• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of aacPermissionsJournals.ASM.orgJournalAAC ArticleJournal InfoAuthorsReviewers
Antimicrob Agents Chemother. May 2011; 55(5): 2011–2017.
PMCID: PMC3088187

Integrase Inhibitors Effective against Human T-Cell Leukemia Virus Type 1[down-pointing small open triangle]

Abstract

Drugs targeting the viral enzyme integrase have been in use for several years as part of the treatment regimen for patients with human immunodeficiency virus type 1 (HIV-1), and similar classes of compounds have been shown to inhibit human T-cell leukemia virus type 1 (HTLV-1) integration in vitro. The current study shows that the clinically approved HIV-1 integrase inhibitor, raltegravir, as well as the more recent diketo acid derivative, MK-2048, are active inhibitors of HTLV-1 infection in vitro. These agents were effective in inhibiting cell-free and cell-to-cell transmission of HTLV-1 in lymphoid and nonlymphoid cells. The drugs also inhibited HTLV-1 immortalization of human peripheral blood mononuclear cells. A novel adaptation of the Alu assay for viral integration was used to show that the drugs inhibit viral integration without affecting reverse transcription. These data support the administration of raltegravir and other integrase inhibitors as treatments for patients with HTLV-1-associated diseases.

INTRODUCTION

The retrovirus human T-cell leukemia virus type 1 (HTLV-1) is the etiologic agent of the malignancy adult T cell leukemia (ATL) and the neurological disorder HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP). HTLV-1 is endemic in Southern Japan, the Caribbean, and parts of Africa. There are more than 20 million infected individuals worldwide. The rates of seroprevalence range from 37% in some Japanese communities to <0.01% in parts of Europe (reviewed in reference 17). Although relatively rare in North America, HTLV-1 is commonly found among intravenous drug users (9).

Hallmarks of the retroviral life cycle are the reverse transcription of the viral RNA genome to produce a DNA copy that is then inserted into the host cell DNA, a process catalyzed by the virus-encoded enzyme integrase. The integrated viral DNA is referred to as the provirus. HTLV-1 primarily targets CD4+ lymphocytes and, to a lesser extent, CD8+ T lymphocytes in vivo (15). Upon infection, the virus enters a long clinical latency stage ranging from 10 to >50 years, and infected individuals become asymptomatic, seropositive carriers. After the latent stage, ca. 5% of infected individuals develop ATL or HAM. The majority of ATL patients die within 2 years of presentation with symptoms.

Although host cell factors are believed to contribute to integration site preference, integrase is the principal viral determinant of integration target site specificity (reviewed in reference 3). Chimeric HIV virus carrying murine leukemia virus (MLV) integrase instead of HIV integrase exhibits target site specificity more consistent with that of MLV (11). Integrase catalyzes the insertion of viral cDNA in three stages: complex assembly, 3′ processing, and strand transfer (5, 24). In the complex assembly stage, integrase forms a stable complex with specific viral long terminal repeat (LTR) sequences, after which the 3′ ends of the viral DNA are trimmed, removing a dinucleotide and exposing reactive 3′-OH groups. The 3′-OH groups at the viral DNA ends then covalently attack phosphodiester bonds in the host DNA, cleaving the DNA, and covalently linking the 3′ viral cDNA ends to the host cell DNA in the final stage known as the strand transfer reaction.

A class of compounds known as diketo acids and which are active inhibitors of the strand transfer reaction of HIV-1 integrase was approved for use in patients in 2007 (7). Recent structural data indicate that strand transfer inhibitors work by creating stable intermolecular interactions with active-site residues of the integrase protein. The binding of the drug results in the displacement of viral DNA from the integrase active site and the prevention of strand transfer (6; reviewed in reference 16). A derivative of these compounds, the pyrimidine carboxamide MK-0518 (raltegravir), has been approved for use in patients with human immunodeficiency virus (HIV) and has demonstrated fewer drug-related clinical adverse events than currently used antiretroviral therapies (13).

