• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
Dev Biol. Author manuscript; available in PMC Jan 15, 2012.
Published in final edited form as:
PMCID: PMC3095822
NIHMSID: NIHMS247869

Prolyl hydroxylation- and glycosylation-dependent functions of Skp1 in O2-regulated development of Dictyostelium

Abstract

O2 regulates multicellular development of the social amoeba Dictyostelium, suggesting it may serve as an important cue in its native soil environment. Dictyostelium expresses an HIFleft angle bracket-type prolyl 4-hydroxylase (P4H1) whose levels affect the O2-threshold for culmination implicating it as a direct O2-sensor, as in animals. But Dictyostelium lacks HIFleft angle bracket, a mediator of animal prolyl 4-hydroxylase signaling, and P4H1 can hydroxylate Pro143 of Skp1, a subunit of E3SCFubiquitin-ligases. Skp1 hydroxyproline then becomes the target of five sequential glycosyltransferase reactions that modulate the O2-signal. Here we show that genetically induced changes in Skp1 levels also affect the O2-threshold, in opposite direction to that of the modification enzymes suggesting that the latter reduce Skp1 activity. Consistent with this, overexpressed Skp1 is poorly hydroxylated and Skp1 is the only P4H1 substrate detectable in extracts. Effects of Pro143 mutations, and of combinations of Skp1 and enzyme level perturbations, are consistent with pathway modulation of Skp1 activity. However, some effects were not mirrored by changes in modification of the bulk Skp1 pool, implicating a Skp1 subpopulation and possibly additional unknown factors. Altered Skp1 levels also affected other developmental transitions in modification-dependent fashion. Whereas hydroxylation of animal HIFleft angle bracket results in its polyubiquitination and proteasomal degradation, Dictyostelium Skp1 levels were little affected by its modification status. These data indicate that Skp1 and possibly E3SCFubiquitin-ligase activity modulate O2-dependent culmination and other developmental processes, and at least partially mediate the action of the hydroxylation/glycosylation pathway in O2-sensing.

Keywords: Prolyl hydroxylation, glycosylation, hypoxia, oxygen, Skp1, Dictyostelium

Introduction

When starved, cells of the social amoeba Dictyostelium aggregate and form a migratory slug, which subsequently culminates into a sessile fruiting body composed of tens of thousands of spores supported above a narrow cellular stalk. In the native environment of the soil, this asexual developmental pathway provides a mechanism for normally subterranean, solitary amoebae to synergistically achieve an aerial disposition from which spores may disperse to distant locales to renew proliferation. The slug-to-fruit switch decision critically depends on O2-concentration (Sandona et al, 1995) and other environmental factors such as NH3, light, humidity and warmth, some of which have been shown to signal via protein kinase A (Kirsten et al., 2005). Whereas only 2.5% O2 is required for proliferation, 10-12% O2 is required for development of the normal strain Ax3 past the slug stage if cells reside at an air-water interface (West et al., 2007), and 70% is required for terminal differentiation into stalk and spore cells when cells are submerged (West and Erdos, 1988).

The O2-set point for culmination appears to involve signaling via P4H1, the Dictyostelium ortholog of HIFleft angle bracket prolyl 4-hydroxylase (PHD or HPH) (West et al., 2010), a major O2-sensor of animals (including humans) involved in mid-to-long term responses to hypoxia (Kaelin and Ratcliffe, 2008). Disruption of the phyA gene encoding P4H1, or increased P4H1 enzyme activity due to overexpression, causes an increased or decreased O2-requirement for culmination, respectively. However, Dictyostelium, and other protists that possess phyA-like genes, lack HIFleft angle bracket, the transcriptional factor subunit that is destabilized by hydroxylation of Pro-residues in its two O2-dependent degradation domains. A known substrate for Dictyostelium P4H1 is Skp1 (van der Wel et al., 2005), a subunit of the SCF-class of E3 Ub-ligases. E3SCFUb-ligases regulate the cell cycle, nutrient sensing, physiology and development in many organisms (Willems et al., 2004), including the latter in Dictyostelium (Ennis et al., 2000; Nelson et al., 2000; Mohanty et al., 2001; Tekinay et al., 2003). Dd-Skp1 is modified at Pro143, which is replaced by Glu in chordate Skp1s. Interestingly, E3SCFUb-ligases are evolutionarily related to the E3VHLUb-ligase which mediates O2-dependent degradation of animal HIFleft angle bracket in normoxia (Kaelin and Ratcliffe, 2008), suggesting a potentially related signaling mechanism associated with protein stability. Therefore Skp1 is a candidate for mediating the O2-signaling role of P4H1 in Dictyostelium.

Hydroxylated Skp1 is subject to successive further modification by three gene products, resulting in the assembly of a pentasaccharide on the fully processed protein (see Fig. 1A below). Disruption of the dual function glycosyltransferase gene pgtA, which results in accumulation of Skp1 whose Hyp is modified by the single sugar GlcNAc, leads to a near wild-type O2-dependence that originally suggested that peripheral glycosylation is not relevant to O2-dependent signaling (West et al., 2007). However, a recent study showed that disruption of agtA (Ercan et al., 2006), required for addition of the final two sugars, results in dependence on high O2 approaching that of phyA cells, revealing a modulatory role for glycosylation (Wang et al., 2009). Since Skp1 is the only substrate detected for the PgtA and AgtA glycosyltransferases in biochemical screening studies, Skp1 is implicated as the functional target of P4H1 in O2-signaling as well. However, since animal PHDs appear to have multiple substrates in O2-signaling (Kaelin and Ratcliffe, 2008), and it is challenging to identify PHD targets, further evidence is required to confirm hypothesized involvement of Skp1 in P4H1 signaling in Dictyostelium.

Fig. 1
Specificity of P4H1 and Gnt1. (A) Schematic of the hydroxylation/glycosylation pathway, using Skp1 as a target example (West et al., 2010; AgtA, unpublished data). (B) Soluble extracts (S100) of phyA(P4H1) stationary stage cells were desalted, ...

Wild-type strains of D. discoideum harbor two Skp1 genes, Skp1A and Skp1B, whose amino acid sequences are identical except for a difference at codon 39 (Ser/Ala) in the N-terminal region (West et al., 1997). The axenic strain Ax2 possesses the wild-type complement, whereas strain Ax3, used in all studies to date, has two Skp1B genes owing to a 100 kb duplication in chromosome 2. The two genes share the same expression pattern in the life cycle based on RT-PCR and protein studies (Sassi et al., 2001; West et al., 1997), and are conserved in the genomes of four other social amoebae (unpublished data). Using reverse genetic approaches, we find that decreasing or increasing Skp1 levels modulates the O2-dependence of culmination over the same range affected by changes in P4H1 levels, except in an opposite direction suggesting that hydroxylation opposes Skp1 activity. Other developmental steps are also affected by changes in Skp1 levels. Enzymatic assays and the phenotypes of Pro143 point mutations, and combined mutations affecting both Skp1 and modification pathway enzymes, are consistent with a model that Skp1 mediates pathway activity in O2-regulation. Analyses of the modification status of the bulk pool of Skp1 suggest, however, that the effects are mediated by a subpopulation of Skp1, and leave open the possibility that other targets of the modification pathway also contribute to signaling.

Experimental procedures

Cell growth and development

Strains (Supplementary Table 1) were grown axenically in HL-5 medium on orbital shakers. For development, vegetative cells (≤5 × 106 cells/ml) were centrifuged at 1000 g × 1 min, resuspended in ice-cold PDF buffer, centrifuged again, and resuspended in PDF (West et al., 2007). 0.4 ml cells (108/ml) were spread on 47 mm-diameter Millipore filters in 60 × 15mm Petri dishes and incubated in sealed plastic boxes, under overhead room fluorescent lighting at 22 °C, for up to 46 h in the presence of the indicated concentration of flowing O2 with the balance made up with N2. Development was evaluated morphologically and by counting spores in a hemacytometer.

