• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of iaiPermissionsJournals.ASM.orgJournalIAI ArticleJournal InfoAuthorsReviewers
Infect Immun. Aug 2011; 79(8): 3302–3308.
PMCID: PMC3147554

Glycogen Synthase Kinase 3 Activation Is Important for Anthrax Edema Toxin-Induced Dendritic Cell Maturation and Anthrax Toxin Receptor 2 Expression in Macrophages [down-pointing small open triangle]

J. B. Bliska, Editor

Abstract

Anthrax edema toxin (ET) is one of two binary toxins produced by Bacillus anthracis that contributes to the virulence of this pathogen. ET is an adenylate cyclase that generates high levels of cyclic AMP (cAMP), causing alterations in multiple host cell signaling pathways. We previously demonstrated that ET increases cell surface expression of the anthrax toxin receptors (ANTXR) in monocyte-derived cells and promotes dendritic cell (DC) migration toward the lymph node-homing chemokine MIP-3β. In this work, we sought to determine if glycogen synthase kinase 3 (GSK-3) is important for ET-induced modulation of macrophage and DC function. We demonstrate that inhibition of GSK-3 dampens ET-induced maturation and migration processes of monocyte-derived dendritic cells (MDDCs). Additional studies reveal that the ET-induced expression of ANTXR in macrophages was decreased when GSK-3 activity was disrupted with chemical inhibitors or with small interfering RNA (siRNA) targeting GSK-3. Further examination of the ET induction of ANTXR revealed that a dominant negative form of CREB could block the ET induction of ANTXR, suggesting that CREB or a related family member was involved in the upregulation of ANTXR. Because CREB and GSK-3 activity appeared to be important for ET-induced ANTXR expression, the impact of GSK-3 on ET-induced CREB activity was examined in RAW 264.7 cells possessing a CRE-luciferase reporter. As with ANTXR expression, the ET induction of the CRE reporter was decreased by reducing GSK-3 activity. These studies not only provide insight into host pathways targeted by ET but also shed light on interactions between GSK-3 and CREB pathways in host immune cells.

INTRODUCTION

Bacillus anthracis secretes three proteins that combine to form two distinct exotoxins, edema toxin (ET) and lethal toxin (LT). ET and LT share a receptor-binding subunit, protective antigen (PA), which targets one of two related host cell surface receptors, anthrax toxin receptor 1 (ANTXR1) and anthrax toxin receptor 2 (ANTXR2), and promotes translocation of the catalytic subunits lethal factor (LF) and edema factor (EF) into the host cytosol (49). EF, the catalytic component of ET, is a calcium- and calmodulin-dependent adenylate cyclase that generates high levels of cyclic AMP (cAMP) in intoxicated cells (24, 25).

ET has been proposed to modulate both innate and adaptive immune responses during the initial stages and progression of anthrax disease (32, 34, 41, 42). In addition, ET induces cellular and histopathological changes that are consistent with circulatory shock associated with anthrax (6, 21, 46). In contrast to earlier findings, it is now known that ET induces cell death in certain cell types and is lethal to mice (9, 10, 15, 44). These effects of ET are linked to the ability of this toxin to increase intracellular cAMP levels in a manner that alters normal host cell signaling pathways and cellular function.

Cyclic AMP is a second messenger that contributes to the regulation of several intracellular signaling cascades via multiple downstream effectors, including protein kinase A (PKA). High levels of cAMP generated by ET activate PKA, leading to upregulation of the ANTXR genes in monocyte-derived cells and inhibition of phospholipase A2 (sPLA-IIA) in macrophages (5, 29, 38, 47). PKA-induced transcriptional changes are mediated through modulation of various transcription factors, including the cAMP-responsive element binding (CREB) protein, which promotes formation of transcription complexes at CRE sequences present in cAMP-responsive genes (31). Results from multiple studies indicate that ET can induce both CREB-dependent and -independent transcriptional changes (20, 35, 37, 38, 48). CREB-mediated responses to ET lead to dysregulation of macrophage migration and survival (20, 35), both of which are critical processes that contribute to the outcome of infection.

CREB transcriptional activity is modulated by multiple kinases, including PKA, mitogen-activated protein kinase (MAPK), ribosomal S6 kinase (RSK), AKT, and glycogen synthase kinase 3 (GSK-3) (4, 7, 13, 36). GSK-3 is a key regulatory component of cellular processes, including cellular structure, growth, motility, and apoptosis (19). Two isoforms of GSK-3 exist, GSK-3α and GSK-3β; these are highly homologous in the kinase domain, although little is known about their distinct contributions to cell physiology (19). We recently demonstrated that ET activates the nuclear pools of GSK-3β in a PKA-dependent manner (22). Targeting of the nuclear pools of GSK-3β by ET bypasses the upstream cytoplasmic inactivation of this kinase, suggesting an additional mechanism by which ET may alter host cell function.

PKA phosphorylation of CREB creates a consensus site for phosphorylation by GSK-3β (8), suggesting that the combined activation of these two kinases may be necessary for ET to completely modulate CREB activity. Yet, the functional consequence of the phosphorylation of CREB by GSK-3β is still not clear. Several studies suggest that GSK-3β promotes the activation of CREB (8, 16, 43), while others indicate that phosphorylation of CREB by GSK-3β negatively regulates DNA binding activity (4, 14, 30, 33, 50). Given that ET activates both PKA and GSK-3β, it is possible that toxin-induced CREB transcriptional activity is influenced by the activities of these two kinases.