Several antiviral agents are currently used in the treatment of ATL, including zidovudine and interferon alpha 2a, but these drugs have proven to be only partially successful. In a clinical trial undertaken to assess the efficacy of chemotherapy, followed by antiretroviral therapy (interferon alpha, zidovudine, and lamivudine) in patients with acute ATL, the majority of patients had high viral RNA levels at presentation or during the course of therapy and, while some patient viral loads remained steady or decreased, several displayed increasing viral RNA levels (19). Along with the changes in viral RNA levels, some patients had proviral sequences harboring mutations in the reverse transcriptase open reading frame indicating that the characteristic error-prone retrovirus replication process may have been reactivated (19). Examination of viral integration sites in blood samples from these patients revealed the presence of new integration sites with accompanying disease progression.

Given the structural and functional similarities between the HIV-1 and HTLV-1 integrases, some inhibitors that are active against HIV-1 integrase may also be active against HTLV-1 integrase. Rabaaoui et al. (18) were the first to show that two classes of compounds known to act against HIV-1 integrase—diketo acids (DKA) and styrylquinolines—are also active against HTLV-1 integrase in vitro and ex vivo. We show here that the DKA-based compounds raltegravir and a more recently synthesized inhibitor, MK-2048, display potent antiviral activity against HTLV-1 in vitro. We used cell culture models of both cell-free and cell-to-cell transmission of HTLV-1 in a variety of cell types, including the lymphoid cell line Jurkat and isolated human peripheral blood mononuclear cells (PBMC) to demonstrate that raltegravir and MK-2048 actively prevent HTLV-1 viral integration in vitro, suggesting that integrase inhibitors may be a valuable addition to treatment regimens for patients with ATL.

MATERIALS AND METHODS

Cell lines and media.

Human PBMC were isolated from normal HTLV-1-negative donors, stimulated with 10 μg of phytohemagglutinin (PHA)/ml and 50 U of interleukin-2 (IL-2)/ml for 4 days, and maintained in complete RPMI with 50 U of IL-2/ml. Jurkat and MT2 cell lines were maintained in RPMI supplemented with 10% FetalClone III, 2 mM l-glutamine, and 100 μg of penicillin and streptomycin/ml. B5Luc cells are B5 cells (derived from the DBS-FRhL rhesus monkey lung fibroblast line) with a stably integrated luciferase reporter gene under the control of a Tax-inducible LTR promoter. B5Luc and 293T cells were maintained in Dulbecco modified Eagle medium (DMEM) supplemented with 10% FetalClone III, 2 mM l-glutamine, 100 μg of penicillin and streptomycin/ml, and 1 mM sodium pyruvate.

Virus stock generation.

293T cells were seeded at 4 × 106 per 10-cm plate and subsequently transfected with 3 μg of packaging plasmid, 3 μg of GFP-Luc plasmid (both gifts from D. Derse, National Cancer Institute [4]), and 0.5 μg of vesicular stomatitis virus G protein (VSV-G) encoding plasmid using TransIT transfection reagent (Mirus) according to established protocols. The transfection mixture was replaced with 8 ml of complete DMEM 4 h after transfection, and virus-containing supernatants were collected 72 h later. Virus stocks were cleared of transfected cells by low-speed centrifugation, followed by filtration through 0.45-μm-pore-size filters.

Cell-free virus infections using recombinant virus vectors.

293T cells were seeded at 2.5 × 105 per well in 12-well plates, followed by incubation in the presence of various concentrations of inhibitors for 4 h. Inhibitors were dissolved in dimethyl sulfoxide. All assays were performed in triplicate. The medium was removed and replaced with 350 μl of virus-containing supernatant, and the cells were incubated at 37°C overnight. Complete medium was added to the required final inhibitor concentrations, and the cells were incubated at 37°C for an additional 72 h; they were then lysed, and Promega luciferase assays were performed.

Cell-to-cell infections.