Stationary stage cells were collected at 2-3 × 107/ml. For aggregation stage cells, washed vegetative cells were resuspended at 2 × 107/ml in 2 ml of Agg buffer (0.01 M NaPO4, 0.01 M KCl, 0.005 M MgCl2, pH 6.0), and shaken in a flask for 8 h. Slug stage cells were scraped from filters 2-3 h after their initial appearance.

Shaking cells were incubated with 400 μg/ml cycloheximide (unless otherwise stated) from Sigma Chemical Co., diluted from a 50 mg/ml stock solution in DMSO, for the indicated time. Control cultures were incubated in 0.8% DMSO. For metabolic labeling, 5 μCi of 35S-Met (carrier-free, Amersham) was added 15 min after introduction of cycloheximide and incubated for 2 h. Incorporation into protein was measured by TCA precipitation as before (Sassi et al., 2001).

Cell extracts and protein analyses

For standard Western blot analysis, cells were collected by centrifugation (1000 g × 1 min), resuspended in ice-cold 50 mM Tris-HCl, pH 8.0, centrifuged at 5000 g × 15 sec, and the pellet frozen at -80° C. For protein determination, pellets were resuspended in ice-cold 50 mM Tris-HCl, pH 8.0, 10 mM EDTA, 0.1% NP40, 0.5 mM PMSF, 5 μg/ml each of leupeptin and aprotinin, and assayed using a micro BCA protein Assay Reagent Kit (Pierce), relative to a bovine serum albumin standard. S100 fractions (cytosol) were prepared as described (Wang et al., 2009).

Western blotting and antibodies

For SDS-PAGE, cell pellets were resuspended in 1X Laemmli sample buffer, 20 mM DTT, or cell lysates were mixed with 4X modified Laemmli sample buffer, 80 mM DTT. After boiling for 1 min, samples were separated on a 7-20% or 15-20%, or 4-12% (NuPAGE Novex Bis-Tris, Invitrogen) acrylamide SDS-PAGE gel at 0.5-1 × 106 cells/lane, and blotted as described (West et al., 2007), or on an iBlot Dry Blotting System (Invitrogen). mAb 4H2, which specifically recognizes non-glycosylated Skp1 (both unmodified and hydroxylated forms), was generated by immunizing mice with a synthetic peptide (CIKNDFTPEEEEQI) linked to KLH, as previously described (Wang et al., 2009). mAb 4E1 recognizes all Skp1 isoforms (Kozarov et al., 1995). Affinity-purified anti-actin antibody (from rabbits immunized with a MAP-peptide of SGPSIVHRKCF) was from Sigma (St. Louis, MO). Alexa-680 labeled secondary Abs were from Invitrogen. anti-P4H1 (rabbit) was described previously (West et al., 2007).

Protein levels were quantitated by densitometric analysis of Alexa-680 fluorescence imaged using a Li-Cor Odyssey infrared scanner, over an intensity range validated by analysis of a 2-fold dilution series of cell extracts probed with the same Abs (not shown).

Skp1 Strain constructions

Skp1A cDNA and Skp1B cDNA (derived from fpaA) were amplified from p48 and p50 plasmids (Sassi et al., 2001), using Skp1A-S (5’-aaGGTACCaaaataaaataaaaaaatgtctttagttaaattagaatcttcagatgaa) and Skp1A-AS (5’-aaGAGCTCttagtttccacctttatgttcacacca), by PCR and cloning into pCR4TOPO. The insert was released using SacI and KpnI, and ligated into similarly digested pVSE (ecmA-promoter), and pVSC (cotB-promoter) plasmids (West et al., 2007). Plasmids were electroporated into growing Dictyostelium, and G418-resistant cells were selected at 20 or 120 μg/ml G418 to enrich for chromosomally integrated low- or high-level expressers, and cloned on bacteria plates.

Skp1B (fpaB) was disrupted in Ax2 cells by replacing the chromosomal gene with a fpaB fragment containing a floxed-Blasticidin S resistance marker (fbsr). A 1067 bp 5’-fragment and a 780 bp 3’-fragment of Skp1B were PCR-amplified from genomic DNA using primers SB1 (5’-gttCCCGGGtgtagaaatgttattgaatgaaaattattgaggtc) and SB2 (5’-gaaCTCGAGaatGGATCCtattttttatttttgtgtgtgtgtgtttatttg), and SB3 (5’-gttGGATCCttttaattttatttatattgttgatattgttgttg) and SB4 (5’-gtaCTCGAGcatCCCGGGtgaagttgaaagtattcaattatcacagtatatc), respectively, and separately cloned into pCR4TOPO. The Skp1B 3’-fragment was cut and ligated into pCR4TOPO-5’Skp1B using BamHI and XhoI. The sequence of each PCR-generated fragment was verified. Lastly, fbsr was released from plBPLP (Kimmel and Faix, 2006) using BamHI and ligated into pCR4TOPO-5′3’Skp1B digested with BamHI to create pCR4TOPO-5′fbsr3’Skp1B. The disruption DNA was released with SmaI and used to transform strain Ax2 cells by electroporation as above, except in the presence of 10 μg/ml Blasticidin S. Gene replacement was confirmed by PCR (not shown), and the fbsr-cassette was removed by transient transfection with pDEX-NLS-cre, which encodes Crerecombinase (Kimmel and Faix, 2006).

Point mutations of Pro143 in fpaA (Skp1A) were generated by replacing chromosomal fpaA with a construct containing Ala143 or Glu143. A 552 bp fragment, which started with codon143, was PCR-amplified from genomic DNA. PCR reaction used primers A1-U (5’-gaaAGATCTgttCTGCAGaagaagaagaacaaatcagaaaag), in which CCA (Pro) was replaced by GCA (Ala) generating a PstI site; and A1-L (5’-gaATCGATGAGCTCCCATGGaccataaacacacactctcaatacacattg). An 874 bp DNA, downstream of Skp1A, was PCR amplified with primers A2-U (5’-gttGAGCTCGGATCCtaaatggtttgatttcttggatgataaaaaag) and A2-L (5’-gaaATCGATagcttgcaaagatttaggtaaaataccagatg). A full length Skp1 coding sequence was PCR-amplified from plasmid p49 (Sassi et al., 2001) with primers p49A1 (5’-gaaAGATCTatgtctttagttaaattagaatcttcag) and p49A-L (5'-gttGAGCTCattttagtttccacctttatcttcac). Fragments were separately cloned into pCR4TOPO. A 874 bp fragment was released using SacI and ClaI and ligated into similarly digested pCR4TOPO(552). Then the 429 bp fragment from p49 was cut and ligated into pCR4TOPO(552+874) using BglII and PstI. Finally, fbsr was ligated into the pCR4TOPO(429+552+874) using NcoI and BamHI.

The Glu143 mutation was generated from the Ala143 construct using site-mutagenesis with primers SAQ-SDM (5’-aagaacgactttactgaagaagaagaagaacaaatcagaaaag) and SAQ-SDM-Rev (5’-atttgttcttcttcttcttcagtaaagtcgttcttgatgttg, which replaced gca (Ala) with gaa (Glu).

