• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
Dev Dyn. Author manuscript; available in PMC May 3, 2011.
Published in final edited form as:
PMCID: PMC3086404
NIHMSID: NIHMS284586

Downstream Targets of GATA3 in the Vestibular Sensory Organs of the Inner Ear

Abstract

Haploinsufficiency for the transcription factor GATA3 leads to hearing loss in humans. It is expressed throughout the auditory sensory epithelium (SE). In the vestibular organs, GATA3 is limited to the striola reversal zone of the utricle. Stereocilia orientation shifts 180° at this region which contains morphologically-distinct type I hair cells. The striola is conserved in all amniotes, its function is unknown and GATA3 is the only known marker of the reversal zone. To identify downstream targets of GATA3 that might point to striolar function we measured gene expression differences between striolar and extra-striolar SE. These were compared with profiles after GATA3 RNAi and GATA3 over-expression. We identified four genes (BMP2, FKHL18, LMO4 and MBNL2) that consistently varied with GATA3. Two of these (LMO4 and MBNL2) were shown to be direct targets of GATA3 by ChIP. Our results suggest that GATA3 impacts WNT signaling in this region of the sensory macula.

Keywords: Transcription Factors, Inner Ear, Utricle

Introduction

The vertebrate inner ear originates from the otic placode, a thickening of surface ectoderm that forms above the hindbrain early in embryonic development. In the mouse embryo, the zinc finger transcription factor GATA3 is expressed throughout this placode, beginning at E8-E9.5, and is required for otic cup invagination and closure. The resulting structure, the otic vesicle, eventually develops into all the structures of the inner ear including the vestibular (balance) and cochlear (auditory) organs (Grace Lawoko-Kerali, 2002; Lilleväli et al., 2006). In humans, mutations that cause haploinsufficiency for GATA3 result in hypoparathyroidism, sensorineural deafness and renal anomaly syndrome (HDR) (Van Esch et al., 2000). Homozygous knockout of the GATA3 gene in mice results in embryonic lethality by E11, due to multiple organ abnormalities, massive internal bleeding, a complete inhibition of T-cell differentiation (Pandolfi et al., 1995) and abnormal brain morphology. Heterozygote knockouts are viable, but have a progressive degeneration of cochlear sensory hair cells and corresponding hearing loss (van der Wees et al., 2004), similar to that observed in HDR in humans. Notably, both GATA3 heterozygous and homozygous knock out mice exhibit misrouted axonal projections to the inner ear (Karis et al., 2001) and elsewhere in the nervous system (Nardelli et al., 1999; Lundfald et al., 2007) suggesting a role for GATA3 in neural development.

GATA3 has been most extensively studied in the development and differentiation of the mammalian hematopoietic system. During differentiation of T lymphocytes from hematopoietic stem cells, naïve CD4+ cells differentiate into either T helper type 1 (Th1) or T helper type 2 (Th2) cells. This switch is tightly regulated by GATA3 (Szabo et al., 2003; Mowen and Glimcher, 2004) and involves the direct transcriptional regulation of IL5 and IL13 by GATA3 to specify a Th2 fate (Siegel et al., 1995; Kishikawa et al., 2001; Lavenu-Bombled et al., 2002). GATA3 also plays a significant role in skin development and particularly in specifying inner root sheath cell vs. hair shaft cell differentiation and organization (Kaufman et al., 2003). Recently, a direct binding target of GATA3 has been described in the first intron of the lipid acyltransferase gene AGPAT5, suggesting a critical role for GATA3 in lipid biosynthesis during skin epidermal barrier acquisition (de Guzman Strong et al., 2006). Although some GATA3 transcriptional targets of this type have been described in T-lymphocyte specification, skin differentiation and brain development (Hikke van Doorninck et al., 1999), little is known about its direct targets of action in inner ear development/differentiation.

Most previous studies of GATA3 in the inner ear have focused on its role in embryonic development. However, expression of GATA3 is also maintained in the mature inner ear. In a previous study (Hawkins et al., 2003) we demonstrated that GATA3 is expressed throughout the sensory epithelium of the mature avian cochlea, but its expression in the vestibular organs is limited to a 6–10 cell wide region of supporting cells in the striola of the utricle and lagena in the utricle. This narrow region of GATA3 expression corresponds to the location where hair cell stereocilia undergo a 180° shift in orientation (Flock, 1964) and where hair cell phenotype changes from so-called type I to type II (Fig. 1). Type I hair cells are enclosed by large calyx nerve terminals (Lysakowski and Goldberg, 1997) and are morphologically distinct from type II hair cells, which are contacted by bouton nerve terminals from afferent and efferent neurons (Jørgensen and Andersen, 1973; Jørgensen, 1989). Type I hair cells are conserved within amniotes but are lacking in anamniotes. Although type I and type II hair cells have been studied for over 30 years, specific roles for type I and type II hair cells have not yet been defined. However, the distinct morphologies between type I and type II sensory hair cells suggest specialized functions. The relationship between GATA3 expression and these two morphological changes is not clear. Recent experiments have examined the orientation of regenerated hair cells in explants of the avian utricle following surgical ablation of the GATA3-expressing region. Such hair cells are normally oriented, suggesting that GATA3 probably does not specify hair cell reversal (Warchol and Montcouquiol, in press). Instead, given its function in other developing systems, it is more likely that GATA3 plays a role in specification of hair cell phenotype (as type I vs. type II) and/or axon guidance near the reversal zone. GATA3 is the only marker for the striola described to date. Since the specific functions of the striola and type I hair cells have not yet been defined, identifying the genes and biological pathways specific to GATA3 in the striola may provide functional insights into this enigmatic inner ear structure.