MT2 cells (106 cells lethally irradiated by exposure to 1 Gy) were added to 107 Jurkat cells that had been incubated for 4 h in medium containing various concentrations of raltegravir or MK-2048. After an initial 48 h of incubation, 75% of the cells from each flask were removed and replaced with fresh medium. The cells were passaged twice more, each time removing 75% of the total cell population. At 10 days postinfection, the remaining cells were counted by trypan blue staining, and DNA was extracted from 5 × 106 cells from each flask for analysis by Alu assay for viral integration. To determine whether contaminating MT2 cells were contributing to the measured number of integrations, irradiated MT2 cells and Jurkat cells were counted, maintained in separate flasks, passaged separately as described, mixed on day 10, and immediately counted and lysed for DNA extraction. We called this flask the t = 0 time point, representing an infection time of 0 h.

B5 Luc cells were seeded at 5 × 105 cells per well in six-well plates and incubated overnight in the presence of various concentrations of inhibitor. Irradiated MT2 cells (5 × 105 per well) were added in medium containing the corresponding drug concentrations and maintained for 6 days by replacement of half the total volume of medium every 48 h. On day 6, the cells were lysed, and Promega luciferase assays were performed.

Alu real-time assay for viral integration.

A standard curve was prepared from MT2 cell DNA extracted by using a DNeasy Blood & Tissue Kit (Qiagen) according to the manufacturer's instructions and sequentially diluted in water to stocks containing DNA from 30, 300, and 3,000 MT2 cells per 4-μl volume. DNA from Jurkat cells infected by cell-to-cell infections, as outlined above, was extracted by the same method, eluted in 100 μl of Tris-EDTA (TE) buffer, and diluted in water to the equivalent of DNA from 20,000 cells per 4-μl volume. DNA samples were subjected to two rounds of PCR, in which the first round amplified the DNA sequence between the HTLV-1 LTR and the nearest chromosomal Alu element and the second nested PCR amplified the first round PCR products. The assay was done with an HTLV-1 LTR sequence-specific probe. First round PCR was performed using the forward primer HTLV-RTF (ATGCCACGTAAGCGAAACTGCGCCGTCTAGGTAAGTTTAAAGCTCAGG; the 5′ linker sequence is underlined and followed by sequence complementary to HTLV-1 LTR) and the Alu primers (TCCCAGCTACTGGGGAGGCTGAGG and GCCTCCCAAAGTGCTGGGATTACAG). Primer concentrations for the first reaction were 375 nM for each of the primers in a total reaction volume of 20 μl. An initial 95°C denaturation step of 8 min was followed by 12 cycles of amplification (95°C for 30 s, 58°C for 30 s, and 72°C for 2 min). The second-round real-time PCR was performed with the primers L-T (ATGCCACGTAAGCGAAACTGC) specific to the linker sequence and RTR2 (GAAACAAAGACGTAGAGTTGAGCAAGC) complementary to the HTLV-1 LTR and the HTLV-1 LTR-specific probe (56-FAM-AGCCTACCTAGACTCAGCCGGCTCTCCACGCTTTG-3IABlkFQ) with iQ Supermix reagent (Bio-Rad) according to the manufacturer's instructions. All samples were performed in triplicate with primer concentrations of 350 nM for the probe and 400 nM for L-T and RTR2 in a final volume of 50 μl. This reaction was performed with an initial 95°C denaturation step for 5 min, followed by 40 cycles of amplification (95°C for 30 s, 60°C for 1 min, and 72°C for 30 s). Experimental samples were compared to the MT2 DNA-generated standard curve using a value of three copies of integrated HTLV-1 viral DNA per MT2 cell (1). Reactions were also performed in the absence of Alu primers, and these values were subtracted from those obtained in the presence of the primers in order to account for false-positive signals due to linear amplification of products in the first reaction.

Total DNA assay.