The mutant constructs were excised using BglII and ClaI, treated with Bal 31 exonuclease to remove flanking non-homologous nt, and used to transform strain Ax2 cells by electroporation as above, in the presence of 10 μg/ml Blasticidin S. Gene replacement was confirmed by PCR with two pairs of primers: SA3 (5'-gtaggatcctaaaggtggaaactaaacagtcaagtatctc) and SA4 (5'-gtactcgagcatcccgggctggcaaatatagtaatggtagtccaataag); SAP49 (5’-cacacccacactcaaataaataaataatatc) and fBSR-R1 (5’-aagataaagctgacccgaaagctc).

Strains overexpressing both Skp1 and P4H1 were generated by cotransformation of equal amounts of the respective expression plasmids and selected for using G418 as described above. The majority of drug-resistant clones expressed both proteins based on Western blot analysis.

RFP and GFP expression reporters

Promoter DNA was amplified from strain Ax3 genomic DNA using PCR reactions containing the following primers: fpaA-sense (5’-ttCTCGAGtttttggaatacaagtttctagttgaaaact), fpaA-antisense (5’-ttGGTACCtttttctatattttttttttacctttttcttttc), fpaB-sense (5’-ttCTCGAGttcttgatactctctggtcttggtgac), fpaB-antisense (5’-ttGGTACCtatattttaaaaagtgtgtattgctttattgg). The products of the reactions were gel purified and cloned into pCR4TOPO (Invitrogen), excised using XhoI and KpnI, and cloned into similarly digested pVSP-RFPmars(T127T) and pVSP-labGFP (West et al., 2007), using standard procedures. For the fpaA promoter constructs, this resulted in replacement of the phyA-promoter DNA with 366 nt of DNA immediately upstream of the fpaA start ATG, which comprises most of the 441 nt separating fpaA from the reverse-oriented upstream coding sequence (DDB_G0269994) and includes all G/C nt more than 13 nt upstream of the DDB_G0269994. For fpaB, this resulted in inclusion of 2127 nt upstream of the fpaB start codon, which extended 28 nt into the upstream reverse-oriented coding sequence (DDB_G0273387).

Enzymes and reactions

His6P4H1 (rP4H1) was expressed in E. coli and purified essentially to homogeneity as described previously (van der Wel et al., 2005).

The Gnt1 ORF was amplified from pTYB1-GnT51 (van der Wel et al., 2002a) using the following primers in a standard PCR reaction: GnT51-Zs1 (5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTCTGAAAACTTGTATTTCCAGGGCGAAAATTCTATT TTTGTTTCTATTATAAG), and GnT51-Zas1 (5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTTATAAACCGATTTGGGATTTAATTAC). The product was transferred to pDEST527 using the LR Clonase II mix to yield pDONR201, which was propagated in TOP10 cells, transferred into ER2566 E. coli cells, and grown in LB medium with 100 μg/ml ampicillin at 37 °C. until OD590 reached 0.4, at which time 1 mM IPTG was added and the culture was incubated for 16 h at 10° C on a shaker. His6Gnt1 was purified from the S100 fraction on a Ni++-column as for His6P4H1 (van der Wel et al., 2005).

Combined P4H1/Gnt1 reactions were performed on desalted S100 preparations of stationary stage or slug stage cells, in the presence of UDP-[3H]GlcNAc, and the entire reaction volume was subjected to SDS-PAGE, as described previously (van der Wel et al., 2005). Incorporation of radioactivity was measured by liquid scintillation counting of evenly spaced gel slices created using a razor blade cutter.

Skp1 purification and mass spectrometry

FLAG-Skp1A and Skp1B-myc were purified to near homogeneity, from stationary stage and slug stage cells, respectively, and analyzed by MALDI-TOF-MS, as described in the supplementary material.

Results

Biochemical screen for P4H1 substrates

To probe for potential P4H1 substrates that accumulate in phyA(P4H1)-null cells, a desalted cytosolic extract was incubated with His6P4H1 and appropriate cosubstrates and cofactors. The extract also included His6Gnt1 and UDP-[3H]GlcNAc to transfer [3H]GlcNAc to the Hyp reaction product, and the entire reaction product was displayed on a 1D SDS-PAGE gel which was then cut into slices to measure radioactivity (Fig. 1B). As expected, Skp1 was strongly labeled. However, no other proteins were detected at more than 0.2% of the level of Skp1 labeling except for a variable, slightly more rapidly migrating peak probably corresponding to a breakdown product of Skp1. About 5% of the level of Skp1 labeled in P4H1 cells was labeled in Ax3 cells (see inset), suggesting the existence of a small steady-state pool of unmodified protein. Similar results were obtained for an extract of slug cells (Fig. 1C). The results suggest that Skp1 is the only substrate of P4H1 that accumulates in P4H1 cells but, since the coupled assay depends on recognition of the P4H1 product by Gnt1, other P4H1 substrates might have been missed. The significance of Skp1 as a potential substrate for P4H1 in O2-signaling was therefore investigated genetically.

Genetic modifications of Skp1 loci

The standard haploid Ax3 strain used in previous studies harbors three Skp1 genes: fpaA and two identical copies of fpaB owing to a duplication on chromosome 2 involving about 50 genes (Bloomfield et al., 2008). Skp1A (fpaA) and Skp1B (fpaB) differ by a single amino acid (S39 vs. A39) as depicted in Fig. 2A. Another standard strain, Ax2, lacks this duplication. The O2-dependence of culmination was compared by incubating cells in a graded series of O2 levels, and monitoring development after 2 d based on morphological appearance. Completion of development was quantitated by counting spores. All strains exhibited a typical, sharp dependence on O2-level to culminate (Fig. 2C). The level required to form 50% of the maximum number of spores (defined as the number formed in 21% O2) was 7% O2 for Ax2 compared to 12% for Ax3 (Fig. 2D).

Fig. 2
Genetic modifications of chromosomal Skp1 loci affect O2-dependence of culmination. (A) Skp1 isoforms examined in this study. (B) Morphological development of Skp1B and normal parental strain Ax2 cells on filters after 43 h at 21% or 2.5% O2 ...

For additional evidence that O2-dependence is affected by Skp1, the Skp1B (fpaB) gene of Ax2 was disrupted by homologous recombination. The Skp1B strain formed fruiting bodies with extended tenuous stalks (Fig. 2B), and exhibited an even lower requirement for O2 with a 50% value of only 3% O2 (Fig. 2C, D). Similar results were obtained for an independent Skp1B strain (data not shown). Western blot analysis revealed that the steady-state level of total Skp1 was reduced to about 50% in the Skp1B strain relative to the parental strain Ax2, whereas the level was similar between strains Ax2 and Ax3 (Fig. 2E). Therefore other genetic differences may explain the distinct O2-requirements for culmination of Ax2 and Ax3. Efforts to disrupt Skp1A (fpaA) using a similar approach were unsuccessful. Thus, at a given O2 level (e.g., 9%), the Skp1B strain exhibited increased culmination whereas Ax3 exhibited less. As summarized in Table 1 (lines 1, 3 and 5), this suggests that higher Skp1 activity inhibits culmination, whereas higher activity of the hydroxylation/glycosylation pathway, which modifies Skp1, promotes culmination (line 8, from West et al., 2007).