Figure 1
Avian utricle hair cell patterns. The striola region contains the Type I hair cells and the extrastriola region is populated by the Type II hair cells. GATA3 is expressed in a 6–10 cell wide strip of cells corresponding to the striola reversal ...

The present study is aimed at the identification of transcription factors in the inner ear the expression of which is regulated by GATA3. We specifically focused on the striola of the chick utricle, which is comprised of ~10,000 cells. We used four approaches to characterize GATA3-regulated gene expression. First, we used microdissection, micro cDNA amplification methods and custom gene microarrays to identify transcription factor (TF) genes specifically co-expressed with GATA3 in the highly localized striolar region. We next utilized siRNA knockdown of GATA3 and ectopic over-expression of GATA3 to identify genes that are coordinately altered in their expression levels when GATA3 expression is disrupted. This resulted in the identification of four genes (BMP2, FKHL18, LMO4 and MBNL2) that paralleled GATA3 expression in all three comparisons. We next used chromatin immunoprecipitation (ChIP) to confirm that two of these genes (the LIM domain only 4 [LMO4] and muscleblind like-2 [MBNL2] transcription factors) are direct targets for GATA3 binding in the chick utricular sensory epithelium. Finally, we confirmed a subset of our microarray observations by RNA in situ hybridizations, including LMO4 and MBNL2. Taken together, our gene expression data demonstrate that regulation of specific components of Wnt, FGF, Notch and BMP signaling, as well as regulators of neurogenesis and neural survival, are differentially expressed in the striolar vs. extra-striolar regions and possibly play roles in regulating neuronal differentiation and axon guidance to specific hair cell types within the sensory maculae.

Results

Striola vs. extra-striola microarray comparisons

As an initial screen for genes that are potentially regulated by GATA3, we compared gene expression in cells of the striola (which includes the narrow strip of GATA3-expressing reversal zone cells) to expression in the medial extra-striolar region. Our rationale for investigating just transcription factors and components of known signaling pathways was that changes in these molecules frequently act as important switches in genetic programming. Sensory epithelia from mature chick utricles were isolated and micro-dissected into striolar and extra-striolar portions (see Fig. 1). Separation of these distinct sensory regions is more easily accomplished in the chick utricle, compared to the utricles of mice. RNAs from these pooled samples were then compared on a custom oligonucleotide microarray that primarily interrogates transcription factor gene expression (Messina et al., 2004), but also includes oligonucleotides specific to major signaling pathways. All comparative microarray hybridizations consisted of 2 biological samples and 4 technical replicates for each biological sample, including dye switch experiments. To our knowledge this is the first such comparison ever conducted and identified 38 genes that are up-regulated and 45 down-regulated at the striola (Fold change > 2.0 and p-value < 0.05) (Table 1). Notably, the four genes that showed the highest relative levels of expression in the striola (KCNIP4, DKK2, NGN2, and HEY2) have been shown to affect neuronal differentiation (Falk et al., 2002; Sakamoto et al., 2003; Xiong et al., 2004; Guder et al., 2006). For example, the bHLH transcription factor NGN2 can induce neuronal cell fate in mouse neural stem cells (Hu et al., 2005). Expression of NGN2 within the striola was up-regulated by 7.85 fold, compared to the extra-striolar region. In contrast, we observed reduced striolar expression of WNT3A and WNT5 (−7.55 and −5.37 fold changes respectively) and two hairy and enhancer of split (HES) paralogs, HEYL and HRY (−5.02 and −6.99 fold changes respectively). HES genes are components of Notch/Delta signaling, and both HEYL and HRY are known to physically interact with GATA proteins and inhibit transcriptional activity (Kathiriya et al., 2004; Fischer et al., 2005). From this dataset we also identified known components of WNT/beta-catenin signaling (DKK2, FZD5, FZD7, WNT3, WNT3A, WNT5A), FGF signaling (FGF16 and FGF20), Notch signaling (HEY2, HEYL and HRY) and BMP signaling (BMP2, BMP4 and BMP15) (Table 1). Overall, this comparison revealed a complex pattern of gene expression changes that strongly implicate differential expression of WNT, FGF, Notch and BMP signaling pathways within these distinct regions of the sensory maculae.