A 2.5-μl portion of infected cell DNA prepared as described above was subjected to one round of PCR amplifying a sequence in the tax region of the genome. The forward and reverse primers were HTLV-1Fwd (AAGACTGTTTGCCCACCACC) and HTLV-1Rev (TTGCCAGGCTGTTAGCGTG), respectively. Reactions were performed in triplicate with iQ SYBR green Supermix 2× mix for real-time PCR applications (Bio-Rad) in 25-μl volume reactions with final primer concentrations of 0.25 μM each. After an initial 10-min denaturation of 95°C, 40 rounds of amplification were performed (95°C for 15 s, 60°C for 30 s, and 60°C for 12 s). The samples were then held at 72°C for 10 s before melting-curve analysis was performed according to established protocols. For a total DNA assay at 24 h postinfection, 3 × 106 293T cells were plated in T25 flasks, followed by incubation in the presence or absence of integrase or reverse transcriptase inhibitor for 4 h. Then, 106 irradiated MT2 cells were added per flask, and infections were allowed to occur for 24 h at 37°C. DNA was extracted by using a Qiagen DNeasy Blood & Tissue Kit according to the manufacturer's instructions and eluted in 100 μl of TE buffer. Total DNA assays were performed as described above with 2.5 μl of a 1:10 dilution of infected DNA in water and compared to a standard curve generated by performing the assay on dilutions of DNA extracted from MT2 cells. A value of three copies of viral DNA per MT2 cell was used to compare the total viral DNA across the various samples (1).

Determining linearity of MT2 standard curve.

Jurkat cells were infected for 10 days by cell-cell infection with irradiated MT2 cells in the absence of inhibitors as described above. DNA from 2 × 104, 1 × 104, 4 × 103, and 2 × 102 infected cells were diluted, where necessary, in carrier DNA (uninfected Jurkat DNA diluted in water) so that the total DNA contributed from the mixture of infected and uninfected DNA would be equivalent to DNA from 2 × 104 cells. Alu assays were performed on each sample as described above.

PBMC immortalization assay.

PBMC (5 × 106) were maintained in T25 flasks in 10 ml of complete RPMI containing 50 U of IL-2/ml (no PHA) and raltegravir, in specified concentrations, and then incubated at 37°C overnight. The following day, 106 irradiated MT2 cells were added to the appropriate flasks. The cells were counted at specified time points by trypan blue staining.

Cell viability assays.

MTT assays were performed according to established protocols. 293T cells (2 × 105/well) were plated in a 12-well plate and exposed to various concentrations of inhibitor or staurosporine (positive control for cell death) for 72 h at 37°C. MTT assay reagent was added, and cells were incubated at 37°C overnight. The cells were lysed in isopropanol, and the optical density values at 560 nm were measured. CellTiter-Blue (Promega) cell viability assays were performed according to the manufacturer's protocols.

p19 antigen enzyme-linked immunosorbent assay (ELISA).

Reactions were performed according to standard protocols. A 450-μl portion of each supernatant was collected and lysed with 50 μl of lysing buffer. Then, 200-μl portions of lysed supernatants were placed in duplicate wells of a 96-well plate, and optical densities of each well were read at 450 nm and compared to that of an HTLV-1 antigen standard by using a Tecan Spectrafluor Plus microplate reader.

Statistical analysis.

The results of all assays were compared by using a two-tailed t test. All statistical analyses compared inhibitor-treated cells to cells that were maintained in medium without drug.

RESULTS

Determining the efficacy of integrase inhibitors against HTLV-1 infection via cell-free infection with recombinant virus vectors.

We first utilized a cell-free infection assay (4) to gauge the effectiveness of a panel of drugs against HTLV-1 infectivity. Infectious virus was generated from transfected cells as detailed above and used to infect 293T cells exposed to various concentrations of drugs. We verified that the virus produced by this method was inhibited by zidovudine (AZT) with a 50% effective concentration (EC50) of 50 nM, in accordance with previously published values (4; data not shown). The experiments were repeated with various concentrations of integrase inhibitors provided by Merck & Co., Inc., including L-870,810, raltegravir (Fig. 1A), and MK-2048 (Fig. 1B). L-870,810 and raltegravir displayed EC50s near the 50 nM range, and treatment with MK-2048 resulted in an EC50 of 1 nM (Fig. 2 and data not shown). Since raltegravir is already approved for clinical use, we decided to focus the rest of the experiments on this compound, and the more recently developed integrase inhibitor MK-2048. Both compounds showed little or no toxicity against 293T cells, indicating that decreased levels of infection observed in the presence of the inhibitors are not attributable to inhibitor toxicity (Fig. 2C).

