

IL-10 induces human plasma cell differentiation in vitro (3436). To determine whether autocrine IL-10 drives mouse B10 cell development or differentiation, the 10BiT transgene was bred into an IL-10−/− background to create 10BiT.IL-10−/− mice. Spleen Thy1.1+ B cell frequencies were identical in both 10BiT and 10BiT.IL-10−/− mice after in vitro stimulation with agonistic CD40 mAb or LPS for 48 h (Fig. 5A). Identical frequencies of IgM ASCs were also found within the spleen Thy1.1+ subsets of 10BiT and 10BiT.IL-10−/− mice following in vivo LPS treatment (Fig. 5B). ASC frequencies within the spleen CD1dhiCD5+ subset were also equivalent in LPS-treated IL-10−/− and wild type mice, with the B10 cell-enriched CD1dhiCD5+ B cells containing a higher frequency of ASCs when compared with CD1dloCD5 B cells. Thus, autocrine IL-10 was not required for either B10 cell development or ASC differentiation.

Figure 5
B10 cells produce Ag-specific antibody and autoantibodies

B10 cells differentiate into IgM and IgG ASCs

Although spleen B10 cells are predominantly cell surface IgMhi (Fig. 3D), B10 cells co-expressing IgG2c, IgG3 and IgA were over-represented in the B10 cell subset relative to non-B10 cells (Fig. 5C). The relative contribution of B10 cells to the ASC pool was therefore assessed using GFP+ B10 cells purified from Tiger mice. Spleen B cells were stimulated for 5 h with L+PI to induce GFP expression, sorted into GFP+ and GFP fractions, and cultured overnight with LPS prior to ELISPOT analysis. Consistent with the B10 cell ASC potential demonstrated in 10BiT mice (Fig. 4D), GFP+ B10 cells were also a major source of IgM ASCs (Fig. 5D). Thus, a large portion of B cells in both Tiger and 10BiT mice produced IL-10 prior to ASC differentiation.

To determine whether B10 cells produce Ag-specific antibody, Tiger mice were immunized with the T cell-dependent Ag 2,4,6-trinitrophenol-conjugated keyhole limpet hemocyanin (TNPKLH) in alum. Seven days later, spleen B cells were stimulated for 5 h with L+PI to induce GFP expression, with purified GFP+ and GFP cells assessed for anti-TNP IgM and IgG ASC potential. GFP+ B cells from both unimmunized and TNP-immunized Tiger mice produced TNP-reactive IgM, indicating that some reactivity was attributable to polyreactive or natural antibodies (Fig. 5E). TNP-reactive IgG was only produced by GFP+ B cells from immunized mice. Thereby, B10 cells produced both polyreactive IgM and Ag-specific IgM and IgG.

B10 cells contribute to serum antibody levels

To determine whether B10 cells contribute to serum Ig, equal numbers of spleen GFP+ B10 cells or GFP non-B10 cells were transferred from unimmunized Tiger mice into Rag2−/− hosts. Serum IgM and IgG were first detected in mice given GFP+ cells after 1 and 4 days, respectively, and increased thereafter (Fig. 5F). In mice receiving non-B10 cells, IgM and IgG were detected after 4 and 6 days, respectively. At day 10 post-transfer, serum IgM levels from Rag2−/− mice that had received GFP+ B10 cells were significantly higher than those of untreated Rag2−/− mice controls or Rag2−/− mice given non-B10 cells. Serum IgG levels in Rag2−/− recipients given either B10 or non-B10 cells were below the levels found in wild type mice (Fig. 5G). Rag2−/− recipients given B10 cells produced IgM but not IgG antibodies reactive with TNP, further confirming that B10 cells produce polyreactive IgM. Serum IgM from these mice also reacted with nuclear Ags, including single- and double-stranded DNA and histone proteins. IgM or IgG autoantibodies were not detected in sera from Rag2−/− mice given non-B10 cells. Thus, B10 cells contributed to the serum IgM and IgG pools, including IgM antibodies with autoreactive/polyreactive specificities.