Table 1
Genes differentially expressed in the striola vs. extra-striola.

GATA3 RNAi knockdown comparisons

To better discriminate between gene expression changes within the striola that are associated with GATA3 expression and those that might be coincidental, we utilized RNAi knockdowns in cultured chick utricles (the entire utricle including striola plus extra-striola regions) to identify genes that potentially act downstream of GATA3. Since GATA3 expression is maintained in the adult utricle, it very likely plays a critical and active role regulating direct targets in the adult striola. We compared gene expression profiles of pure sensory epithelia from whole, explanted utricles transfected in vitro via electroporation with siRNAs for either GATA3 or a GFP control. In order to identify both direct and indirect consequences of GATA3 knockdown, epithelial cells were harvested 48 hours after RNAi treatment. Immunohistochemical labeling indicated that knockdown of GATA3 is maintained at the striola 48 hrs. post siRNA treatment (Fig 2A,B). We identified 63 genes that were up-regulated and 10 genes down-regulated (including GATA3 itself) in response to GATA3 siRNA knockdowns (Fold change > 2.0 and p-value < 0.05) (Table 2). The BAR homeobox transcription factor 1 (BARX1) and BARH-like homeobox 1 (BARHL1) genes exhibited the largest down-regulation in expression (−9.31 and −6.68 fold changes respectively). BARHL1 encodes a homeodomain transcription factor involved in sensorineural development. It is expressed in migrating neurons of the CNS as well as in sensory hair cells, where it is required for long-term survival and maintenance (Bulfone et al., 2000; Li et al., 2002). BARX1 regulates transcription of two WNT antagonists, sFRP1 and sFRP2 (Kim et al., 2005). Consistent with our earlier observation that WNT signaling is differentially regulated in the striola compared to the extra-striola regions, we identified three components of WNT signaling that were up-regulated in GATA3 knockdowns (WNT3, LRP5 and FZD5) and one Wnt gene (WNT5B) that was down-regulated. Expression of the Fibroblast Growth Factor FGF16, which was specifically down-regulated at the striola, was up-regulated in GATA3 knockdowns.

Figure 2
Immunohistochemical labeling with a GATA3 antibody (green) in siRNA treated whole avian utricles. GATA3 immunoreactivity is localized to the 6–10 cell wide strip of cells at the striola reversal zone in the A) control GFP siRNA treated sample ...
Table 2
Genes differentially expressed in GATA3 siRNA treatments.

GATA3 over-expression microarray comparisons

As a reciprocal experiment to our siRNA knockdowns, we next identified genes differentially expressed in response to GATA3 over-expression. Using a pMES vector expressing GATA3 and eGFP under the control of a chick beta-actin promoter we over-expressed GATA3 in dissociated epithelial cells from the chick utricle (see Fig. S1 in supplementary material). Transfection efficiency was determined to be 24% by comparing eGFP expression to total DAPI stained nuclei (n = 136). We quantified changes in gene expression between the GATA3 over-expressing samples and those transfected with an eGFP/pMES (empty) vector. We identified 12 genes that are up-regulated and 11 down-regulated in response to GATA3 over-expression (Fold change > 2.0 and p-value < 0.05) (Table 3). The genes showing the most dramatic up-regulation in response to GATA3 over-expression are the WNT/beta-catenin signaling modulators WNT9A and SFRP2.

Table 3
Genes differentially expressed in GATA3 over-expression.

Downstream effectors of GATA3 expression

To identify genes that are potentially directly regulated by GATA3 we compared expression changes across all three conditions. This is a particularly conservative approach given that GATA3 can in various circumstances act as either an activator or a repressor (Siegel et al., 1995; Lavenu-Bombled et al., 2002; Mantel et al., 2007). It is quite possible that dramatic down-regulation or up-regulation of GATA3 may not have immediately reciprocal effects on actual in vivo target genes in a simplistic model of target selection. Nevertheless, we adopted this filtering approach to identify a set of genes that would be strong candidates for direct regulation. We identified 4 genes with similar or reciprocal expression patterns to GATA3: BMP2, FKHL18, LMO4 and MBNL2 (Table 4). For this comparison, we expanded our datasets to include more modest fold changes (>1.3 fold, p-value < 0.05) across all 3 conditions (see Tables S1, S2 and S3 in supplementary material). As described below, it is clear that at least two of these genes are indeed in vivo targets of GATA3.

Table 4
Genes with similar or reciprocal expression patterns to GATA3 across all three conditions.