We previously demonstrated that ET promotes monocyte-derived dendritic cell (MDDC) maturation and migration in a cAMP-dependent manner (28) and induces ANTXR expression in monocyte-derived cells through cAMP and PKA (29). Consistent with a role for CREB in these processes, ET-induced migration of macrophages requires CREB-dependent expression of syndecan-1 (20), and consensus cAMP response elements are present upstream of the ANTXR genes (51). Because ET activates GSK-3β and CREB in a PKA-dependent manner in macrophages (22), we hypothesized that ET-induced ANTXR expression (29) and modulation of MDDC maturation and migration are GSK-3β and CREB dependent. Here we test this hypothesis and investigate the role of GSK-3 and CREB in ET-mediated responses in monocyte-derived cells.

MATERIALS AND METHODS

Reagents and toxins.

Lipopolysaccharide (LPS) from Escherichia coli and polymyxin B were purchased from Sigma-Aldrich. Lithium chloride (LiCl) and BIO [(2′Z,3′E)-6-bromoindirubin-3′-oxime] were purchased from EMD Chemicals. PA expression plasmid PA-pET22b was kindly provided by John Collier (Harvard Medical School) and transformed into E. coli BL21(DE3) cells. A fresh colony was inoculated into a 20-ml starter culture of Luria-Bertani (LB) Lennox medium (EMD Biosciences, Inc.) with 100 μg/ml ampicillin (EMD Chemicals) and grown overnight at 37°C. The following day, a 1:50 dilution was made into a 2-liter baffled Erlenmeyer flask of LB Lennox medium with 100 μg/ml ampicillin. The culture was allowed to grow at 37°C with shaking at 250 rpm until an optical density of 1.0 was reached. The culture was then induced with a final concentration of 1 mM isopropyl β-d-1-thiogalactopyranoside (IPTG) (Gold BioTechnology) and allowed to grow at 30°C with shaking at 250 rpm for 4 h. PA was isolated from the periplasm and purified over a macroprep HighQ (Bio-Rad) column. EF expression plasmid EF-pET15b was transformed into E. coli BL21(DE3) cells for protein expression. EF was produced and purified as described previously (44) using Ni+ affinity chromatography. Endotoxin was removed from PA and EF protein preparations using Detoxi-Gel endotoxin removing gel (Pierce). Purified proteins were assayed for endotoxin using a limulus amebocyte lysate kit (BioWhittaker) that has a detection minimum of 0.03 endotoxin units/ml.

Subcloning of ACREB.

The CMV-500-ACREB vector (39) was kindly provided by C. Vinson (NIH). ACREB was PCR amplified using the forward primer CAAGCAGATCTATGGACTACAAGGACGACGATGACAAG (underlined is the BglII restriction site) and the reverse primer CTCTAGGAATTCGAATTAATCTGACTTGTGGCAGTAAAG (underlined is the EcoRI restriction site). PCR, with a mixture containing 20 ng of template plasmid DNA and 200 nM each primer, was carried out as follows: 98°C for 3 min, followed by 30 cycles at 98°C for 15 s, 59°C for 30 s, and 72°C for 1 min, and ending with 1 cycle at 72°C for 5 min. The PCR product was then digested with EcoRI and BglII, gel purified, and subcloned into the retroviral vector pMIGR1 (kindly provided by Philip G. Ashton-Rickardt [26]).

Cell lines.

RAW 264.7 and HEK-293 cells (American Type Culture Collection [ATCC]) were cultured in Dulbecco's modification of Eagle's medium (DMEM) (Cellgro) containing 10% fetal bovine serum (FBS) and penicillin-streptomycin-glutamine (PSG) cocktail (Invitrogen).

Generation of ACREB-expressing RAW 264.7 cells.

pMIGR1 and ACREB plasmids were each cotransfected into HEK-293 cells with murine leukemia virus (MLV) gag/pol and vesicular stomatitis virus G (VSV-G) expression plasmids pMD.gagpol and pMD.G, respectively (3). Forty-eight hours later, the resulting retroviral particles were harvested from the medium by filtration and used to transduce RAW 264.7 cells at a multiplicity of infection (MOI) greater than or equal to one. Virus was diluted 1:1 in medium with 8 μg/ml Polybrene (Sigma) and added to 2.0 × 105 cells per well of a 12-well plate. The plate containing the cell and virus mixture was then centrifuged for 2 h at 1,200 × g at 25°C. Following centrifugation, cells were incubated for an additional 6 h at 37°C with 5% CO2. Virus was then removed, and fresh medium without virus or Polybrene was added to the cells. Forty-eight hours after infection, cells were used for the experiments described in the figure legends.

Knocking down GSK-3 with siRNA.

RAW 264.7 cells were transfected with small interfering RNA (siRNA) using the transfection reagent HiPerFect (Qiagen) by following a modified version of the manufacturer's protocol for RAW 264.7 cells. Briefly, 6 × 105 cells in 800 μl of DMEM with 10% FBS were plated into a well of a 6-well plate. Immediately after the cells were plated, the transfection mixture containing siRNA and 24 μl of HiPerFect was prepared in 800 μl of Opti-MEM (Invitrogen). After a 10-min incubation, the transfection mixture was added to the cells to a final volume of 1.6 ml and an siRNA concentration of 50 nM. After a 6-h exposure, the medium containing the transfection mixture was removed and replaced with fresh DMEM containing 10% FBS. The siRNAs against GSK-3 (no. 6301) were purchased from Cell Signaling Technology. As a negative control, cells were transfected with a scrambled sequence not targeting any known gene (sc-37007; Santa Cruz).