Fig. 1.
Chemical structures of the integrase inhibitors MK-0518 (A), also known as raltegravir and Isentress, and MK-2048 (B).
Fig. 2.
Raltegravir and MK-2048 significantly inhibit cell-free infection by recombinant HTLV-1 in vitro and are not toxic to target cells. The cell-free infection of 293T cells with luciferase-encoding recombinant HTLV-1 in the presence of increasing concentrations ...

MK-2048 and raltegravir are effective inhibitors of HTLV-1 infection via cell-to-cell transmission.

HTLV-1 infection is primarily achieved through cell-to-cell transmission of virus particles (8). We next tested whether this mode of infection was also subject to inhibition by MK-2048 and raltegravir using B5Luc cells, which are B5 cells (primate kidney fibroblasts) containing a stably integrated luciferase gene under the control of an HTLV-1 LTR promoter (20). Infection of this cell line by HTLV-1 activates the Tax-inducible promoter, resulting in luciferase expression. Infection of B5Luc cells by lethally irradiated MT2 cells, an HTLV-1 transformed lymphoid cell line, was significantly impaired in the presence of raltegravir and MK-2048 at concentrations similar to those observed in the cell-free infection assay (Fig. 3).

Fig. 3.
Raltegravir and MK-2048 significantly inhibit HTLV-1 cell-cell infection of B5 Luc cells. B5Luc cells (fetal rhesus lung cell line clone B5 containing a stably integrated luciferase gene under the control of a Tax-inducible LTR) were coincubated with ...

Raltegravir and MK-2048 inhibit HTLV-1 integration in target cells.

We examined HTLV-1 integration by adapting the Alu assay for viral integration (2) to our HTLV-1 cell-to-cell infection model. Briefly, the assay involves two PCR steps whereby the first step amplifies the DNA sequence between the HTLV-1 LTR and the nearest chromosomal Alu element, and the second nested PCR amplifies the first-round PCR products. To our knowledge, this is the first time the Alu assay for viral integration has been successfully adapted to measure HTLV-1 genomic integration. Total viral DNA was quantified by real-time PCR using primers to the viral tax gene. We tested whether the lymphoid cell line, Jurkat, was affected by the inhibitors in the context of cell-cell viral transmission. As expected, both raltegravir and MK-2048 were effective in reducing the number of integrated viral copies in the target cell line at concentrations within the range identified in the previous cell-free infection, and the B5Luc infection assays (Fig. 4A and B). No integrations were detectable in a sample of MT2 cells after irradiation and cultivation alone for 10 days (data not shown). Raltegravir displayed no toxicity against Jurkat cells, indicating that decreased levels of infection observed in the presence of the inhibitor are not attributable to inhibitor toxicity (Fig. 4C). The standard curve from MT2 cells was reliable in predicting integrations on a linear scale over a 10-fold dilution of infected DNA in carrier DNA (Fig. 4D).

Fig. 4.
Raltegravir and MK-2048 reduce the number of viral integration events and total viral DNA levels per cell in cell-cell infections of Jurkat cells and is not toxic to the cells. (A) Jurkat cells were infected by coincubation with lethally irradiated MT2 ...

Raltegravir prevents immortalization of human PBMC in a dose-dependent manner.