We next employed chromatin immunoprecipitation (ChIP) to confirm the direct interaction of GATA3 with two of the four predicted target genes. This experiment was conducted using dissociated epithelial cells from the chick utricle that had been transfected with the pMES vector, to over-express GATA3. Putative GATA binding sites were computationally identified, using TF Search (Heinemeyer et al., 1998), upstream of the transcription start sites of LMO4 and MBNL2. Searches within the regions surrounding the other two genes did not reveal convincing putative GATA3 targets. However, as previously noted, biologically functional GATA3 sites are not strictly confined to promoter-proximal sites and broader search parameters revealed numerous potential GATA3 sites. Primers were designed surrounding the putative GATA binding sites adjacent to the LMO4 and MBNL2 genes. These were used to PCR amplify those regions after ChIP pull-down with a GATA3 polyclonal antibody (see Table S4 in supplementary material). PCR products for each candidate region were compared to products from a mock antibody pull-down, in order to identify enrichment by GATA3 ChIP (Fig. 3). We identified enrichment of 1 region upstream of the LMO4 transcription start site, −627 to −818, containing two putative GATA binding sites and another region upstream of the MBNL2 transcription start site, −1574 to −1950, containing 8 putative GATA binding sites. These data strongly support the classification of these two genes as being directly regulated by GATA3.

Figure 3
Direct in-vivo interactions with GATA3 were demonstrated by ChIP in dissociated sensory epithelia over-expressing GATA3. PCR amplification with primers flanking putative GATA binding sites identified enrichment in the anti-GATA antibody (+) ChIP compared ...

To independently verify the expression patterns predicted by our microarray comparisons and confirm that those expression patterns were consistent with direct regulation by GATA3, we conducted RNA in situ hybridizations on whole mount chicken utricles (Fig. 4). In agreement with our microarray data we found that the area of LMO4 expression surrounds and encloses the striolar region. Our microarray data indicate that MBNL2 exhibits a reciprocal pattern of expression to that of GATA3. In agreement with this, we found that MBNL2 is not expressed at the striola, but is confined to the medial region of the utricle bordering the striola. This is consistent with a model in which GATA3 acts to repress MBNL2 expression, but positively regulates LMO4 expression at the striola.

Figure 4
In situ hybridizations confirm expression patterns of LMO4 and MBNL2 predicted by our microarray and ChIP data. Immunohistochemical labeling with a GATA3 antibody (green) and RNA in situ hybridizations with antisense probes to LMO4 and MBNL2 in whole ...

Discussion

In this study, we report the first large-scale study of regionalized differences in gene expression in the vestibular sensory organs. We focused on genes that are differentially expressed in the striolar vs. extra-striolar regions of the chick utricle, and which are associated with the expression of the zinc finger transcription factor GATA3. Most notable among the detected differences were those involving genes implicated in WNT signaling and neurogenesis. Our data indicate that the neurogenesis regulators, KCNIP4, NGN2, and HEY2, may be correlated with the presence of type I vestibular hair cells. KCNIP4 is particularly interesting, as it encodes a potassium channel-interacting protein that regulates membrane excitability (Holmqvist et al., 2002; Rhodes et al., 2004) and has also been shown to inhibit WNT signaling by promoting presenilin (PS1) mediated degradation of β-catenin (Kitagawa et al., 2007). Consistent with this observation we also identified 6 modulators of WNT signaling that are differentially regulated at the striola. Three secreted WNT ligands, WNT3, WNT3a and WNT5a, and two WNT receptors, FZD5 and FZD7, are specifically down-regulated in the striolar region. In contrast, the striola expresses high levels of the Wnt modulator Dickkopft2 (DKK2). DKK2 acts as a context-dependant agonist or antagonist of WNT/beta-catenin signaling depending on the presence of its co-factor Kremen-2 (Mao and Niehrs, 2003). Although there is no known chick ortholog to Kremen-2, we did note that GATA3 over-expression resulted in strong upregulation of the WNT antagonist SFRP2 (5.84 fold change). Together, our data suggests a model in which GATA3 expression leads to down-regulation of WNT signaling at the striola. In support of this, a previous study identified overrepresentation of WNT signaling, Notch signaling, FGF signaling and BMP signaling gene expression in GATA3 conditional knockouts of mouse skin epidermis and hair follicles (Kurek et al., 2007). GATA3 is also required for differentiation and organization of hair follicles during skin development and regeneration (Kaufman et al., 2003). Our data suggest that GATA3 may regulate these same signaling pathways in the utricle striola. In addition, GATA3-regulated differences in Wnt signaling may play an important role in type I vs. type II hair cell differentiation and/or function. Further studies, based upon the candidate genes identified here, should help to resolve these issues.