Generation of RAW 264.7 cells expressing luciferase gene reporters.

To create luciferase-based gene reporters, RAW 264.7 cells were transduced with lentivirus particles (SABioscience) containing a luciferase reporter gene with a minimal promoter plus CRE enhancer elements (CRE), a minimal promoter with NF-κB enhancer elements (NF-κB), a minimal promoter with no enhancer elements (Neg), or a promoter with cytomegalovirus (CMV) enhancer/promoter elements (CMV). To infect the RAW 264.7 cells, the lentiviral particles (MOI of ~10) plus 8 μg/ml Polybrene were added to cells plated at 5.0 × 104 cells per well in a 12-well plate and incubated for 24 h at 32°C. The virus was then removed, and 3.5 μg/ml of puromycin was used for the selection of stable cells. The puromycin-resistant cells were maintained in culture medium containing puromycin until a day before experiments were performed.

Generation of MDDCs.

Monocytes were either kindly provided by B. Lee (UCLA) or isolated from peripheral blood obtained from healthy donors through the Virology Core of the UCLA AIDS Institute (institutional review board [IRB] approval no. 06-06-102). Monocytes were purified using RosetteSep monocyte enrichment cocktail (StemCell) according to manufacturer's protocol. Approximately 5.0 × 106 cells were seeded onto a 100-mm dish and differentiated in RPMI 1640 medium (Invitrogen) containing 10% FBS and PSG plus 50 ng/ml granulocyte-macrophage colony-stimulating factor (GM-CSF) and 100 ng/ml interleukin 4 (IL-4) (PeproTech). Fresh medium and cytokines were added on day 4, and cultures were maintained for an additional 3 days to complete differentiation. At day 7, nonadherent cells were collected and combined with adherent cells released with calcium- and magnesium-free Dulbecco's phosphate-buffered saline (DPBS) (Cellgro) plus 1 mM EDTA. Approximately 4.0 × 105 cells per well were seeded onto a 12-well plate and treated as indicated in the figure legends in the presence of 50 ng/ml GM-CSF and 100 ng/ml IL-4.

RNA isolation and quantitative analysis of mouse Antxr2 and Sdc1 gene transcript levels.

RAW 264.7 cells were toxin treated and incubated as indicated in the figure legends. RNA was isolated using Trizol reagent (Invitrogen) and treated with RQ1 RNase-free DNase (Promega), following the manufacturer's protocol. Quantitative analysis of mouse Antxr2 transcript levels was performed as described previously (2). To measure Sdc1 transcript levels, cDNA was synthesized from total RNA using SuperScript III (Invitrogen) according to the conditions suggested by the manufacturer. The resulting cDNA was combined with Power SYBR green PCR master mix (ABI) and primer pairs specific for mouse Sdc1 (GAAGATCAGGATGGCTCTGG and TGCCGTGACAAAGTATCTGG) or mouse Actb (GACGGCCAGGTCATCACTATTG and CCACAGGATTCCATACCCAAGA). Amplification was performed with an Applied Biosystems 7500 real-time PCR system, and the comparative cycle at threshold (2−ΔΔCT) method (27) was used to determine relative changes in Sdc1 mRNA levels compared to Actb mRNA levels.

Analysis of cell surface phenotype and PA binding.

Binding of Alexa Fluor 647-labeled PA(E733C) (AFPA) to ET-treated cells was determined using a previously described flow cytometry-based assay (2). Briefly, cells were harvested after ET treatment by scraping, washed with PBS, and stained for 1 h on ice with 80 nM AFPA diluted in medium. Cells were then washed twice with PBS and fixed in 1% paraformaldehyde. Analysis of cell surface phenotype markers for MDDCs was performed using flow cytometry. Cells were harvested by scraping, washed with PBS, and then stained for 1 h on ice with 80 nM AFPA and the following directly conjugated antibodies diluted in medium as per manufacturer's suggestions: anti-DC-SIGN-fluorescein isothiocyanate (FITC) (R&D Systems), anti-CD14-phycoerythrin (PE) (Caltag), anti-CD83-allophycocyanin (APC) (Caltag), and anti-CD86-FITC (Caltag). Cells were then washed twice with PBS and fixed in 1% paraformaldehyde. Stained MDDCs were analyzed for the relative amount of bound PA and/or cell surface marker expression using a FACSCalibur (BD), and data were analyzed using Cell Quest (BD) and FlowJo (Tree Star, Inc.) software.

Chemotaxis assay.