B10 cells express diverse Ag receptors

PCR methods were used to obtain an unbiased representation of the IgH and IgL repertoires of single IL-10+λ CD19+ cells from wild type mice. Both H and L chain transcripts revealed the utilization of diverse VH and VK family members (Fig. 6, Tables I–II). VH1 (J558) was the most frequently observed VH family, reflecting the predominance of this family within the Ig locus. Germline sequences without mutations encoded 84% of 50 representative VH-D-JH sequences and 91% of 69 representative VK-JK sequences. Thereby, B10 cells express diverse BCRs that were predominantly germline-encoded.

Figure 6
B10 cells utilize diverse V genes that are largely unmutated
Table II
B10 cell VK-JK sequences.

Discussion

These results demonstrate that the B10 cell subset not only regulates inflammatory immune responses through the production of IL-10, but also maintains a capacity for plasma cell differentiation. Following a transient period of IL-10 production, a significant fraction of B10 cells initiated the genetic and phenotypic program leading to ASC differentiation in vitro and in vivo (Figs. 4 and and5).5). B10 cells not only produced Ag-specific antibodies and represented a significant source of serum IgM and IgG (Figs. 5D–F), but also contributed polyreactive and autoreactive antibody specificities (Fig. 5G), consistent with the broad diversity of their expressed BCRs (Fig. 6). Hence, B10 cells do not define a distinct B cell lineage committed exclusively to IL-10-dependent immunoregulation. Instead, Ag-specific in vivo signals select B10pro cells, which develop into IL-10-competent B10 cells that secrete IL-10 in response to Ag exposure and/or TLR signaling before plasma cell differentiation (Fig. 7). Thus, B10 cells not only regulate acute inflammation and immune responses by the transient production of IL-10, but may also have the capacity to clear their inducing Ags by producing polyreactive and/or Ag-specific antibody.

Figure 7
B10 cells regulate antibody production in vivo

The BCR repertoire of spleen B10 cells was remarkably diverse, involving a wide spectrum of VH, D and JH elements, normal frequencies of noncoded nucleotide (N) insertions, as well as considerable complementarity-determining region 3 diversity (Fig. 6, Tables I–II). Regulatory B10 cell BCRs were predominantly germline-encoded with no somatic mutations in most clones. Thereby, spleen B10 cell VH utilization was similar to that observed for conventional spleen B cells (37) and did not exhibit the skewed pattern associated with peritoneal cavity B-1a cells (38, 39). While different selective and/or developmental forces may ultimately shape the regulatory B10 cell BCR repertoire, the current findings demonstrate that IL-10 competent B cells are generated in response to diverse foreign and self Ags, including a T cell-dependent Ag. Some B10 cells also produced “natural” IgM antibody that was characteristically polyreactive (Fig. 5E and G). Consistent with their IgMhiIgDlo phenotype (Fig. 3D) and ability to clonally expand rapidly in vitro (12, 17), it is likely that B10 cells contribute substantially to the short-lived plasma cell pool that develops rapidly following Ag encounter. Regulatory B10 cells also develop at normal frequencies in T cell-deficient mice (17), suggesting that many respond to T cell-independent Ags and are unlikely products of germinal center reactions. Germinal center-independent B cell isotype switching may apply to B10 cells as described (40, 41), although it remains possible that some B10 cells are recruited into germinal centers. Whether B10 cells re-enter the memory B cell pool after IL-10 production is also unknown since methods are not currently available to track B10 cells after they lose Thy1.1 expression. Regardless, B10 cell production of diverse antibody products following transient IL-10 production highlights their functional plasticity.

There were significant changes in B10 cell expression of the blimp1, xbp1, irf4, pax5 and bcl6 transcription factors following activation in vivo, which paralleled ASC differentiation (Fig. 4E). Upregulated B10 cell expression of blimp1 and irf4 (Fig. 4F–I) may be of considerable functional significance since these transcription factors cooperatively induce regulatory T cell differentiation and il10 gene expression (42). The Blimp-1 transcriptional repressor is well known for its role in promoting plasma cell differentiation (43), with IRF4 required for blimp1 expression (44). Blimp-1 may also exert its normal function as a transcriptional repressor and stop IL-10 expression during B10 cell differentiation into ASCs. Identifying the overlapping upregulation of il10, blimp1, and irf4 by B10 cells highlights the potential importance of these transcription factors for regulatory B10 cell function, although other B cells also upregulate blimp1 and irf4 as they differentiate.