In addition to implicating candidate effectors within the striola, we also used chromatin immunoprecipitation to identify two direct gene targets of GATA3 and an additional two genes whose expression consistently varies with GATA3 levels and localization. BMP2 has previously been shown to act downstream of Wnt signaling during osteoblast differentiation (Rawadi et al., 2003; Morvan et al., 2006) and our gene expression data suggest that GATA3 may inhibit BMP2 at the striola, although it is not clear whether this is direct or indirect regulation. Of the confirmed direct targets, the LIM domain only 4 gene (LMO4) encodes a cystein-rich transcription regulator containing two LIM domains. The zinc finger binding domains of LMO4 are structurally similar to GATA zinc fingers (Perez-Alvarado et al., 1994). However, no specific LIM-DNA interaction has been reported. Rather, LIM family members are thought to act as part of a transcriptional complex that is mediated by protein-protein interactions: LIM family members have been shown to interact with GATA transcription factors during hematopoiesis (Osada et al., 1995; Wadman et al., 1997) and in the spinal cord, LMO4 interacts with GATA transcription factors to regulate the balanced generation of inhibitory and excitatory neurons (Joshi et al., 2009). In the inner ear, LMO4 is detected in the mouse otic placode at E8.5 and by E10.5 it is expressed primarily in the dorsolateral regions of the otic vesicle that will eventually form the vestibular organs (Fekete and Wu, 2002; Burton et al., 2004; Deng et al., 2006). This pattern appears to be coincident with GATA3 expression, which also occurs throughout the otic placode at E8 and is also restricted to the dorsolateral otic vesicle by E10.5 (Grace Lawoko-Kerali, 2002). Our gene expression and in situ hybridization results confirm this pattern of spatial and temporal co-expression in the mature utricle as well. Taken together, these data suggest that GATA3 and LMO4 may partner during ear development. In addition, our ChIP data indicate that LMO4 is itself a direct target of GATA3 activity within the mature utricle and very likely throughout inner ear development.

We also identified the muscleblind-like 2 (MBNL2) gene as a direct binding target of GATA3 in the utricle. In this case, given the fact that MBNL2 gene expression shows a reciprocal pattern to GATA3, we would postulate that GATA3 represses MBNL2 in the striolar region. The Muscleblind family of proteins regulate alternative exon splicing during differentiation in many cell types, including muscle, neurons and photoreceptors. MBNL2 can also function as an RNA binding protein essential for integrin α3 subcellular localization (Adereth et al., 2005; Maya Pascual, 2006). Interestingly, a role for integrins in hair cell differentiation and stereocilia maturation has previously been described (Littlewood Evans and Muller, 2000). Taken together these observations suggest that GATA3 may play a role in subcellular localization of integrins and in the regulation of alternative splicing between type I and type II sensory hair cells in the utricle.

Overall, the current study represents the first large-scale investigation of GATA3 and its function in the vestibular organs. The identification of two direct DNA binding targets lays the groundwork for eventually building the entire pathway of GATA3 interactions in the utricle. Our gene expression data strongly suggest that at least one of these interactions is with WNT signaling and that WNT signaling, or suppression of WNT signaling, may play a pivotal role in the striola reversal zone. Our dataset also provides many differentially expressed genes that have not yet been parsed into known pathways. These will be good candidates for future exploration of the exact function of the striola and its conservation within amniote species.

Experimental Procedures

Tissue dissection

10–21 day post hatch White Leghorn chicks were CO2 asphyxiated and decapitated, heads were immersed in chilled 70% ethanol for 10 min. Utricles were removed and immediately placed in chilled Medium 199 with Hanks salts.

Separation of striolar and extrastriolar regions of the utricle

Explanted utricles were placed in Medium-199 with Hanks salts and iridectomy scissors were used to cut away the edges of the sensory organs (which are comprised of nonsensory transitional epithelium). The remaining sensory tissue was then cut along the anterior-posterior axis, in order to separate the lateral portion of the epithelium (which contains the striola, the GATA3-expressing region and all type I hair cells) from the medial portion (which does not express GATA3 and is populated exclusively by type II hair cells – Fig. 1). Striolar and extrastriolar regions from 10 utricles were separated into two groups and were incubated for 60 min. in 500 μg/ml thermolysin (at 37°C). A fine needle was then used to remove the sensory epithelium from each of the utricular fragments, and mRNA from the striolar and extra-striolar groups was extracted with 100 μl Trizol.

siRNA transfection

Whole utricle specimens were treated 1 mM streptomycin in Medium 199 with Earles salts supplemented with 10% FBS for 24 hours. At this point specimens were rinsed 3× with fresh Medium199/10% FBS and cultured for an additional 24 hours to recover. Whole utricle siRNA transfections were performed by electroporation. Utricles were transfected with 21mer synthetic siRNAs (Ambion) at a final concentration of 100 nM siRNA in 30 μl H2O under the following conditions: 50 Volts, 30 ms pulse for 10 pulses. Specimens were returned to Medium 199/10% FBS for an additional 48 hours and pure sensory epithelia were isolated using previously published methods (Warchol, 2002).