MT2 cells produce infectious virus capable of immortalizing uninfected PBMC (21). We tested whether raltegravir would lower the propensity of the PBMC to be immortalized by virus from MT2 cells by coculturing irradiated MT2 cells with PBMC in the presence of various concentrations of raltegravir. Uninfected PBMC proliferated for 4 weeks, after which they steadily decreased in number and were all dead after 9 weeks in culture, whereas the irradiated MT2 cells alone did not proliferate (data not shown). In the absence of inhibitor, PBMC cultured in the presence of MT2 cells proliferated indefinitely (>89 days), and the number of immortalized cells decreased with increasing concentrations of raltegravir (Fig. 5A). HTLV-1 p19 antigen ELISA performed on viral supernatants removed at day 41 after culture indicated that there was significantly less virus production in raltegravir-treated cells compared to the untreated control (Fig. 5B). As expected, cells cultured for 89 days in the presence of inhibitor displayed a significant decrease in the number of copies of integrated DNA and total DNA relative to the untreated control (Fig. 5C and D).

Fig. 5.
Raltegravir blocks infection of PBMC by HTLV-1 cell-to-cell transmission from irradiated MT2 cells. PBMC were extracted from whole blood and coincubated with irradiated MT2 cells for 90 days. (A) Cell viability was measured by trypan blue stain resistance ...

Antiviral effects of raltegravir and MK-2048 are exhibited at the stage of integration in HTLV-1 cell-cell transmission.

The class of integrase inhibitors described here has been shown to act at the stage of strand transfer in HIV-1 viral integration (7) and in in vitro studies of HTLV-1 integration (18). We measured the consequence of this block on the viral replication cycle by measuring the number of integration events in a cell population. However, any antiviral agent that acts at or before the stage of strand transfer would have the same effect on the number of integrated copies of virus. Treatment of target cells with the nucleoside analog reverse transcriptase inhibitor AZT resulted in a similar decrease in integrated viral DNA in both 293T and Jurkat cells (data not shown). However, because multiple rounds of replication were necessary for these assays, the decrease in integrated DNA was accompanied by a decrease in total viral DNA. If the integrase inhibitors are acting to prevent integration and not at an earlier stage, then we would expect to observe either an increase or no change in total viral DNA at early stages of infection. Therefore, we performed total DNA assays on 293T cells infected with lethally irradiated MT2 cells for 24 h in the presence of MK-2048 and raltegravir, as well as with AZT as a positive control for inhibition of reverse transcription. As expected, total viral DNA levels were significantly diminished by AZT, whereas there was an increase in total viral DNA in raltegravir-treated cells and no significant change in cells treated with MK-2048, indicating that the compounds are effective inhibitors of HTLV-1 viral integration (Fig. 6).

Fig. 6.
Raltegravir- and MK-2048-mediated inhibition of HTLV-1 infection in vitro occurs at the stage of viral integration. Total DNA assays were performed on MT2 cells infected for 24 h by cell-cell contact with lethally irradiated MT2 cells in the presence ...

DISCUSSION

Our data demonstrate that the clinically approved HIV-1 integrase inhibitor raltegravir and the newer DKA-derived drug MK-2048 prevent integration of HTLV-1 in vitro for both cell-free and the more physiologically relevant cell-to-cell modes of infection. We utilized a novel application of the Alu assay for viral integration to measure HTLV-1 integration events in infected cell populations. The effects of DKA derivatives on HTLV-1 viral integration have not been widely studied. Rabaaoui et al. (18) showed that two DKA inhibitors, L-731,988 and L-839,616, prevented HTLV-1 strand transfer with 50% inhibitory concentrations between 50 and 70 nM. These values were obtained from fluorescent PCR quantification of the transfer of synthetic strands of DNA to target sequences in the presence of purified recombinant HTLV-1 integrase in cell-free reactions. In contrast, we used in vitro cell culture models to calculate significantly lower EC50s of 35 and 1 nM for raltegravir and MK-2048, respectively. We also demonstrated that the integrase inhibitor-mediated reduction of the spread of virus by cell-cell transmission, the primary route of HTLV-1 viral propagation, occurred with similar EC50s for these drugs. As with HIV-1 infection, MK-2048 demonstrated significantly improved potency over the original drug, raltegravir, in the context of HTLV-1 infection (23).