Table 1
Summary of effects

To investigate whether the effect of Skp1 was influenced by its hydroxylation/glycosylation, Pro143 was changed to either Ala or Glu in the chromosomal locus of Skp1A (fpaA) of strain Ax2. These substitutions occur naturally in C. elegans SKR2 and human Skp1, respectively. Attempts to similarly modify the Skp1B gene, or the Skp1A gene in the Skp1B strain, were unsuccessful. The gene replacements were confirmed by PCR, and Western blotting showed a doublet consistent with an equimolar mixture of glycosylated and unmodified Skp1 (data not shown), confirming that both Skp1s are normally expressed (West et al., 1997). The Skp1A3(P143A) and (P143E) strains each exhibited modest but reproducibly higher O2-requirements for 50% culmination, intermediate between the parental Ax2 strain and Ax3 (Fig. 2C, D). In addition, the Pro143 mutant strains were delayed by several h in the time to convert from loose to tight aggregates, whereas the time required for the other developmental transitions was not affected (Fig. 2F). The delay of tight aggregate formation is a novel phenotype, but differs from the selective delay in conversion of tipped aggregates to slugs that occurs in hypoxia (see Discussion). As previously described for P4H1 strains (West et al., 2007), the above strains exhibited a higher O2-requirement when developed under darkness compared to overhead light (data not shown), indicating that altered Skp1 levels interact with other signaling pathways as for hydroxylation/glycosylation. The inhibition of culmination seen whether Ala or Glu replaced Pro correlated with inhibition observed in P4H1 cells, that also do not modify Skp1 (West et al., 2007).

Overexpression of epitope-tagged Skp1s

O2-dependent development was then investigated in strains modified by stable transfection with additional copies of Skp1A or Skp1B genes. The previously described strain HW302 (Sassi et al. 2001), in which transgenic Skp1B-myc (C-terminally tagged) is expressed at a level similar to that of endogenous Skp1 in Ax3 (Supplementary Fig. 1), from a tandem array of chromosomally integrated transgenes under control of the semi-constitutive discoidin 1© (dscC) promoter, exhibited normal dependence on O2 for culmination (Fig. 3A). In contrast, expression of the same protein under control of the developmental promoter cotB, which directs expression in prespore cells, resulted in an increase in the O2-requirement to ~18%, approximately the level required for culmination of phyA(P4H1) cells. The cotB::Skp1B-myc strain expressed 4-5-fold more Skp1B-myc than endogenous Skp1 in slugs, and Skp1B-myc was not detected in vegetative cells confirming promoter specificity (Supplementary Fig. 1). The results are consistent with the above analysis that increased activity of Skp1 increases the level of O2 required for culmination, and the comparison with HW302 cells suggests that the level and/or timing of expression is important for the effect. Since, at a given level of O2 (e.g., 12-18%), elevated Skp1 leads to reduced culmination, and Skp1 contributes to the E3SCFUb-ligase, Skp1 may normally promote the degradation of a hypothetical activator of culmination.

Fig. 3
Functional analysis of strains overexpressing epitope-tagged Skp1. Development was quantitated by spore counting as in Fig. 2C. Visual inspections confirmed that spore formation coincided with culmination. Selected examples of separate trials including ...

Previous studies showed that whereas Skp1B-myc expressed under control of the dscC-promoter was predominantly modified by the pentasaccharide (Sassi et al, 2001), Skp1B-myc expressed under control of the cotB-promoter did not appear to be modified based on gel shift analysis. To address the hydroxylation status of P143, Skp1B-myc was purified essentially to homogeneity from cotB::Skp1B-myc slugs (Supplementary Fig. 2A). MALDI-TOF-MS analysis of the full-length protein was consistent with absence of glycosylation (panel B), and MALDI-TOF-MS of HPLC-separated, endo Lys-C generated peptides detected only the unmodified peptide containing P143 (panels C, D), confirming its unmodified status. Previous Western blot analyses showed that P4H1 is present in both prespore and prestalk cells (West et al., 2007), and activity assays performed on soluble slug extracts revealed P4H1 activity (data not shown) at 33% of the specific activity of that of stationary stage cell extracts (van der Wel et al., 2005). Therefore, P4H1 is present in the slug, but appears to be rate-limiting for the hydroxylation of nascent Skp1B-myc. Thus, the increased O2-requirement resulting from overexpression of Skp1 under control of the cotB-promoter, compared to the dscC-promoter, may depend on less hydroxylation/glycosylation.

A second approach to testing the role of hydroxylation was to examine the effect of overexpressing the Skp1B3(P143A)-myc mutant. When expressed at a level similar to that of normal Skp1B-myc (Supplementary Fig. 1C), Skp1B3-myc exerted a minimal effect on the O2-requirement (Fig. 3B). However, a clone (cotB::Skp1B3.6-myc) that expressed a very high level (Supplementary Fig. 1B) raised the O2-requirement to a threshold that did not, however exceed that of Skp1B-myc. Although its inability to be modified appears to affect the activity of Skp1B3-myc, the possibility that the mutation reduces activity independent of the effect on modification cannot be excluded.

To investigate whether failure to hydroxylate prespore-expressed Skp1B-myc was due to the C-terminal myc-tag or which isoform was expressed, Skp1A with an N-terminal FLAG-tag was expressed in Ax3, as done in yeast studies (e.g., Seol et al., 2001). Unlike the C-terminally-tagged protein, the majority of FLAG-Skp1A was poorly modified even in stationary stage cells when expressed behind the dscC-promoter, based on gel shift analysis (Supplementary Fig. 3A, lanes 4-6). FLAG-Skp1A was also recognized by mAb 4H2 (data not shown), generated by immunization of a mouse with a 13-mer synthetic peptide corresponding to the sequence surrounding Pro143 (Wang et al., 2009), that specifically recognizes unmodified or hydroxylated Skp1 but not glycosylated Skp1 (data not shown), confirming that it is not glycosylated. MALDI-TOF-MS analysis of tryptic peptides of FLAG-Skp1A purified from stationary stage cells showed that the great majority was unhydroxylated (Supplementary Fig. 3B). FLAG-Skp1A was also poorly modified when expressed in slug cells under either a prestalk (ecmA, lanes 7-9) or prespore (cotB, lanes 10-12) promoter, as for Skp1B-myc. Expression of FLAG-Skp1A under control of either promoter had an effect similar to that of cotB::Skp1B-myc in elevating the O2-requirement for culmination (Fig. 3C). In contrast, dscC::FLAG-Skp1A had no effect on the O2-requirement, despite the similar level of FLAG-Skp1A that accumulated under the different promoters (Supplementary Figs. 1B,C). The inactivity of dscC::FLAG-Skp1A, which unlike dscC::Skp1B-myc was not glycosylated, suggests that preformed Skp1 is not inactive owing to its average glycosylation status, but inaccessibility to O2-signaling components. The inhibitory activity of tagged Skp1 expressed in slugs (summarized in Fig. 3D) correlates with timing of expression and lack of glycosylation, rather than the type of Skp1 (A or B), the position or identity of the peptide tag, or the cell type in which it is expressed.

Overexpression of native Skp1

To address the possibility that the epitope tags inhibit Skp1 hydroxylation and thereby affect its activity, native sequences of Skp1 were overexpressed in Ax3 cells. In a range of clones expressing low to high levels of Skp1A or B, driven by ecmA- or cotB-promoters (Fig. 5A), modestly shorter fruiting bodies were formed (Fig. 4A) in contrast to the taller fruiting bodies formed by Skp1B strains (Fig. 2B). In addition, the majority of cells in the sori (>85%) failed to become spores (Figs. 4B, C), even at O2 levels up to 100% (not shown). The few spores produced did depend on O2 in the same way as culmination. As represented in Fig. 4D, the culmination of these and all other (not shown) Skp1 overexpression strains exhibited an elevated O2-requirement, as for tagged Skp1s. In addition, the overexpression strains were delayed in fruiting body formation at 21% O2, as a result of delayed tight aggregate formation (Fig. 4E) as observed also for the Skp1A3(P143A/E) mutants above (Fig. 2F). In comparison, strains expressing tagged Skp1s formed slugs at the normal time but tended to be delayed in culmination at 21% O2 (data not shown), as observed for P4H1 cells (Fig. 4E). Skp1A and Skp1B appeared equally inhibitory, with no correlation observed between the degree of Skp1 overexpression (133-700%; Fig. 5A) and the O2-requirement. Furthermore, similar inhibition was observed whether Skp1 was overexpressed under the prestalk or prespore promoter. Thus overexpression of native Skp1 rendered an effect on culmination very similar to that of the tagged Skp1s (compares lines 9-11, Table 1), confirming the trend that higher Skp1 levels are more inhibitory toward culmination, i.e., elevated O2 are required to culminate. Overexpressed native Skp1 exerted, in addition, two novel functions: inhibition of tight aggregate formation and sporulation.