MDDCs were treated as indicated in the figure legends for 48 h. Following treatment, cells were collected from wells and counted. For the chemotaxis assay, RPMI 1640 medium containing 3% FBS and PSG plus 50 ng/ml GM-CSF, 100 ng/ml IL-4, and 200 ng/ml MIP-3β (PeproTech) was added to the bottom of a 24-well plate. MDDCs (2.5 × 104 per well) for each treatment condition (in triplicate) were added to the top of an uncoated insert with a pore size of 5 μm (Costar) in serum-free RPMI 1640 containing PSG plus 50 ng/ml GM-CSF and 100 ng/ml IL-4. Cells were allowed to migrate for 4 h at 37°C. Inserts were then removed, cells that had not migrated were aspirated off the top, and cells that had migrated and were adherent to the bottom of inserts were removed with trypsin (Invitrogen). Cells that migrated to the bottom well were collected and pooled with the trypsinized cells. Pooled migrated cells were stained with trypan blue (Invitrogen) and counted using a hemocytometer. Statistical analysis was performed as described in the figure legends using GraphPad PRISM 4 (GraphPad Software, Inc.) software.

Luciferase assay.

RAW 264.7 cells transduced with CRE (RAW-CRE), NF-κB (RAW-NF-κB), Neg (RAW-Neg), or CMV (RAW-CMV) luciferase reporter were exposed to experimental conditions described in the figure legends. The luciferase expression levels in these reporter cell lines were quantified using a luciferase assay system (Promega) followed by measurement of luminescence signal with a Victor3 (Perkin Elmer) plate reader. Luciferase expression in the negative control (RAW-Neg) was used to normalize for changes to the minimal promoter that are not dependent on the CRE or NF-κB element.

WCE and immunoblotting.

Following treatment as indicated in the figure legends, cells were incubated on ice for 15 min in lysis buffer containing 1% SDS, 50 mM Tris, pH 7.4, 5 mM EDTA, protease inhibitor cocktail (Sigma-Aldrich), phosphatase inhibitors (Active Motif), and 10 mM N-ethylmaleimide. Following incubation on ice, cells were passed through a 22-gauge needle 10 times, and protein determination was then performed on the resulting whole-cell extracts (WCE) using a Bio-Rad DC protein assay. SDS-PAGE and immunoblotting were performed using 10 μg of WCE, and membranes were then probed with primary antibodies and subsequently incubated with the appropriate secondary antibodies conjugated to horseradish peroxidase. To detect the secondary antibody signal, the immunoblot was subjected to an enhanced chemiluminescent protein development system (GE Healthcare), and the bands were imaged by exposing the immunoblot to film. The film was scanned, and bands on the resulting digitized images were quantified by densitometry using ImageJ 1.37V software (Wayne Rasband, National Institutes of Health). To probe the phosphorylation state of CREB at Ser-129, a rabbit polyclonal antibody directed against both phosphorylated Ser-133 (p-Ser-133) and p-Ser-129 (Invitrogen) was preincubated with a blocking peptide directed against the p-Ser-133 site (Santa Cruz). This approach absorbed the antibodies recognizing only the p-Ser-133 site before use in the Western blot analysis. Primary antibodies against GSK-3β, CREB, and p-Ser-133 CREB were purchased from Cell Signaling Technology. The primary antibody against GAPDH (glyceraldehyde-3-phosphate dehydrogenase) was purchased from Abcam.

RESULTS

GSK-3 is required for ET-induced maturation and migration of MDDCs.

Based on the finding that ET (28) and GSK-3 (40) both mediate DC maturation, we sought to determine if GSK-3 signaling plays a role in these ET-induced phenotypes. To monitor the effects of GSK-3 on DC maturation, we exposed the DCs to a standard inhibitor of GSK-3, LiCl, and then measured cell surface expression of DC-SIGN, a marker of immature DCs, and two markers, CD83 and CD86, which increase their surface expression upon DC maturation. Interestingly, LiCl treatment alone decreased DC-SIGN surface expression in all donors tested, similar to the decrease observed upon either LPS or ET treatment (Fig. 1A). In contrast, increases in surface expression of CD83 induced by LPS or ET, as well as increased expression of CD86 induced by LPS, were inhibited in the presence of LiCl (Fig. 1A). Although results failed to reach statistical significance, we observed a trend toward inhibition of ET-induced CD86 expression upon treatment with LiCl (Fig. 1A). Two out of five donors analyzed showed no LiCl effect on ET-mediated CD86 expression, likely contributing to the lack of significance.

Fig. 1.
GSK-3 is required for MDDC maturation and chemotaxis. (A and B) With or without a 2-h pretreatment with LiCl, MDDCs were left untreated (NT), treated with 100 ng/ml LPS, or treated with 100 ng/ml PA plus 100 ng/ml EF (ET). To remove residual endotoxin, ...

We next sought to determine the effect of GSK-3 inhibition on ET-induced MDDC migration toward the lymph node-homing chemokine MIP-3β (28). Previous studies demonstrated that DC migration induced by E. coli is dampened in the presence of GSK-3 inhibitors (40). Consistent with these findings, LiCl treatment inhibited both LPS- and ET-induced migration toward MIP-3β (Fig. 1B). Given the role of ET in promoting both MDDC and macrophage migration (20, 28), we also measured the effect of GSK-3 inhibition in syndecan-1 (Sdc1) expression in RAW 264.7 cells. Sdc1 was recently implicated as playing a crucial role in ET-induced macrophage migration, and its expression is induced upon exposure to this toxin (20). Inhibition of GSK-3 with LiCl or BIO, which are established GSK-3 inhibitors, reduced the ET-induced expression of Sdc1 mRNA (Fig. 1C). Taken together, these data suggest that GSK-3 is involved in maturation and function of MDDCs and the migratory process of both MDDCs and macrophages.