Based on their unique phenotypes and ability to proliferate rapidly following mitogenic stimulation, it is likely that mouse and human regulatory B10 cells represent subsets of Ag-experienced B cells (12, 17). Despite high IgM expression by most B10 cells (Fig. 3D), some B10 cells have undergone isotype switching (Fig. 5C). Furthermore, B10 cells do not develop in transgenic mice with fixed Ag receptors and genetic alterations that regulate BCR signaling significantly influence B10 cell numbers (17, 4547). Since only a small subset of B cells have the capacity to produce IL-10 in vivo or in vitro (Figs. 12) and not all ASC expressed IL-10 before differentiation (Fig. 4A–C), specific in vivo signals must be required to induce IL-10 competence. This may explain why potent BCR ligation alone does not induce B10pro cells to mature into B10 cells in vitro, but may instead drive these cells towards different functional programs (Figs. 1E and and2F)2F) (17). Since neither CD40 nor MyD88 expression are absolutely required for B10 cell development in vivo (17), it is likely that these signals and polyclonal mitogens such as LPS expand B10pro and B10 cells subsequent to Ag encounter. Consistent with this, murine cytomegalovirus infection leads to the development of IL-10-expressing CD138hi B cells by 7 days (48). Salmonella infection also results in the rapid development of IL-10-expressing CD138hi B cells, which is maximal at day 1 post infection (49). Thereby, pathways that modify intrinsic BCR signals will drive IL-10 competence and B10 cell differentiation (16).

B10 cell antibody production in vitro and in vivo suggests that B10 cells contribute significantly to the serum IgM and IgG antibody pool after transient IL-10 secretion. The spleen marginal zone and B1a cell subsets also contribute significantly to antibody responses. In fact, spleen marginal zone B cells, by virtue of their preactivated state and topographical location, join B1 B cells to generate a wave of IgM producing plasmablasts during early responses to blood-borne antigens (50, 51). B10 cells also proliferate rapidly following in vitro or in vivo activation (12, 17) and rapidly convert to plasmablasts (Figs. 45). Since the regulatory B10 cell, B1a and marginal zone B cell subsets share overlapping cell surface markers, it is not currently possible to ascertain whether individual members of any one of these functionally- or phenotypically-defined subsets are the primary source of natural, polyreactive, autoreactive or antigen-specific antibody. Furthermore, B10pro cells cannot be identified apart from the CD1dhiCD5+ subset of B cells, so it is not possible to remove B cells that have the functional capacity to become IL-10 competent from either the CD5+ B1a or the CD1dhi marginal zone subsets for functional studies. Thus, B1a, marginal zone and B10 B cells share the capacity to produce antibodies in vivo and contribute to early innate and subsequent adaptive immune responses.

B10 cell antibody secretion may also contribute to their immunosuppressive functions in vivo. Soluble antibodies can quickly reduce Ag load and promote Ag clearance by opsonization or complement-mediated phagocytosis. In addition, bound antibody can directly interfere with Ag recognition by other cell types, effectively reducing the availability of activation signals via Ag neutralization. Autoantibodies can also be important negative regulators of intestinal inflammation and suppress colitis (52, 53). B10 cells may thus exhibit two waves of protection that are first IL-10- and subsequently antibody-dependent. For example, B10 cell IL-10 production inhibits the initial pathology associated with experimental autoimmune encephalomyelitis induction (9, 18), while others have defined a subsequent wave of B cell-mediated immunosuppression in this model that is both Ag-specific and enhanced by CD40 signals (4, 54). Since B10 cells can produce autoantibodies (Fig. 5G), it is possible that their antibody products reduce inflammation and disease through a second wave of Ag clearance. Also, B10 cells primarily produced germline-encoded IgM antibodies that are likely to be of low affinity and non-pathogenic, which may be optimally suited to neutralize self-Ags, preempt pathogenic IgG production, and contribute to the suppression of autoimmunity (Fig. 7). Consistent with this, treatment of MRLlpr mice with unmutated IgM autoantibodies confers protection against lupus nephritis (55). Further characterization of the B10 cell repertoire will be important for understanding both B10 cell development and expansion, particularly during autoimmune disease. Defining the BCR ligands and other signals important for B10 cell expansion and subsequent antibody production may also lead to new therapies for treating both inflammatory and autoimmune conditions.