Whole utricles were transfected with either GFP synthetic siRNA target sequence (AGGAGAAGAACTTTTCACT) or an equal concentration of GATA3 synthetic siRNA target sequence (AAGGCAGGGAGTGTGTAAATT).

GATA3 overexpression

Dissociated sensory epithelia were plated in 96 well cultures, 5 wells per sample. 4 days post plating, ~ 30% confluency, cells were transfected with a pMES vector containing an internal ribosome entry site regulating expression of GATA3 and eGFP under control of a chick beta-actin promoter. Controls were transfected with a vector containing eGFP only. Transfections were performed using recommended concentrations for Lipofectamine 2000 (Invitrogen). 24 hours post transfection cells were harvested in 100 μl Trizol per well, 5 wells were combined for each biological sample.

cDNA amplification and microarray hybridization

RNA isolation and cDNA synthesis was carried out as previously described (Hawkins et al., 2003), with the following modifications. Following cDNA amplification from the streptavidin coated beads cDNA was used for in-vitro transcription (T7 MegaScript Kit, Ambion). Following LiCl precipitation and 75% ethanol wash, 1 μg poly (A)+ RNA was used for indirect labeling using Genisphere 3DNA Array 50 Kit following manufacturers protocols and hybridized to a custom oligonucleotide microarray at 42C

Microarray design and analysis

All microarray hybridizations were conducted on a custom microarray consisting of 50–70 mer oligonucleotides designed to the majority of human transcription factor genes (Messina et al., 2004). Probes were designed to coding regions and have been shown to accurately report expression in chicken under appropriate conditions (Hawkins et al., 2003). Microarray comparisons were Lowess normalized, genes with intensity below background as determined by control spots were removed. All comparative microarray hybridizations consisted of 2 biological samples and 4 technical replicates for each biological sample, including dye switch experiments. A one-sample t-test was used to identify genes that showed statistically consistent changes in gene expression with a P-value < 0.05 across all replicates for each condition. All microarray data has been deposited with NCBI GEO with accession number GSE14792.

RNA in situs

Primers were designed to generate 200–400 bp PCR amplicons from chicken sequences. A second round of PCR was used to add T7 promoters to either the 5′ or 3′ end. PCR products were gel purified and verified by DNA sequencing. PCR templates were used to separately generate DIG labeled in-vitro transcripts (Ambion T7 MegaScript Kit) for both sense and anti-sense strands. Utricles were obtained from 10–21 day old White Leghorn chicks and processed for whole mount in situs following published protocols (Henrique et al., 1995) Utricles were labeled and mounted in glycerol/PBS (9:1) and imaged.

ChIP

Chromatin immunoprecipitation was performed in dissociated sensory epithelia over-expressing GATA. Sensory epithelia from 10 utricles were physically dissociated and plated in 6 well cultures and transfected with a GATA3 expressing pMES vector as previously described. ChIP was conducted following recommended protocols (Active Motif). Specifically, enzymatic shearing was conducted for 10 min and IP was performed with the GATA3 goat polyclonal IgG sc-22205 (Santa Cruz) at a concentration of 3 μg/100 μl or a mock antibody negative control. Predicted GATA binding sites were identified up to 2000 bp upstream of predicted target genes using TF Search (Heinemeyer et al., 1998). PCR primers were designed flanking putative GATA binding sites (see Table S4 in supplementary material) and ChIP pull down products were amplified for 30 cycles with a 55 °C annealing temperature followed by an additional 30 cycles and imaged by agarose gel electrophoresis.

Supplementary Material

Supp Fig S1

Supp Table S1

Supp Table S2

Supp Table S3

Supp Table S4

Acknowledgments

Grant Sponsor: NIH; RO1DC005632

We thank Dr. Anne M. Bowcock for critical reading of this paper. This work was supported by a grant (NIH RO1DC005632) to ML.