GSK-3 inhibitors block ET-induced ANTXR expression.

To test whether GSK-3 activation is required for the increase in ANTXR expression induced by ET, RAW 264.7 cells were pretreated for 2 h with the GSK-3 inhibitor LiCl, followed by a 6-h treatment with ET. As previously shown (29), ET treatment in the absence of LiCl led to an increase in Antxr2 mRNA expression levels and PA binding in RAW 264.7 cells (Fig. 2 A and B). Interestingly, pretreatment of cells with LiCl completely inhibited the increase in both Antxr2 mRNA expression and PA binding (Fig. 2A and B). Treatment with a second GSK-3 inhibitor, BIO, also dampened the ET-induced PA binding in RAW 264.7 cells (Fig. 2C). To further test a role for GSK-3 in ET-induced Antxr2 expression, we employed siRNAs targeting GSK-3α/β. Transfection of GSK-3α/β-specific siRNAs led to an ~40% reduction in expression in GSK-3β (Fig. 2D). This reduced GSK-3α/β expression was sufficient to repress the ET-induced increase in PA binding by 30% (Fig. 2E). Taken together, these results suggest that GSK-3 is involved in ANTXR expression in RAW 264.7 cells.

Fig. 2.
GSK-3 is involved in the increase in ANTXR expression induced by ET. (A and B) RAW 264.7 cells were pretreated with 20 mM LiCl for 2 h, followed by a 6-h treatment with 100 ng/ml PA plus 100 ng/ml EF (ET) or no treatment (NT). (A) Following treatment, ...

ET-induced ANTXR expression is inhibited by a dominant negative form of CREB.

To address the role of CREB in ANTXR expression, we made use of a dominant negative CREB, ACREB. ACREB forms dimers with endogenous CREB or related family members, and these resulting heterodimers are then unable to bind DNA and activate transcription (1). Overexpression of ACREB reduced ET-mediated luciferase expression in RAW 264.7 cells in which luciferase is driven by a CREB-responsive promoter (RAW-CRE cells) (Fig. 3A). In contrast, expression of ACREB did not alter LPS-mediated NF-κB activation, indicating that this dominant negative inhibitor is specific for the CREB pathway (Fig. 3A). Expression of ACREB in RAW 264.7 cells blocked the increase in both Antxr2 mRNA level and PA binding induced by ET, compared with the result for ET-treated cells transduced with empty vector (Fig. 3B and C). Therefore, the activation of CREB or a CREB family member is required for the ET-induced increase in ANTXR expression.

Fig. 3.
ACREB inhibits increase in ANTXR expression induced by ET. (A) RAW-CRE and RAW-NF-κB cells were transduced with MIGR1 or ACREB virus as described in Materials and Methods. Forty hours after transduction, cells were treated for 6 h with either ...

Interaction between GSK-3 and CREB.

Because experiments utilizing ACREB suggest that CREB is involved in ANTXR expression, the ability of GSK-3 to impact CREB was examined. CREB activity is regulated via phosphorylation mediated by different kinases, including PKA and GSK-3 (8, 18, 31). However, the functional consequence of the GSK-3-mediated CREB phosphorylation is still not clear (4, 8, 14). Interestingly, GSK-3 inhibitors LiCl and BIO both reduced CREB-mediated expression of luciferase in ET-treated RAW-CRE cells (Fig. 4A), consistent with these inhibitors blocking Antxr2 and Sdc1 expression (Fig. 1C and and2).2). LiCl and BIO did not inhibit a luciferase reporter under the control of the CMV promoter (RAW-CMV), indicating that these inhibitors do not nonspecifically block transcription or luciferase activity (Fig. 4B). Additionally, transfection of cells with siRNA targeting GSK-3α/β significantly reduced levels of ET-dependent luciferase production in the RAW-CRE cells (Fig. 4C), consistent with the level of repression of ET-induced PA binding observed in cells containing GSK-3α/β siRNAs (Fig. 2).

Fig. 4.
Interactions between GSK-3 and CREB. (A and B) RAW-Neg, RAW-CRE, or RAW-CMV cells were treated for 24 h with 1 μg/ml PA plus 1 μg/ml EF (ET) or untreated (NT), with or without 20 mM LiCl or 5 μM BIO. Following treatment, cell extracts ...

Next we examined the mechanism by which GSK-3 inhibition reduces CREB activity. Treatment with GSK-3 inhibitors did not reduce PKA-dependent phosphorylation of CREB at Ser-133 (Fig. 4D) (13). Next, we observed that ET stimulated the phosphorylation of CREB at Ser-129 (Fig. 4D and E), which is a known GSK-3 target. The addition of GSK-3 inhibitors led to a decrease in ET-stimulated phosphorylation of CREB at Ser-129 (Fig. 4D and E) that correlates with decreased expression of CRE-luciferase, Antxr2, and Sdc1 (Fig. 1 and and2).2). Taken together, these data indicate that GSK-3 activity is needed to fully activate CREB.