Fig. 4
Functional analysis of strains overexpressing native Skp1. (A) Strains overexpressing Skp1A under control of either the ecmA- or cotB-promoter, and the parental strain Ax3, were developed for 43 h at ambient (21%) O2 on filters and photographed. (B) Representative ...
Fig. 5
Western blot analysis of Skp1 expression in slugs of selected strains formed in 21% O2. (A) Summary of densitometric analyses of total Skp1 expression levels in slugs, based on Western blotting as in Fig. 2E. Slugs were analyzed 2 h after their time of ...

Glycosylation analysis revealed that, in contrast to the tagged Skp1s, overexpressed native Skp1 exhibited partial glycosylation at 21% O2. Since expressed untagged Skp1 comigrates with endogenous Skp1, this was inferred from increased levels of the primary glycosylated Skp1 band based on densitometric analysis of the ecmA::Skp1 and cotB::Skp1 strains (Figs. 5B, C). Hydroxylation/glycosylation correlates with the ability of overexpressed untagged Skp1 to delay slug formation and inhibit sporulation. In addition, most strains also accumulated unmodified Skp1 (at 21% O2), based on the presence of a more rapidly migrating species in Western blots that was recognized by mAb 4H2. Accumulation of unmodified Skp1 correlates with its ability to inhibit culmination as for the tagged Skp1s. In contrast, overexpression of mutant Skp1A3(P143A) in the Ax3 background caused either no change or a slight decrease in O2-requirement, and did not delay culmination or inhibit sporulation (Fig. 4C and data not shown; line 12 in Table 1). The minimal effect was potentially due to low activity of the mutant protein as suggested above for Skp1B-myc.

Genetic interactions between Skp1 and its modification enzymes

The significance of Skp1 modification was investigated further by testing for genetic interactions between Skp1 level and modification pathway mutants. First, the native Skp1A and Skp1B constructs were expressed in phyA and agtA backgrounds (see Fig. 1A for pathway genes). Timing of tight aggregate and slug formation was normal, and culmination was delayed slightly as for phyA and agtA strains (Fig. 6A). In addition, sporulation was normal (example in Fig. 4B, bottom panel). Therefore the inhibitory effects of Skp1 overexpression was contingent upon activity of the hydroxylation/glycosylation pathway, as suggested by the comparison of untagged and tagged Skp1 strains.

Fig. 6
Genetic interactions. (A) Developmental timing of strains over-expressing native Skp1A or Skp1B, in normal, phyA or agtA backgrounds, or in combination with P4H1 overexpression, were compared with Ax3, phyA or agtA ...

In these strains, the O2-level required for culmination approached but did not quite achieve the O2-requirement of the parental phyA and agtA strains (Supplementary Fig. 4A, Fig. 6B), which themselves differed by 2-3% O2 (summarized in lines 15-17 and 6-7, Table 1). The observation that O2-requirements were not additive was consistent with their functioning in the same pathway, with maximal signaling achieved either by absence of inhibitory modification or overexpression of Skp1 to an extent that exceeds the capacity of inhibitory modification. Culmination at higher O2 implies the existence of an unknown bypass pathway that can override Skp1 signaling (West et al., 2010).

The ask if under-modification was important for the inhibitory activity of overexpressed Skp1, strains that overexpressed both P4H1 and Skp1 were created by cotransformation with Skp1B and P4H1 expression plasmids of the same promoter type. Western blotting with anti-P4H1 and mAb 4E1 confirmed that both proteins were overexpressed (Supplementary Fig. 4B). Interestingly, the majority of excess Skp1 accumulated at the position of unmodified Skp1 and reacted with mAb 4H2, consistent with their being unglycosylated. Morphological analysis showed absence of the delayed tight aggregate formation (Fig. 6A), short fruiting body stature, and reduced sporulation typical of the Skp1 overexpression strains (data not shown). In addition, the O2-requirement for culmination was reduced to levels typical of P4H1-overexpression in Ax3 cells lacking overexpressed Skp1 (Fig. 6C, Supplementary Fig. 4B). The epistatic relationship of P4H1 toward Skp1 was consistent with its exerting a dominant inhibitory effect on Skp1 activity, with the biochemical data suggesting that the effect of hydroxylation is mediated by a small subpopulation of Skp1.

To test for an interaction when Skp1 is expressed at subnormal levels, a double Skp1B/agtA mutant was created. Independent clones sporulated normally, as expected, and exhibited an O2-threshold for culmination intermediate between that of the single mutants (Fig. 6D), similar to that of the genomic Skp1A3(P143A) mutation (Fig. 2C) in which one of the Skp1s was not glycosylated (compare lines 2 and 3, Table 1). The absence of an epistatic effect of either gene over the other is consistent with opposing effects of Skp1 level and its modification to tune the activity of Skp1 when at near physiological levels in the cell. Repeated attempts to create a phyA/Skp1B double mutant were unsuccessful.

Skp1 expression patterns

No differences between Skp1A and Skp1B were observed in the overexpression studies, suggesting that their activities are similar during development. Consistent with this, both proteins are expressed in stationary stage cells (West et al., 1997) and slugs (see above), and RT-PCR studies showed that they are similarly and constitutively co-expressed throughout development (Sassi et al., 2001). However, because the chromosomal loci encoding Skp1A and Skp1B (fpaA and fpaB) appeared to differ in their susceptibility to genetic modification (see above), which might reflect non-redundant activities, their expression patterns in the slug was analyzed. Promoter-RFP and -labile GFP constructs were created by fusing the entire upstream intergenic region from Skp1A (fpaA) and Skp1B (fpaB), excepting a distal A/T-only region for fpaA, to RFP or an unstable form of GFP, and transfected as above for overexpressing Skp1. Clones screened for modest RFP or GFP fluorescence were homogeneously fluorescent along the length of the slug (Supplementary Fig. 5). Thus no evidence was obtained for differential expression of Skp1A and Skp1B in prestalk and prespore cells of the slug, suggesting that the Skp1 isoforms do not serve prestalk and prespore cell specific functions.

Stability of Skp1 protein

Since changes in Skp1 levels affect O2-dependence of culmination, we asked if the effects of mutating genes in the hydroxylation/glycosylation pathway affected Skp1 levels. As shown in Fig. 7A, similar levels of Skp1 were detected in slugs from each of the available pathway mutants, indicating that the modification state of Skp1 does not affect its steady-state expression level. In addition, the stability of Skp1 was investigated by incubating cells for varying times in 400 μg/ml cycloheximide, which inhibited incorporation of 35S-Met by over 95% (Supplementary Fig. 6). Skp1 was stable in normal cells with only a slight diminution observed after 80 min of treatment, as expected (Zhou and Howley, 1998), and no differences were observed in mutant cells lacking P4H1 or AgtA (Fig. 7B). Similar results were obtained for stationary stage and aggregation stage cells. The results suggest that overall Skp1 levels are not regulated by the modification pathway.

Fig. 7
Skp1 stability. (A) Summary of Western blot analysis of whole cell extracts of slugs from mutant strains, showing Skp1 levels relative to actin. Standard deviations of 2-3 replicates are shown. (B) Analysis of Skp1 stability. Stationary stage cells in ...