Table I
B10 cell VH-DH-JH sequences.

Acknowledgments

We thank Drs. Eric Weimer and Garnett Kelsoe for help with the experiments, interpretation of the results and writing the manuscript.

These studies were supported by grants from the NIH, AI56363 and Southeastern Regional Center of Excellence for Emerging Infections and Biodefense (U54 AI057157).

Footnotes

Disclosures Conflict-of-interest disclosure: T.F.T. is a consultant for MedImmune/AstraZeneca, Inc, and shareholder and consultant for Angelica Therapeutics, Inc. All other authors declare no competing financial interests.

References

1. LeBien TW, Tedder TF. B-lymphocytes: How they develop and function. Blood. 2008;112:1570–1579. [PMC free article] [PubMed]
2. DiLillo DJ, Matsushita T, Tedder TF. B10 cells and regulatory B cells balance immune responses during inflammation, autoimmunity, and cancer. Ann. N. Y. Acad. Sci. 2010;1183:38–57. [PubMed]
3. Mizoguchi A, Bhan AK. A case for regulatory B cells. J. Immunol. 2006;176:705–710. [PubMed]
4. Fillatreau S, Sweenie CH, McGeachy MJ, Gray D, Anderton SM. B cells regulate autoimmunity by provision of IL-10. Nat. Immunol. 2002;3:944–950. [PubMed]
5. Mauri C, Gray D, Mushtaq N, Londei M. Prevention of arthritis by interleukin 10-producing B cells. The Journal of experimental medicine. 2003;197:489–501. [PMC free article] [PubMed]
6. Evans JG, Chavez-Rueda KA, Eddaoudi A, Meyer-Bahlburg A, Rawlings DJ, Ehrenstein MR, Mauri C. Novel suppressive function of transitional 2 B cells in experimental arthritis. J. Immunol. 2007;178:7868–7878. [PubMed]
7. Bouaziz J-D, Yanaba K, Tedder TF. Regulatory B cells as inhibitors of immune responses and inflammation. Immunological reviews. 2008;224:201–214. [PubMed]
8. Yanaba K, Bouaziz J-D, Haas KM, Poe JC, Fujimoto M, Tedder TF. A regulatory B cell subset with a unique CD1dhiCD5+ phenotype controls T cell-dependent inflammatory responses. Immunity. 2008;28:639–650. [PubMed]
9. Matsushita T, Yanaba K, Bouaziz J-D, Fujimoto M, Tedder TF. Regulatory B cells inhibit EAE initiation in mice while other B cells promote disease progression. J. Clin. Invest. 2008;118:3420–3430. [PMC free article] [PubMed]
10. Haas KM, Watanabe R, Matsushita T, Nakashima H, Ishiura N, Okochi H, Fujimoto M, Tedder TF. Protective and pathogenic roles for B cells during systemic autoimmunity in NZB/W F1 mice. J. Immunol. 2010;184:4789–4800. [PMC free article] [PubMed]
11. Watanabe R, Ishiura N, Nakashima H, Kuwano Y, Okochi H, Tamaki K, Sato S, Tedder TF, Fujimoto M. Regulatory B cells (B10 cells) have a suppressive role in murine lupus: CD19 and B10 cell deficiency exacerbates systemic autoimmunity. J. Immunol. 2010;184:4801–4809. [PMC free article] [PubMed]
12. Iwata Y, Matsushita T, Horikawa M, DiLillo DJ, Yanaba K, Venturi GM, Szabolcs PM, Bernstein SH, Magro CM, Williams AD, Hall RP, St.Clair EW, Tedder TF. Characterization of a rare IL-10-competent B cell subset in humans that parallels mouse regulatory B10 cells. Blood. 2011;117:530–541. [PMC free article] [PubMed]
13. Horikawa M, Minard-Colin V, Matsushita T, Tedder TF. Regulatory B lymphocyte production of IL-10 inhibits lymphoma depletion during CD20 immunotherapy in mice. J. Clin. Invest. 2011 in press. [PMC free article] [PubMed]
14. Saraiva M, O'Garra A. The regulation of IL-10 production by immune cells. Nat. Rev. Immunol. 2010;10:170–181. [PubMed]