DISCUSSION

In the present work, we characterize the signaling mechanisms activated by ET that alter monocyte function, including MDDC maturation and migration, and expression of Antxr2 in macrophages. We previously demonstrated that ET promotes maturation and migration of MDDCs and that this response is cAMP dependent (28). Here we expand on this finding and demonstrate that inhibition of GSK-3 dampens both the ET- and LPS-induced maturation and migration processes of MDDCs. Further, ET-induced expression of Sdc1, a gene required for macrophage migration (20), is reduced by GSK-3 inhibitors. Finally, ET-induced expression of Antxr2 is decreased by expression of a dominant negative form of CREB, suggesting that CREB or a related protein is important for the ET-induced expression of Antxr2. Together, these findings suggest that GSK-3 and CREB are required for propagation of ET-mediated signaling, resulting in alteration of normal host cell functions.

Our finding that ET promotes Antxr2 expression in a GSK-3- and CREB-dependent manner led us to reason that GSK-3 might be responsible, in part, for CREB activation. Indeed, GSK-3β can phosphorylate CREB at serine 129 (8). However, the current literature suggests two apparently contradictory consequences of this phosphorylation. Several groups have reported that GSK-3β phosphorylation of CREB (Ser-129) results in increased trans-activation by a GAL4-CREB fusion protein (8, 16, 43). These data suggest that phosphorylated CREB (Ser-129) has an increased ability to interact with additional transcription factors and promote gene expression. Consistent with this, phosphorylation at Ser-129 alters CREB protein conformation and surface charge (4), potentially altering protein-protein interactions. Indeed, inhibition of GSK-3 was reported to either reduce (16) or increase (30) binding of CBP to CREB. In support of a model in which Ser-129 phosphorylation plays a positive role in CREB-dependent gene expression, a recent study revealed that phosphorylation of Ser-129 promoted transcription by helping to stabilize a CREB-containing protein complex consisting of coactivators and the homobox protein MEIS1 (45). In contrast, other studies demonstrate that activation of GSK-3 and/or phosphorylation of CREB (Ser-129) reduces the affinity of CREB for DNA, which the authors interpret as decreased CREB activity (4, 14, 30, 33). To assay CREB activity directly, we and others (16) demonstrate that inhibition of GSK-3 blocks the ability of cAMP to induce expression from a CRE-luciferase reporter construct. In addition, treatment with either LiCl or BIO inhibited ET-induced expression of two CREB-dependent genes, Sdc1 (Fig. 1C) and Antxr2 (Fig. 2). Importantly, GSK-3 inhibitors reduced phosphorylation of CREB (Ser-129) but did not block the ET-induced PKA-mediated phosphorylation of CREB at Ser-133 (Fig. 4). Therefore, activation of CREB by PKA may not be sufficient for target gene expression, and our data suggest an activating role for GSK-3-mediated phosphorylation of CREB at Ser-129. However, our results do not exclude the possibility that GSK-3 may enhance CREB activity by phosphorylating CREB coactivators or sites on CREB in addition to Ser-129.

Although GSK-3 is commonly considered a constitutively active kinase, it is inactivated by phosphorylation at Ser-9 in the presence of serum (14) and is predominantly inactive in primary human macrophages (17). Interestingly, LPS treatment of macrophages results in further inactivation of GSK-3 (30), while treatment with ET results in activation of the nuclear pool of GSK-3 (22). Therefore, although MDDC activation and migration induced by LPS and ET appear similar in many respects (Fig. 1), the signal transduction pathways induced by each are likely distinct.

In summary, we demonstrate that ET promotes ANTXR expression through activation of GSK-3 and CREB and that GSK-3 is involved in the maturation and migration of MDDCs induced by this toxin. The ability of ET and other cAMP-inducing stimuli to promote MDDC maturation (11, 12, 23, 28) and our observation of GSK-3 involvement in the ET-mediated response suggest that other cAMP-inducing agents may also act through GSK-3. Altogether, these studies reveal mechanisms by which ET hijacks signaling pathways to alter host cell function and provide insight into functional interactions between GSK-3 and CREB.

ACKNOWLEDGMENTS

This work was funded by NIH award AI057870 (K.A.B.) and NIH/NIAID grant U19 AI062629-6 (J.D.B.). F.J.M.-A. was supported by NIH award 5F31AI061837-03. We also acknowledge support of the UCLA Jonsson Comprehensive Cancer Center (JCCC) and the UCLA AIDS Institute and the flow cytometry, virology, and mucosal immunology cores, which are supported by NIH awards CA-16042 and AI-28697 (UCLA-CFAR grant), the UCLA AIDS Institute, and the David Geffen School of Medicine at UCLA.

Footnotes

[down-pointing small open triangle]Published ahead of print on 16 May 2011.