Discussion

Skp1

Genetic disruption of one of the two loci for Skp1, or stable introduction of multiple transgenic copies of Skp1, yielded strains that expressed over a 10-fold range of steady-state Skp1 levels in slugs of the normal parental strain Ax3. Reduced Skp1 level lowered the O2-requirement for 50% culmination from ~10% to ~3% (Fig. 2), close to the minimal amount required for unicellular growth (West et al., 2007). In comparison, overexpression to ~133% or beyond, under the control of developmental promoters, resulted in an increase to about ~18% (Figs. 3,,4).4). Similar effects were observed at the highest levels of overexpression, suggesting absence of dominant negative activity. Skp1 was similarly active as its A or B isoforms, or when epitope-tagged, or when expressed under control of a prestalk- or prespore-specific promoter (summarized in Table 1).

Since lower levels of Skp1 promoted and higher levels inhibited culmination at any given level of O2, and Skp1 is associated with polyubiquitination via E3SCFUb-ligases, it is proposed that Skp1 contributes to the polyubiquitination and proteasomal degradation of a hypothetical activator of culmination. Even at the maximal level of Skp1 activity achieved by this approach, inhibition of development was suppressed by high levels of O2 (>18%). The existence of an override pathway was also inferred from analysis of P4H1 mutants (West et al., 2007). A previously described substrate of the the Dictyostelium E3(SCFFbxA)Ub-ligase (Mohanty et al., 2001), the cAMP phosphodiesterase RegA, is not a good candidate for culmination regulation by Skp1 since this enzyme inhibits development.

An exception occurred for Skp1 overexpressed under control of the promoter dscC, which resulted in considerable carryover of FLAG-Skp1A or Skp1B-myc into the slug without an effect on the O2-requirement (Fig. 3). This suggests that the modification status or rate of synthesis of Skp1 (dscC is less active in the slug) may be important parameters in addition to the total level of Skp1 in mediating these effects.

The strains overexpressing native (untagged) Skp1 exhibited two additional, novel phenotypes: delayed formation of tipped aggregates at 21% O2 (Fig. 4E), and failure of prespore cells in the sorus to efficiently differentiate into spores (Figs. 4B,C). Inhibition of slug formation is consistent with the initial timing of ecmA and cotB expression around the tipped aggregate stage (Early et al., 1995). As for culmination, these defects occurred whether a low or high level of Skp1A or B was overexpressed in prestalk or prespore cells. Interestingly, Skp1 did not exert these effects when modified at either its N- or C-terminus by epitope-tags, which inhibited modification in vivo. These inhibitory effects were not overridden by high O2 levels, and we have not observed effects of hypoxia on these processes in normal cells (unpublished data). Therefore, Skp1 may also contribute to the degradation of activators of tight aggregate formation and sporulation, but independent of O2-regulation per se.

Relation of Skp1 activity to hydroxylation/glycosylation pathway signaling in culmination

The range of O2-requirements exhibited by the Skp1 expression level panel is remarkably similar but inverse to that observed in a P4H1 expression level panel (West et al. 2007), in which phyA(P4H1) cells required ~18% O2, and P4H1-overexpression strains required 5% O2 to culminate. Skp1 overexpressed in the slug is poorly hydroxylated, mimicking the phyA condition. Together, these data suggest that the effects of altered Skp1 levels on O2-dependent culmination are reflective of normal effects of O2-regulated modification of Skp1 by P4H1 (see Fig. 7C). Since higher P4H1 levels promote and higher Skp1 levels inhibit culmination at any given O2 level, we propose that hydroxylation reduces the activity of Skp1. Previous studies showed that Hyp becomes modified by GlcNAc, and subsequently by the addition of up to 4 additional sugars. Reverse genetic analyses showed that the glycosyltransferases that mediate these additions modulate O2-signaling (Wang et al., 2009), and we propose that the glycosyl-modifications also directly modulate the effect of proline hydroxylation on Skp1 activity.

A direct interaction between Skp1 and the hydroxylation/glycosylation pathway is supported by other mutants and mutant combinations. Substitution of Pro143 with Ala or Glu in the chromosomal locus of Skp1A resulted in a slightly higher O2-requirement (Fig. 2C), consistent with its inability to be modified. The Skp1B/agtA double mutant, in which modification of residual Skp1A was interrupted at the trisaccharide step, exhibited an O2-requirement intermediate between the individual mutants (Fig. 6D), consistent with reduced inhibition of a lower level of inhibitory Skp1. Overexpression of Skp1 in a phyA or agtA background did not have an additive effect on the O2-ceiling (Fig. 6B, Supplementary Fig. 4A), which differed for the two backgrounds, consistent with confinement of the effect of Skp1 to within the O2-range dictated by the modification potential. Interestingly, overexpression in either modification mutant background slightly reduced the O2-requirement, raising the possibility of a dominant negative effect of overexpression of uninhibited Skp1, resulting in slightly reduced Skp1 activity. Co-overexpression of P4H1 reduced O2-dependence of culmination to near the value of seen when P4H1 alone was overexpressed (Fig. 6C, Supplementary Fig. 4B). Finally, the overexpressed mutant Skp1A3(P143A) had minimal effect on culmination (Fig. 4C). Possibly this point mutant has weaker activity than unmodified native Skp1 owing to secondary effects of the amino acid substitution, with its residual activity being more apparent in combination with a single wild-type copy (Fig. 2D) than with the 3 wild-type copies present in the overexpression strains. Consistent with this model, very highly expressed mutant Skp1B3(P143A)-myc was as inhibitory as modestly expressed Skp1B-myc (Fig. 3B).

The mutant strains were monitored for expression levels of Skp1 and evidence for expected effects on its modification status. Generally, endogenous Skp1 is >90% hydroxylated and glycosylated in the steady state during growth and development (Fig. 1; Sassi et al., 2001). However, as suggested by that study and shown in Supplementary Fig. 2, prolyl 4-hydroxylation is rate-limiting, even at ambient (21%) O2-levels, for modification of Skp1B-myc overexpressed in prespore cells. In contrast, Skp1B-myc that is overexpressed during vegetative growth is fully modified (Sassi et al., 2001), though the rates of synthesis have not been directly compared. Similar results were obtained for FLAG-Skp1A expressed in prestalk or prespore cells (Supplementary Fig. 3), except that FLAG-Skp1A is poorly modified even in vegetative and stationary cells. In contrast, while prolyl 4-hydroxylation was also rate-limiting for overexpressed native Skp1A or Skp1B, increased glycosylated Skp1 was detectable (Fig. 5B,C). Surprisingly, co-overexpression of P4H1, which corrected the phenotype, did not appear to increase the fraction of modified Skp1 (Supplementary Fig. 4B). This indicates that a subpopulation of Skp1, too low in abundance to be detected, mediates the effects of P4H1 overexpression, and suggests that accessibility of P4H1 to nascent Skp1 may be important. Alternatively, P4H1 may have other functions in this overexpression setting by signaling via another substrate. These possibilities, which are not mutually exclusive, are depicted in Fig. 7C. In an attempt to identify an alternative target, soluble extracts from normal and phyA slug cells, and stationary cells, were incubated in the presence of recombinant P4H1, Gnt1 and UDP-[3H]GlcNAc. No targets other than Skp1 were detected (Fig. 1), though substrates not subsequently modified by Gnt1 GlcNAcT would have escaped detection. However, since AgtA, which solely modifies Skp1 and depends on Gnt1 for its biochemical function, modulates the action of P4H1 in O2-regulated culmination (Wang et al., 2009), Skp1 clearly contributes to P4H1 signaling. Finally, non-enzymatic functions of P4H1 are excluded based on analysis of inactivating active site point mutations (West et al., 2007).