15. Sugimoto K, Ogawa A, Shimomura Y, Nagahama K, Mizoguchi A, Bhan AK. Inducible IL-12-producing B cells regulate Th2-mediated intestinal inflammation. Gastroenterology. 2007;133:124–136. [PubMed]
16. Poe JC, Smith S-H, Haas KM, Yanaba K, Tsubata T, Matsushita T, Tedder TF. Amplified B lymphocyte CD40 signaling drives regulatory B10 cell expansion in mice. PLoS ONE. 2011;6:e22464. [PMC free article] [PubMed]
17. Yanaba K, Bouaziz J-D, Matsushita T, Tsubata T, Tedder TF. The development and function of regulatory B cells expressing IL-10 (B10 cells) requires antigen receptor diversity and TLR signals. J. Immunol. 2009;182:7459–7472. [PMC free article] [PubMed]
18. Matsushita T, Horikawa M, Iwata Y, Tedder TF. Regulatory B cells (B10 cells) and regulatory T cells have independent roles in controlling EAE initiation and late-phase immunopathogenesis. J. Immunol. 2010;185:2240–2252. [PMC free article] [PubMed]
19. Kamanaka M, Kim ST, Wan YY, Sutterwala FS, Lara-Tejero M, Galan JE, Harhaj E, Flavell RA. Expression of interleukin-10 in intestinal lymphocytes detected by an interleukin-10 reporter knockin tiger mouse. Immunity. 2006;25:941–952. [PubMed]
20. Maynard CL, Harrington LE, Janowski KM, Oliver JR, Zindl CL, Rudensky AY, Weaver CT. Regulatory T cells expressing interleukin 10 develop from Foxp3+ and Foxp3 precursor cells in the absence of interleukin 10. Nat. Immunol. 2007;8:931–941. [PubMed]
21. Sato S, Miller AS, Inaoki M, Bock CB, Jansen PJ, Tang MLK, Tedder TF. CD22 is both a positive and negative regulator of B lymphocyte antigen receptor signal transduction: altered signaling in CD22-deficient mice. Immunity. 1996;5:551–562. [PubMed]
22. Matsushita T, Tedder TF. Identifying regulatory B cells (B10 cells) that produce IL-10. Methods Mol. Biol. 2010;677:99–111. [PubMed]
23. Sha H, He Y, Chen H, Wang C, Zenno A, Shi H, Yang X, Zhang X, Qi L. The IRE1alpha-XBP1 pathway of the unfolded protein response is required for adipogenesis. Cell metabolism. 2009;9:556–564. [PMC free article] [PubMed]
24. Saito M, Novak U, Piovan E, Basso K, Sumazin P, Schneider C, Crespo M, Shen Q, Bhagat G, Califano A, Chadburn A, Pasqualucci L, Dalla-Favera R. BCL6 suppression of BCL2 via Miz1 and its disruption in diffuse large B cell lymphoma. Proceedings of the National Academy of Sciences of the United States of America. 2009;106:11294–11299. [PMC free article] [PubMed]
25. Todd DJ, McHeyzer-Williams LJ, Kowal C, Lee AH, Volpe BT, Diamond B, McHeyzer-Williams MG, Glimcher LH. XBP1 governs late events in plasma cell differentiation and is not required for antigen-specific memory B cell development. The Journal of experimental medicine. 2009;206:2151–2159. [PMC free article] [PubMed]
26. Engel P, Zhou L-J, Ord DC, Sato S, Koller B, Tedder TF. Abnormal B lymphocyte development, activation and differentiation in mice that lack or overexpress the CD19 signal transduction molecule. Immunity. 1995;3:39–50. [PubMed]
27. DiLillo DJ, Hamaguchi Y, Ueda Y, Yang K, Uchida J, Haas KM, Kelsoe G, Tedder TF. Maintenance of long-lived plasma cells and serological memory despite mature and memory B cell depletion during CD20 immunotherapy in mice. J. Immunol. 2008;180:361–371. [PubMed]