One of the problems associated with studying HTLV-1 infection in vitro is the relative difficulty of infecting target cells. Real-time methods to measure total viral DNA are hampered by the presence of contaminating plasmid DNA in infections utilizing cells transfected with the HTLV-1 molecular clone. To circumvent this, we used lethally irradiated cells from the chronically infected HTLV-1 cell line MT2 and, over a period of 10 days, passaged the cells to remove as much background contamination as possible. Over the 10 days, the integrase inhibitors blocked new integrations, reducing the reservoir of integrated virus available for transcription, thus blocking virus spread and decreasing total viral DNA levels. This decrease in total viral DNA in the presence of the integrase inhibitors rendered the antiviral activity of the compounds indistinguishable from the reverse transcriptase inhibitor, AZT, as demonstrated by the Alu assay. Since Jurkat cells did not display high levels of infection above background levels up to 36 h postinfection (data not shown), we used 293T cells to show that whereas AZT caused a highly significant decrease in total viral DNA levels 24 h postinfection, the integrase inhibitors either increased or did not change total viral DNA, indicating that the antiviral effect of the inhibitors is exhibited after reverse transcription.

HIV-1 replicates more efficiently at early stages in infection than HTLV-1 due to its selective targeting to active genes (10, 22). HTLV-1 integration targeted to actively transcribed genomic regions has been associated with more rapid and aggressive disease progression in patients with HAM/TSP (14). ATL patients enrolled in a recent clinical trial displayed high viral RNA levels at presentation or during the course of therapy. Some patients displayed increasing viral RNA levels and proviral sequences harboring mutations in the reverse transcriptase open reading frame, indicating possible viral reactivation (19). A combination of HTLV-1 Tax expression and T cell receptor stimulation have been shown to coactivate viral and cellular gene expression, thereby promoting latent HTLV-1 production (12). The cause-and-effect relationship—whether viral expression is simply a consequence of progression and perhaps a result of lymphocyte activation or whether virus expression and mutation are causing new and more consequential integrations, thus leading to progression—remains unknown.

ATL is a disease with a poor prognosis; the majority of ATL patients die within 2 years of presentation with symptoms and treatment options are currently very limited. The combination of chemotherapy with integrase inhibitors may be a viable treatment option for these patients.

ACKNOWLEDGMENTS

Merck & Co., Inc., provided the integrase inhibitor compounds for study. We thank Mary Beth Anzovino for help with the chemical structures in Fig. 1.

This study was supported by grants from the Public Health Service (CA10073, CA94056, and CA63417) and a Lymphoma & Leukemia Society grant (LLS 6067-10).

Footnotes

[down-pointing small open triangle]Published ahead of print on 22 February 2011.