Although altered levels of Skp1 affect the O2-requirement for culmination, there was no evidence that its modifications affect its level or stability in cells, based on Western blot analysis of the mutant strains treated with cycloheximide (Fig. 7). Thus the role of hydroxylation of Skp1 appears to differ from that of animal HIFleft angle bracket, which is destabilized by becoming a target of E3VHLUbligase (Kaelin and Ratcliffe, 2008). However, an effect of hydroxylation in the absence of subsequent glycosylation has not yet been directly analyzed.

Relation of Skp1 activity to hydroxylation/glycosylation pathway activity in aggregation and sporulation

The inhibitory effects of Skp1 overexpression on tipped aggregate formation and sporulation were dependent on its modification. Thus, tipped aggregate formation and sporulation were normal when Skp1 was overexpressed in phyA or agtA strains, or when Skp1A3(P143A) was overexpressed in the normal strain Ax3 (Table 1). FLAG-Skp1A and Skp1B-myc were also not inhibitory. Because tagged Skp1s were similarly overexpressed in slugs, their inactivity was possibly attributable to their lower potential for modification (Supplementary Figs. 2, 3) compared to native Skp1 (Fig. 5B, C). A similar inhibition of tipped aggregate formation occurred when Skp1A of strain Ax2 was mutated to Skp1A3(P143A/E)(Fig. 2F). A shared trait between these mutant strains is the simultaneous forced expression of both modifiable and unmodified Skp1, suggesting that the ratio is more influential than the absolute level of Skp1. As discussed above, these effects do not correlate with O2-regulated steps in development, but may portend novel regulatory mechanisms involving hydroxylation-dependent glycosylation or other modes of P4H1 regulation.

These effects of Skp1 on aggregation and sporulation are promoted by the modification pathway, in contrast to the inhibition effect inferred from the analysis of culmination, as summarized in Table 1. The reason for this difference is unclear but may be related to the mechanism of Skp1 action, which is thought to involve association with F-box proteins (Willems et al., 2004). Potentially, each of the effects (slug formation, culmination, sporulation) involves interaction with distinct F-box proteins, potentially synthesized at the specific time that regulation occurs. In addition, F-box proteins, which number around 50 in D. discoideum based on genomic sequence searches (unpublished data), fall into two classes based on ability to contact cullin in SCF complexes and sensitivity to regulation by Cand1 and NEDDylation (Schmidt et al., 2009). Modification of Pro143 may have differential effects on interactions with individual F-box proteins or classes of F-box proteins or, alternatively, non-SCF functions of Skp1 that have been proposed (Seol et al., 2001; Hermand, 2006).

Developmental significance

The effects of Skp1 overexpression in either of the major cell types of the slug, prestalk (ecmA) and prespore (cotB) cells, were indistinguishable. A similar result was observed in a previous study of P4H1 expression (West et al., 2007). It was noted that in strain mixture experiments, cells expressing higher levels P4H1 tended, regardless of the promoter used to direct its expression, to migrate to the tip, where prestalk cells direct culmination and possibly also slug formation and sporulation. If Skp1 mediates P4H1-dependent signaling as hypothesized (Fig. 7C), it is predicted that Skp1-underexpressing cells will undergo similar tip transdifferentiation to regulate development, which would explain the similar activity when initially expressed in either cell type. Although the biological significance has yet to be studied, this phenomenon suggests that development is promoted by cells experiencing the highest O2-levels, which would be expected to occur at the slug surface at points of minimal radius of curvature such as the tip, but might occur elsewhere. Since the O2-dependence of development can be controlled by the properties of <10% of the cells in the strain mixture studies (West et al., 2007), developmental regulation may be ultrasensitive to O2. This may contribute to the sharp O2-thresholds within experiments and variations of the precise threshold in independent trials. In addition, ultrasensitivity may help explain why, in instances such as the double P4H1oe/Skp1oe strain, the modification status of the bulk pool of Skp1 does not correspond to expectation based on protein expression alone. As discussed above, Skp1-signaling may be dependent on an efficiently modified subpopulation that is nascent and/or co-compartmentalized with P4H1 and the other enzymes.

As described for P4H1, Skp1 levels appear to be constant throughout the life cycle (Sassi et al., 2001; West et al., 2007), and results here suggest that Skp1 is expressed at similar levels throughout the slug (Supplementary Fig. 5). As also shown here (Fig. 7), Skp1 is a relatively stable protein, though ongoing synthesis replaces at least half of the steady state pool during development according to prolyl hydroxylase inhibitor studies (Sassi et al., 2001). Based on our unpublished data that Skp1 is not hydroxylated in vitro after forming a stable complex with FbxA, we reason that cells may continuously monitor O2, Krebs cycle intermediates (Koivunen et al, 2007), redox sensors and other factors such as sugar-associated signals, via modification of nascently synthesized Skp1 prior to association with coordinately synthesized F-box proteins. With an estimated 50 F-box proteins, the activity of multiple E3SCFUb-ligases targeting a potentially larger set of regulatory proteins may be selectively influenced by this ‘timer’ mechanism, to ultimately couple environmental signals reflective of soil microenvironments to appropriate developmental transitions (West et al., 2010). Pulse-chase labeling has the potential to investigate the properties of nascent Skp1 relative to background bulk Skp1 which may not be relevant to signaling.

Forward genetic screens previously implicated cullins and F-box proteins, partners with Skp1 in SCF complexes, in the regulation of multiple developmental transitions in Dictyostelium (Ennis et al., 2000; Nelson et al., 2000; Mohanty et al., 2001; Wang and Kuspa, 2002). Studies on regulation of E3SCFUb-ligases, conducted primarily in yeast and mammals, have focused on the E2, RING, cullin, and the F-box protein subunits (Deshaies and Joazeiro, 2009). Some organisms, such as Caenorhabditis elegans and Arabidopsis thaliana, have potentially diversified their SCF complexes through extensive gene duplications of Skp1 (Kong et al., 2004). This study supports the significance of Skp1 diversification with evidence for functional modulation of Skp1 by novel posttranslational modifications in Dictyostelium. Evidence for the widespread occurrence of the pathway in select protists (West et al., 2010) provides a rationale for why Skp1 became evolutionarily fixed as a discrete adaptor in the SCF lineage of E3 Ub-ligases.

Supplementary Material

01

Acknowledgments

We thank Zoe Fischer for performing the MS-analysis of Skp1-myc, and Jennifer Johnson at the Oklahoma Center for Medical Glycobiology at OUHSC for performing the MS-analysis of FLAG-Skp1. This work was supported by NIH grants GM-37539 and GM-84383.

Abbreviations

GlcNAc
N-acetyl-d-glucosamine
HIF
hypoxia inducible factor
Hyp
4-hydroxyproline
PHD
prolyl hydroxylase domain protein
RFP
red fluorescent protein
rP4H1
recombinant His6P4H1 isolated from E. coli
rGnt1
recombinant His6Gnt1 isolated from E. coli
Ub
ubiquitin

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Appendix A. Supplementary data.

Supplementary data associated with this article can be found in the online version.