REFERENCES

1. Ahn S., et al. 1998. A dominant-negative inhibitor of CREB reveals that it is a general mediator of stimulus-dependent transcription of c-fos. Mol. Cell. Biol. 18:967–977 [PMC free article] [PubMed]
2. Banks D. J., Barnajian M., Maldonado-Arocho F. J., Sanchez A. M., Bradley K. A. 2005. Anthrax toxin receptor 2 mediates Bacillus anthracis killing of macrophages following spore challenge. Cell. Microbiol. 7:1173–1185 [PubMed]
3. Bradley K. A., et al. 2003. Binding of anthrax toxin to its receptor is similar to alpha integrin-ligand interactions. J. Biol. Chem. 278:49342–49347 [PubMed]
4. Bullock B. P., Habener J. F. 1998. Phosphorylation of the cAMP response element binding protein CREB by cAMP-dependent protein kinase A and glycogen synthase kinase-3 alters DNA-binding affinity, conformation, and increases net charge. Biochemistry 37:3795–3809 [PubMed]
5. Comer J. E., et al. 2006. Murine macrophage transcriptional and functional responses to Bacillus anthracis edema toxin. Microb. Pathog. 41:96–110 [PubMed]
6. Cui X., et al. 2007. Bacillus anthracis edema and lethal toxin have different hemodynamic effects but function together to worsen shock and outcome in a rat model. J. Infect. Dis. 195:572–580 [PubMed]
7. Du K., Montminy M. 1998. CREB is a regulatory target for the protein kinase Akt/PKB. J. Biol. Chem. 273:32377–32379 [PubMed]
8. Fiol C. J., et al. 1994. A secondary phosphorylation of CREB341 at Ser129 is required for the cAMP-mediated control of gene expression. A role for glycogen synthase kinase-3 in the control of gene expression. J. Biol. Chem. 269:32187–32193 [PubMed]
9. Firoved A. M., et al. 2005. Bacillus anthracis edema toxin causes extensive tissue lesions and rapid lethality in mice. Am. J. Pathol. 167:1309–1320 [PMC free article] [PubMed]
10. Firoved A. M., et al. 2007. Anthrax edema toxin sensitizes DBA/2J mice to lethal toxin. Infect. Immun. 75:2120–2125 [PMC free article] [PubMed]
11. Gagliardi M. C., et al. 2000. Cholera toxin induces maturation of human dendritic cells and licences them for Th2 priming. Eur. J. Immunol. 30:2394–2403 [PubMed]
12. Galgani M., et al. 2004. Cyclic AMP modulates the functional plasticity of immature dendritic cells by inhibiting Src-like kinases through protein kinase A-mediated signaling. J. Biol. Chem. 279:32507–32514 [PubMed]
13. Gonzalez G. A., Montminy M. R. 1989. Cyclic AMP stimulates somatostatin gene transcription by phosphorylation of CREB at serine 133. Cell 59:675–680 [PubMed]
14. Grimes C. A., Jope R. S. 2001. CREB DNA binding activity is inhibited by glycogen synthase kinase-3 beta and facilitated by lithium. J. Neurochem. 78:1219–1232 [PMC free article] [PubMed]
15. Hong J., et al. 2005. Anthrax edema factor potency depends on mode of cell entry. Biochem. Biophys. Res. Commun. 335:850–857 [PubMed]
16. Horike N., et al. 2008. AMP-activated protein kinase activation increases phosphorylation of glycogen synthase kinase 3beta and thereby reduces cAMP-responsive element transcriptional activity and phosphoenolpyruvate carboxykinase C gene expression in the liver. J. Biol. Chem. 283:33902–33910 [PMC free article] [PubMed]
17. Hu X., et al. 2006. IFN-gamma suppresses IL-10 production and synergizes with TLR2 by regulating GSK3 and CREB/AP-1 proteins. Immunity 24:563–574 [PubMed]
18. Johannessen M., Delghandi M. P., Moens U. 2004. What turns CREB on? Cell. Signal. 16:1211–1227 [PubMed]
19. Jope R. S., Johnson G. V. 2004. The glamour and gloom of glycogen synthase kinase-3. Trends Biochem. Sci. 29:95–102 [PubMed]
20. Kim C., et al. 2008. Antiinflammatory cAMP signaling and cell migration genes co-opted by the anthrax bacillus. Proc. Natl. Acad. Sci. U. S. A. 105:6150–6155 [PMC free article] [PubMed]
21. Kuo S. R., et al. 2007. Anthrax toxin-induced shock in rats is associated with pulmonary edema and hemorrhage. Microb. Pathog. 44:467–472 [PubMed]
22. Larabee J. L., DeGiusti K., Regens J. L., Ballard J. D. 2008. Bacillus anthracis edema toxin activates nuclear glycogen synthase kinase 3beta. Infect. Immun. 76:4895–4904 [PMC free article] [PubMed]
23. la Sala A., et al. 2001. Extracellular ATP induces a distorted maturation of dendritic cells and inhibits their capacity to initiate Th1 responses. J. Immunol. 166:1611–1617 [PubMed]
24. Leppla S. H. 1982. Anthrax toxin edema factor: a bacterial adenylate cyclase that increases cyclic AMP concentrations of eukaryotic cells. Proc. Natl. Acad. Sci. U. S. A. 79:3162–3166 [PMC free article] [PubMed]
25. Leppla S. H. 1984. Bacillus anthracis calmodulin-dependent adenylate cyclase: chemical and enzymatic properties and interactions with eucaryotic cells. Adv. Cyclic Nucleotide Protein Phosphorylation Res. 17:189–198 [PubMed]
26. Liu N., et al. 2003. NF-kappaB protects from the lysosomal pathway of cell death. EMBO J. 22:5313–5322 [PMC free article] [PubMed]
27. Livak K. J., Schmittgen T. D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25:402–408 [PubMed]