28. Rohatgi S, Ganju P, Sehgal D. Systematic design and testing of nested (RT-)PCR primers for specific amplification of mouse rearranged/expressed immunoglobulin variable region genes from small number of B cells. Journal of immunological methods. 2008;339:205–219. [PubMed]
29. Brochet X, Lefranc MP, Giudicelli V. IMGT/V-QUEST: the highly customized and integrated system for IG and TR standardized V-J and V-D-J sequence analysis. Nucleic Acids Res. 2008;36:W503–508. [PMC free article] [PubMed]
30. Chenna R, Sugawara H, Koike T, Lopez R, Gibson TJ, Higgins DG, Thompson JD. Multiple sequence alignment with the Clustal series of programs. Nucleic acids research. 2003;31:3497–3500. [PMC free article] [PubMed]
31. Laszlo G, Hathcock KS, Dickler HB, Hodes RJ. Characterization of a novel cell-surface molecule expressed on subpopulations of activated T and B cells. J. Immunol. 1993;150:5252–5262. [PubMed]
32. Sanderson RD, Lalor P, Bernfield M. B lymphocytes express and lose syndecan at specific stages of differentiation. Cell Reg. 1989;1:27–35. [PMC free article] [PubMed]
33. Yang Y, Tung JW, Ghosn EE, Herzenberg LA, Herzenberg LA. Division and differentiation of natural antibody-producing cells in mouse spleen. Proc. Natl. Acad. Sci., U. S. A. 2007;104:4542–4546. [PMC free article] [PubMed]
34. Rousset F, Garcia E, Defrance T, Peronne C, Vezzio N, Hsu DH, Kastelein R, Moore KW, Banchereau J. Interleukin 10 is a potent growth and differentiation factor for activated human B lymphocytes. Proc. Natl. Acad. Sci. USA. 1992;89:1890–1893. [PMC free article] [PubMed]
35. Briere F, Servet-Delprat C, Bridon JM, Saint-Remy JM, Banchereau J. Human interleukin 10 induces naive surface immunoglobulin D+ (sIgD+) B cells to secrete IgG1 and IgG3. The Journal of experimental medicine. 1994;179:757–762. [PMC free article] [PubMed]
36. Itoh K, Hirohata S. The role of IL-10 in human B cell activation, proliferation, and differentiation. J. Immunol. 1995;154:4341–4350. [PubMed]
37. Kantor AB, Merrill CE, Herzenberg LA, Hillson JL. An unbiased analysis of VH-D-JH sequences from B1-a, B1-b, and conventional B cells. J. Immunol. 1996;158:1175–1186. [PubMed]
38. Hardy RR, Carmack CE, Shinton SA, Riblet RJ, Hayakawa K. A single VH gene is utilized predominantly in anti-BrMRBC hybridomas derived from purified Ly-1 B cells. Definition of the VH11 family. J. Immunol. 1989;142:3643–3651. [PubMed]
39. Seidl KJ, MacKenzie JD, Wang D, Kantor AB, Kabat EA, Herzenberg LA, Herzenberg LA. Frequent occurrence of identical heavy and light chain Ig rearrangements. Int. Immunol. 1997;9:689–702. [PubMed]
40. Snapper CM, McIntyre TM, Mandler R, Pecanha LM, Finkelman FD, Lees A, Mond JJ. Induction of IgG3 secretion by interferon γ: a model for T cell-independent class switching in response to T cell-independent type 2 antigens. The Journal of experimental medicine. 1992;175:1367–1371. [PMC free article] [PubMed]
41. Bergqvist P, Gardby E, Stensson A, Bemark M, Lycke NY. Gut IgA class switch recombination in the absence of CD40 does not occur in the lamina propria and is independent of germinal centers. J. Immunol. 2006;177:7772–7783. [PubMed]
42. Cretney E, Xin A, Shi W, Minnich M, Masson F, Miasari M, Belz GT, Smyth GK, Busslinger M, Nutt SL, Kallies A. The transcription factors Blimp-1 and IRF4 jointly control the differentiation and function of effector regulatory T cells. Nat. Immunol. 2011;12:304–311. [PubMed]