References

  • Bloomfield G, Tanaka Y, Skelton J, Ivens A, Kay RR. Widespread duplications in the genomes of laboratory stocks of Dictyostelium discoideum. Genome Biol. 2008;9:R75. [PMC free article] [PubMed]
  • Deshaies RJ, Joazeiro CA. RING domain E3 ubiquitin ligases. Annu. Rev. Biochem. 2009;78:399–434. [PubMed]
  • Early A, Abe T, Williams J. Evidence for positional differentiation of prestalk cells and for amorphogenetic gradient in Dictyostelium. Cell. 1995;83:91–99. [PubMed]
  • Ennis HL, Dao DN, Pukatzki SU, Kessin RH. Dictyostelium amoebae lacking an F-box protein form spores rather than stalk in chimeras with wild type. Proc. Natl. Acad. Sci. U.S.A. 2000;97:3292–3297. [PMC free article] [PubMed]
  • Ercan A, Panico M, Sutton-Smith M, Dell A, Morris HR, Matta KL, Gay DF, West CM. Molecular characterization of a novel UDP-galactose:fucoside alpha3-galactosyltransferase that modifies Skp1 in the cytoplasm of Dictyostelium. J. Biol. Chem. 2006;281:12713–12721. [PubMed]
  • Hermand D. F-box proteins: more than baits for the SCF? Cell Div. 2006;1:30. [PMC free article] [PubMed]
  • Kaelin WG, Jr., Ratcliffe PJ. Oxygen sensing by metazoans: the central role of the HIF hydroxylase pathway. Mol. Cell. 2008;30:393–402. [PubMed]
  • Kaplan KB, Hyman AA, Sorger PK. Regulating the yeast kinetochore by ubiquitin-dependent degradation and Skp1p-mediated phosphorylation. Cell. 1997;91:491–500. [PubMed]
  • Kimmel AR, Faix J. Generation of multiple knockout mutants using the Cre-loxP system. Methods Mol. Biol. 2006;346:187–199. [PubMed]
  • Kirsten JH, Xiong Y, Dunbar AJ, Rai M, Singleton CK. Ammonium transporter C of Dictyostelium discoideum is required for correct prestalk gene expression and for regulating the choice between slug migration and culmination. Dev. Biol. 2005;287:146–156. [PubMed]
  • Koivunen P, Hirsila M, Remes AM, Hassinen IE, Kivirikko KI, Myllyharju J. Inhibition of hypoxia-inducible factor (HIF) hydroxylases by citric acid cycle intermediates: possible links between cell metabolism and stabilization of HIF. J. Biol. Chem. 2007;282:4524–4532. [PubMed]
  • Kong H, Leebens-Mack J, Ni W, dePamphilis CW, Ma H. Highly heterogeneous rates of evolution in the SKP1 gene family in plants and animals: functional and evolutionary implications. Mol. Biol. Evol. 2004;21:117–128. [PubMed]
  • Kozarov E, van der Wel H, Field M, Gritzali M, Brown RD, Jr., West CM. Characterization of FP21, a cytosolic glycoprotein from Dictyostelium. J. Biol. Chem. 1995;270:3022–3030. [PubMed]
  • Mohanty S, Lee S, Yadava N, Dealy MJ, Johnson RS, Firtel RA. Regulated protein degradation controls PKA function and cell-type differentiation in Dictyostelium. Genes Dev. 2001;15:1435–1148. [PMC free article] [PubMed]
  • Nelson MK, Clark A, Abe T, Nomura A, Yadava N, Funair CJ, Jermyn KA, Mohanty S, Firtel RA, Williams JG. An F-Box/WD40 repeat-containing protein important for Dictyostelium cell-type proportioning, slug behaviour, and culmination. Dev. Biol. 2000;224:42–59. [PubMed]
  • Sandona D, Gastaldello S, Rizzuto R, Bisson R. Expression of cytochrome c oxidase during growth and development of Dictyostelium. J. Biol. Chem. 1995;270:5587–5593. [PubMed]
  • Sassi S, Sweetinburgh M, Erogul J, Zhang P, Teng-umnuay P, West CM. Analysis of Skp1 glycosylation and nuclear enrichment in Dictyostelium. Glycobiology. 2001;11:283–295. [PubMed]
  • Schiller B, Hykollari A, Voglmeir J, Pöltl G, Hummel K, Razzazi-Fazeli E, Geyer R, Wilson IB. Development of Dictyostelium discoideum is associated with alteration of fucosylated N-glycan structures. Biochem. J. 2009;423:41–52. [PMC free article] [PubMed]
  • Schmidt MW, McQuary PR, Wee S, Hofmann K, Wolf DA. F-box-directed CRL complex assembly and regulation by the CSN and CAND1. Mol. Cell. 2009;35:586–597. [PMC free article] [PubMed]
  • Seol JH, Shevchenko A, Shevchenko A, Deshaies RJ. Skp1 forms multiple protein complexes, including RAVE, a regulator of V-ATPase assembly. Nat. Cell Biol. 2001;3:384–391. [PubMed]
  • Tekinay T, Ennis HL, Wu MY, Nelson M, Kessin RH, Ratner DI. Genetic interactions of the E3 ubiquitin ligase component FbxA with cyclic AMP metabolism and a histidine kinase signaling pathway during Dictyostelium discoideum development. Eukaryot. Cell. 2003;2:618–626. [PMC free article] [PubMed]
  • van der Wel H, Morris HR, Panico M, Paxton T, Dell A, Kaplan L, West CM. Molecular cloning and expression of a UDP-GlcNAc:hydroxyproline polypeptide GlcNAc-transferase that modifies Skp1 in the cytoplasm of Dictyostelium. J. Biol. Chem. 2002a;277:46328–46337. [PubMed]
  • van der Wel H, Fisher SZ, West CM. A bifunctional diglycosyltransferase forms the Fucleft angle bracket1,2Gal®1,3-disaccharide on Skp1 in the cytoplasm of Dictyostelium. J. Biol. Chem. 2002b;277:46527–46534. [PubMed]
  • van der Wel H, Ercan A, West CM. The Skp1 prolyl hydroxylase from Dictyostelium is related to the hypoxia-inducible factor-alpha class of animal prolyl 4-hydroxylases. J. Biol. Chem. 2005;280:14645–14655. [PubMed]
  • Wang B, Kuspa A. CulB, a putative ubiquitin ligase subunit, regulates prestalk cell differentiation and morphogenesis in Dictyostelium spp. Eukaryot. Cell. 2002;1:126–136. [PMC free article] [PubMed]
  • Wang ZA, van der Wel H, Vohra Y, Buskas T, Boons G-J, West CM. Role of a cytoplasmic dual-function glycosyltransferase in O2-regulation of development in Dictyostelium. J. Biol. Chem. 2009;284:28896–28904. [PMC free article] [PubMed]
  • West CM, Erdos GW. The expression of glycoproteins in the extracellular matrix of the cellular slime mold Dictyostelium discoideum. Cell Differentiation. 1988;23:1–16. [PubMed]
  • West CM, Kozarov E, Teng-umnuay P. The cytosolic glycoprotein FP21 of Dictyostelium discoideum is encoded by two genes resulting in a polymorphism at a single amino acid position. Gene. 1997;200:1–10. [PubMed]
  • West CM, van der Wel H, Wang ZA. Prolyl 4-hydroxylase-1 mediates O2-signaling during development of Dictyostelium. Development. 2007;134:3349–3358. [PubMed]
  • West CM, Wang ZA, van der Wel H. A cytoplasmic prolyl hydroxylation and glycosylation pathway modifies Skp1 and regulates O2-dependent development in Dictyostelium. Biochim. Biophys. Acta. 2010;1800:160–171. [PMC free article] [PubMed]
  • Willems AR, Schwab M, Tyers M. A hitchhiker's guide to the cullin ubiquitin ligases: SCF and its kin. Biochim. Biophys. Acta. 2004;1695:133–170. [PubMed]
  • Zhou P, Howley PM. Ubiquitination and degradation of the substrate recognition subunits of SCF ubiquitin-protein ligases. Mol. Cell. 1998;2:571–580. [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...