References

  • Adereth Y, Dammai V, Kose N, Li R, Hsu T. RNA-dependent integrin alpha3 protein localization regulated by the Muscleblind-like protein MLP1. Nat Cell Biol. 2005;12:1240–1247. [PMC free article] [PubMed]
  • Bulfone A, Menguzzato E, Broccoli V, Marchitiello A, Gattuso C, Mariani M, Consalez GG, Martinez S, Ballabio A, Banfi S. Barhl1, a gene belonging to a new subfamily of mammalian homeobox genes, is expressed in migrating neurons of the CNS. Hum Mol Genet. 2000;9:1443–1452. [PubMed]
  • Burton Q, Cole LK, Mulheisen M, Chang W, Wu DK. The role of Pax2 in mouse inner ear development. Developmental Biology. 2004;272:161–175. [PubMed]
  • de Guzman Strong C, Wertz PW, Wang C, Yang F, Meltzer PS, Andl T, Millar SE, Ho IC, Pai S-Y, Segre JA. Lipid defect underlies selective skin barrier impairment of an epidermal-specific deletion of Gata-3. J Cell Biol. 2006;175:661–670. [PMC free article] [PubMed]
  • Deng M, Pan L, Xie X, Gan L. Differential expression of LIM domain-only (LMO) genes in the developing mouse inner ear. Gene Expression Patterns. 2006;6:857–863. [PubMed]
  • Falk A, Holmström N, Carlén M, Cassidy R, Lundberg C, Frisén J. Gene Delivery to Adult Neural Stem Cells. Experimental Cell Research. 2002;279:34–39. [PubMed]
  • Fekete DM, Wu DK. Revisiting cell fate specification in the inner ear. Current Opinion in Neurobiology. 2002;12:35–42. [PubMed]
  • Fischer A, Klattig J, Kneitz B, Diez H, Maier M, Holtmann B, Englert C, Gessler M. Hey Basic Helix-Loop-Helix Transcription Factors Are Repressors of GATA4 and GATA6 and Restrict Expression of the GATA Target Gene ANF in Fetal Hearts. Mol Cell Biol. 2005;25:8960–8970. [PMC free article] [PubMed]
  • Flock A. Structure of the macula utriculi with special reference to directional interplay of sensory responses as revealed by morphological polarization. J Cell Biol. 1964;22:413–431. [PMC free article] [PubMed]
  • Grace Lawoko-Kerali MNRMH. Expression of the transcription factors GATA3 and Pax2 during development of the mammalian inner ear. The Journal of Comparative Neurology. 2002;442:378–391. [PubMed]
  • Guder C, Pinho S, Nacak TG, Schmidt HA, Hobmayer B, Niehrs C, Holstein TW. An ancient Wnt-Dickkopf antagonism in Hydra. Development. 2006;133:901–911. [PubMed]
  • Hawkins RD, Bashiardes S, Helms CA, Hu L, Saccone NL, Warchol ME, Lovett M. Gene expression differences in quiescent versus regenerating hair cells of avian sensory epithelia: implications for human hearing and balance disorders. Hum Mol Genet. 2003;12:1261–1272. [PubMed]
  • Heinemeyer T, Wingender E, Reuter I, Hermjakob H, Kel AE, Kel OV, Ignatieva EV, Ananko EA, Podkolodnaya OA, Kolpakov FA, Podkolodny NL, Kolchanov NA. Databases on Transcriptional Regulation: TRANSFAC, TRRD, and COMPEL. Nucleic Acids Res. 1998;26:364–370. [PMC free article] [PubMed]
  • Henrique D, Adam J, Myat A, Chitnis A, Lewis J, Ish-Horowicz D. Expression of a Delta homologue in prospective neurons in the chick. Nature. 1995;375:787–790. [PubMed]
  • Hikke van Doorninck J, van der Wees J, Karis A, Goedknegt E, Coesmans M, Rutteman M, Grosveld F, De Zeeuw CI. GATA-3 Is Involved in the Development of Serotonergic Neurons in the Caudal Raphe Nuclei. J Neurosci. 1999;19:12RC. [PubMed]
  • Holmqvist MH, Cao J, Hernandez-Pineda R, Jacobson MD, Carroll KI, Sung MA, Betty M, Ge P, Gilbride KJ, Brown ME, Jurman ME, Lawson D, Silos-Santiago I, Xie Y, Covarrubias M, Rhodes KJ, Distefano PS, An WF. Elimination of fast inactivation in Kv4 A-type potassium channels by an auxiliary subunit domain. Proceedings of the National Academy of Sciences of the United States of America. 2002;99:1035–1040. [PMC free article] [PubMed]
  • Hu Z, Wei D, Johansson CB, Holmström N, Duan M, Frisén J, Ulfendahl M. Survival and neural differentiation of adult neural stem cells transplanted into the mature inner ear. Experimental Cell Research. 2005;302:40–47. [PubMed]
  • Jørgensen J. Number and distribuition of hair cells in the utricular macula of some avian species. J Morphol. 1989;201:187–204.
  • Jørgensen J, Andersen T. On the structure of the avian maculae. Acta Zool. 1973;54:121–130.