43. Martins G, Calame K. Regulation and functions of Blimp-1 in T and B lymphocytes. Annu. Rev. Immunol. 2008;26:133–169. [PubMed]
44. Sciammas R, Shaffer AL, Schatz JH, Zhao H, Staudt LM, Singh H. Graded expression of interferon regulatory factor-4 coordinates isotype switching with plasma cell differentiation. Immunity. 2006;25:225–236. [PubMed]
45. Scapini P, Lamagna C, Hu Y, Lee K, Tang Q, DeFranco AL, Lowell CA. B cell-derived IL-10 suppresses inflammatory disease in Lyn-deficient mice. Proceedings of the National Academy of Sciences of the United States of America. 2011 in press. [PMC free article] [PubMed]
46. Ding Q, Yeung M, Camirand G, Zeng Q, Akiba H, Yagita H, Chalasani G, Sayegh MH, Najafian N, Rothstein DM. Regulatory B cells are identified by expression of TIM-1 and can be induced through TIM-1 ligation to promote tolerance in mice. J. Clin. Invest. 2011;121:3645–3656. [PMC free article] [PubMed]
47. Matsumoto M, Fujii Y, Baba A, Hikida M, Kurosaki T, Baba Y. The calcium sensors STIM1 and STIM2 control B cell regulatory function through interleukin-10 production. Immunity. 2011;34:703–714. [PubMed]
48. Madan R, Demircik F, Surianarayanan S, Allen JL, Divanovic S, Trompette A, Yogev N, Gu Y, Khodoun M, Hildeman D, Boespflug N, Fogolin MB, Grobe L, Greweling M, Finkelman FD, Cardin R, Mohrs M, Muller W, Waisman A, Roers A, Karp CL. Nonredundant roles for B cell-derived IL-10 in immune counter-regulation. J. Immunol. 2009;183:2312–2320. [PMC free article] [PubMed]
49. Neves P, Lampropoulou V, Calderon-Gomez E, Roch T, Stervbo U, Shen P, Kuhl AA, Loddenkemper C, Haury M, Nedospasov SA, Kaufmann SH, Steinhoff U, Calado DP, Fillatreau S. Signaling via the MyD88 adaptor protein in B cells suppresses protective immunity during Salmonella typhimurium infection. Immunity. 2010;33:777–790. [PubMed]
50. Oliver AM, Martin F, Kearney JF. IgMhighCD21high lymphocytes enriched in the splenic marginal zone generate effector cells more rapidly than the bulk of follicular B cells. J. Immunol. 1999;162:7198–7207. [PubMed]
51. Martin F, Oliver AM, Kearney JF. Marginal zone and B1 B cells unite in the early response against T-independent blood-borne particulate antigens. Immunity. 2001;14:617–629. [PubMed]
52. Mizoguchi A, Mizoguchi E, Smith RN, Preffer FI, Bhan AK. Suppressive role of B cells in chronic colitis of T cell receptor α mutant mice. The Journal of experimental medicine. 1997;186:1749–1756. [PMC free article] [PubMed]
53. Genestier L, Taillardet M, Mondiere P, Gheit H, Bella C, Defrance T. TLR agonists selectively promote terminal plasma cell differentiation of B cell subsets specialized in thymus-independent responses. J. Immunol. 2007;178:7779–7786. [PubMed]
54. Lampropoulou V, Calderon-Gomez E, Roch T, Neves P, Shen P, Stervbo U, Boudinot P, Anderton SM, Fillatreau S. Suppressive functions of activated B cells in autoimmune diseases reveal the dual roles of Toll-like receptors in immunity. Immunological reviews. 2010;233:146–161. [PubMed]
55. Jiang C, Zhao ML, Scearce RM, Diaz M. Activation-induced deaminase-deficient MRL/lpr mice secrete high levels of protective antibodies against lupus nephritis. Arthritis Rheum. 2011;63:1086–1096. [PMC free article] [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...