28. Maldonado-Arocho F. J., Bradley K. A. 2009. Anthrax edema toxin induces maturation of dendritic cells and enhances chemotaxis towards macrophage inflammatory protein 3beta. Infect. Immun. 77:2036–2042 [PMC free article] [PubMed]
29. Maldonado-Arocho F. J., Fulcher J. A., Lee B., Bradley K. A. 2006. Anthrax oedema toxin induces anthrax toxin receptor expression in monocyte-derived cells. Mol. Microbiol. 61:324–337 [PubMed]
30. Martin M., Rehani K., Jope R. S., Michalek S. M. 2005. Toll-like receptor-mediated cytokine production is differentially regulated by glycogen synthase kinase 3. Nat. Immunol. 6:777–784 [PMC free article] [PubMed]
31. Mayr B., Montminy M. 2001. Transcriptional regulation by the phosphorylation-dependent factor CREB. Nat. Rev. Mol. Cell Biol. 2:599–609 [PubMed]
32. O'Brien J., Friedlander A., Dreier T., Ezzell J., Leppla S. 1985. Effects of anthrax toxin components on human neutrophils. Infect. Immun. 47:306–310 [PMC free article] [PubMed]
33. Ozaki N., Chuang D. M. 1997. Lithium increases transcription factor binding to AP-1 and cyclic AMP-responsive element in cultured neurons and rat brain. J. Neurochem. 69:2336–2344 [PubMed]
34. Paccani S. R., et al. 2005. Anthrax toxins suppress T lymphocyte activation by disrupting antigen receptor signaling. J. Exp. Med. 201:325–331 [PMC free article] [PubMed]
35. Park J. M., et al. 2005. Signaling pathways and genes that inhibit pathogen-induced macrophage apoptosis—CREB and NF-kappaB as key regulators. Immunity 23:319–329 [PubMed]
36. Pierrat B., Correia J. S., Mary J. L., Tomas-Zuber M., Lesslauer W. 1998. RSK-B, a novel ribosomal S6 kinase family member, is a CREB kinase under dominant control of p38alpha mitogen-activated protein kinase (p38alphaMAPK). J. Biol. Chem. 273:29661–29671 [PubMed]
37. Puhar A., Dal Molin F., Horvath S., Ladants D., Montecucco C. 2008. Anthrax edema toxin modulates PKA- and CREB-dependent signaling in two phases. PLoS One 3:e3564. [PMC free article] [PubMed]
38. Raymond B., et al. 2007. Edema toxin impairs anthracidal phospholipase A2 expression by alveolar macrophages. PLoS Pathog. 3:e187. [PMC free article] [PubMed]
39. Rishi V., et al. 2004. SREBP-1 dimerization specificity maps to both the helix-loop-helix and leucine zipper domains: use of a dominant negative. J. Biol. Chem. 279:11863–11874 [PubMed]
40. Rodionova E., et al. 2007. GSK-3 mediates differentiation and activation of proinflammatory dendritic cells. Blood 109:1584–1592 [PubMed]
41. Szarowicz S. E., et al. 2009. Bacillus anthracis edema toxin impairs neutrophil actin-based motility. Infect. Immun. 77:2455–2464 [PMC free article] [PubMed]
42. Tournier J. N., et al. 2005. Anthrax edema toxin cooperates with lethal toxin to impair cytokine secretion during infection of dendritic cells. J. Immunol. 174:4934–4941 [PubMed]
43. Tyson D. R., Swarthout J. T., Jefcoat S. C., Partridge N. C. 2002. PTH induction of transcriptional activity of the cAMP response element-binding protein requires the serine 129 site and glycogen synthase kinase-3 activity, but not casein kinase II sites. Endocrinology 143:674–682 [PubMed]
44. Voth D. E., et al. 2005. Bacillus anthracis oedema toxin as a cause of tissue necrosis and cell type-specific cytotoxicity. Cell. Microbiol. 7:1139–1149 [PubMed]
45. Wang Z., et al. 2010. GSK-3 promotes conditional association of CREB and its coactivators with MEIS1 to facilitate HOX-mediated transcription and oncogenesis. Cancer Cell 17:597–608 [PMC free article] [PubMed]
46. Watson L. E., et al. 2007. Anthrax toxins induce shock in rats by depressed cardiac ventricular function. PLoS One 2:e466. [PMC free article] [PubMed]
47. Xu Q., Hesek E. D., Zeng M. 2007. Transcriptional stimulation of anthrax toxin receptors by anthrax edema toxin and Bacillus anthracis Sterne spore. Microb. Pathog. 43:37–45 [PMC free article] [PubMed]
48. Yeager L. A., Chopra A. K., Peterson J. W. 2009. Bacillus anthracis edema toxin suppresses human macrophage phagocytosis and cytoskeletal remodeling via the protein kinase A and exchange protein activated by cyclic AMP pathways. Infect. Immun. 77:2530–2543 [PMC free article] [PubMed]
49. Young J. A., Collier R. J. 2007. Anthrax toxin: receptor binding, internalization, pore formation, and translocation. Annu. Rev. Biochem. 76:243–265 [PubMed]
50. Zhang P., Katz J., Michalek S. M. 2009. Glycogen synthase kinase-3beta (GSK3beta) inhibition suppresses the inflammatory response to Francisella infection and protects against tularemia in mice. Mol. Immunol. 46:677–687 [PMC free article] [PubMed]
51. Zhang X., et al. 2005. Genome-wide analysis of cAMP-response element binding protein occupancy, phosphorylation, and target gene activation in human tissues. Proc. Natl. Acad. Sci. U. S. A. 102:4459–4464 [PMC free article] [PubMed]

Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...