REFERENCES

1. Albrecht B., Collins N. D., Newbound G. C., Ratner L., Lairmore M. D. 1998. Quantification of human T-cell lymphotropic virus type 1 proviral load by quantitative competitive polymerase chain reaction. J. Virol. Methods 75:123–140 [PubMed]
2. Brussel A., Sonigo P. 2003. Analysis of early human immunodeficiency virus type 1 DNA synthesis by use of a new sensitive assay for quantifying integrated provirus. J. Virol. 77:10119–10124 [PMC free article] [PubMed]
3. Delelis O., Carayon K., Saib A., Deprez E., Mouscadet J. F. 2008. Integrase and integration: biochemical activities of HIV-1 integrase. Retrovirology 5:114. [PMC free article] [PubMed]
4. Derse D., Hill S. A., Lloyd P. A., Chung H., Morse B. A. 2001. Examining human T-lymphotropic virus type 1 infection and replication by cell-free infection with recombinant virus vectors. J. Virol. 75:8461–8468 [PMC free article] [PubMed]
5. Engelman A., Mizuuchi K., Craigie R. 1991. HIV-1 DNA integration: mechanism of viral DNA cleavage and DNA strand transfer. Cell 67:1211–1221 [PubMed]
6. Hare S., Gupta S. S., Valkov E., Engelman A., Cherepanov P. 2010. Retroviral intasome assembly and inhibition of DNA strand transfer. Nature 464:232–236 [PMC free article] [PubMed]
7. Hazuda D. J., et al. 2000. Inhibitors of strand transfer that prevent integration and inhibit HIV-1 replication in cells. Science 287:646–650 [PubMed]
8. Igakura T., et al. 2003. Spread of HTLV-1 between lymphocytes by virus-induced polarization of the cytoskeleton. Science 299:1713–1716 [PubMed]
9. Khabbaz R. F., et al. 1992. Seroprevalence of HTLV-1 and HTLV-2 among intravenous drug users and persons in clinics for sexually transmitted diseases. N. Engl. J. Med. 326:375–380 [PubMed]
10. Leclercq I., Mortreux F., Gabet A. S., Jonsson C. B., Wattel E. 2000. Basis of HTLV type 1 target site selection. AIDS Res. Hum. Retrovir. 16:1653–1659 [PubMed]
11. Lewinski M. K., et al. 2006. Retroviral DNA integration: viral and cellular determinants of target-site selection. PLoS Pathog. 2:e60. [PMC free article] [PubMed]
12. Lin H. C., Hickey M., Hsu L., Medina D., Rabson A. B. 2005. Activation of human T cell leukemia virus type 1 LTR promoter and cellular promoter elements by T cell receptor signaling and HTLV-1 Tax expression. Virology 339:1–11 [PubMed]
13. Markowitz M., et al. 2007. Rapid and durable antiretroviral effect of the HIV-1 Integrase inhibitor raltegravir as part of combination therapy in treatment-naive patients with HIV-1 infection: results of a 48-week controlled study. J. Acquir. Immune Defic. Syndr. 46:125–133 [PubMed]
14. Meekings K. N., Leipzig J., Bushman F. D., Taylor G. P., Bangham C. R. 2008. HTLV-1 integration into transcriptionally active genomic regions is associated with proviral expression and with HAM/TSP. PLoS Pathog. 4:e1000027. [PMC free article] [PubMed]
15. Nagai M., Brennan M. B., Sakai J. A., Mora C. A., Jacobson S. 2001. CD8+ T cells are an in vivo reservoir for human T-cell lymphotropic virus type I. Blood 98:1858–1861 [PubMed]
16. Pommier Y., Johnson A. A., Marchand C. 2005. Integrase inhibitors to treat HIV/AIDS. Nat. Rev. Drug Discov. 4:236–248 [PubMed]
17. Proietti F. A., Carneiro-Proietti A. B., Catalan-Soares B. C., Murphy E. L. 2005. Global epidemiology of HTLV-1 infection and associated diseases. Oncogene 24:6058–6068 [PubMed]
18. Rabaaoui S., et al. 2008. Inhibitors of strand transfer that prevent integration and inhibit human T-cell leukemia virus type 1 early replication. Antimicrob. Agents Chemother. 52:3532–3541 [PMC free article] [PubMed]
19. Ratner L., et al. 2009. Human T cell leukemia virus reactivation with progression of adult T-cell leukemia-lymphoma. PLoS One 4:e4420. [PMC free article] [PubMed]
20. Rauch D., et al. 2009. T-cell activation promotes tumorigenesis in inflammation-associated cancer. Retrovirology 6:116. [PMC free article] [PubMed]
21. Robek M. D., Wong F. H., Ratner L. 1998. Human T-cell leukemia virus type 1 pX-I and pX-II open reading frames are dispensable for the immortalization of primary lymphocytes. J. Virol. 72:4458–4462 [PMC free article] [PubMed]
22. Schroder A. R., et al. 2002. HIV-1 integration in the human genome favors active genes and local hot spots. Cell 110:521–529 [PubMed]
23. Serrao E., Odde S., Ramkumar K., Neamati N. 2009. Raltegravir, elvitegravir, and metoogravir: the birth of “me-too” HIV-1 integrase inhibitors. Retrovirology 6:25. [PMC free article] [PubMed]
24. Yoder K. E., Bushman F. D. 2000. Repair of gaps in retroviral DNA integration intermediates. J. Virol. 74:11191–11200 [PMC free article] [PubMed]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...