  • Joshi K, Lee S, Lee B, Lee JW, Lee S-K. LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons. Neuron. 2009;61:839–851. [PMC free article] [PubMed]
  • Karis A, Pata I, van Doorninck JH, Grosveld F, de Zeeuw CI, de Caprona D, Fritzsch B. Transcription factor GATA-3 alters pathway selection of olivocochlear neurons and affects morphogenesis of the ear. The Journal of Comparative Neurology. 2001;429:615–630. [PubMed]
  • Kathiriya IS, King IN, Murakami M, Nakagawa M, Astle JM, Gardner KA, Gerard RD, Olson EN, Srivastava D, Nakagawa O. Hairy-related Transcription Factors Inhibit GATA-dependent Cardiac Gene Expression through a Signal-responsive Mechanism. J Biol Chem. 2004;279:54937–54943. [PubMed]
  • Kaufman CK, Zhou P, Pasolli HA, Rendl M, Bolotin D, Lim K-C, Dai X, Alegre M-L, Fuchs E. GATA-3: an unexpected regulator of cell lineage determination in skin. Genes Dev. 2003;17:2108–2122. [PMC free article] [PubMed]
  • Kim B-M, Buchner G, Miletich I, Sharpe PT, Shivdasani RA. The Stomach Mesenchymal Transcription Factor Barx1 Specifies Gastric Epithelial Identity through Inhibition of Transient Wnt Signaling. Developmental Cell. 2005;8:611–622. [PubMed]
  • Kishikawa H, Sun J, Choi A, Miaw S-C, Ho IC. The Cell Type-Specific Expression of the Murine IL-13 Gene Is Regulated by GATA-3. J Immunol. 2001;167:4414–4420. [PubMed]
  • Kitagawa H, Ray WJ, Glantschnig H, Nantermet PV, Yu Y, Leu C-T, Harada S-i, Kato S, Freedman LP. A Regulatory Circuit Mediating Convergence between Nurr1 Transcriptional Regulation and Wnt Signaling. Mol Cell Biol. 2007;27:7486–7496. [PMC free article] [PubMed]
  • Kurek D, Garinis GA, van Doorninck JH, van der Wees J, Grosveld FG. Transcriptome and phenotypic analysis reveals Gata3-dependent signalling pathways in murine hair follicles. Development. 2007;134:261–272. [PubMed]
  • Lavenu-Bombled C, Trainor CD, Makeh I, Romeo P-H, Max-Audit I. Interleukin-13 Gene Expression Is Regulated by GATA-3 in T Cells. ROLE OF A CRITICAL ASSOCIATION OF A GATA AND TWO GATG MOTIFS. J Biol Chem. 2002;277:18313–18321. [PubMed]
  • Li S, Price SM, Cahill H, Ryugo DK, Shen MM, Xiang M. Hearing loss caused by progressive degeneration of cochlear hair cells in mice deficient for the Barhl1 homeobox gene. Development. 2002;129:3523–3532. [PubMed]
  • Lilleväli K, Haugas M, Matilainen T, Pussinen C, Karis A, Salminen M. Gata3 is required for early morphogenesis and Fgf10 expression during otic development. Mechanisms of Development. 2006;123:415–429. [PubMed]
  • Littlewood Evans A, Muller U. Stereocilia defects in the sensory hair cells of the inner ear in mice deficient in integrin [alpha]8[beta]1. Nat Genet. 2000;24:424–428. [PubMed]
  • Lundfald L, Restrepo CE, Butt SJB, Peng C-Y, Droho S, Endo T, Zeilhofer HU, Sharma K, Kiehn O. Phenotype of V2-derived interneurons and their relationship to the axon guidance molecule EphA4 in the developing mouse spinal cord. European Journal of Neuroscience. 2007;26:2989–3002. [PubMed]
  • Lysakowski A, Goldberg J. A regional ultrastructural analysis of the cellular and synaptic architecture in the chinchilla cristae ampullares. The Journal of Comparative Neurology. 1997;389:419–443. [PubMed]
  • Mantel P-Y, Kuipers H, Boyman O, Rhyner C, Ouaked N, Rümlckert B, Karagiannidis C, Lambrecht BN, Hendriks RW, Crameri R, Akdis CA, Blaser K, Schmidt-Weber CB. GATA3-Driven Th2 Responses Inhibit TGF-β1-Induced FOXP3 Expression and the Formation of Regulatory T Cells. PLoS Biol. 2007;5:e329. [PMC free article] [PubMed]
  • Mao B, Niehrs C. Kremen2 modulates Dickkopf2 activity during Wnt/lRP6 signaling. Gene. 2003;302:179–183. [PubMed]
  • Maya Pascual MVLMRA. The Muscleblind family of proteins: an emerging class of regulators of developmentally programmed alternative splicing. Differentiation. 2006;74:65–80. [PubMed]
  • Messina DN, Glasscock J, Gish W, Lovett M. An ORFeome-based Analysis of Human Transcription Factor Genes and the Construction of a Microarray to Interrogate Their Expression. Genome Res. 2004;14:2041–2047. [PMC free article] [PubMed]
  • Morvan F, Boulukos K, Clément-Lacroix P, Roman Roman S, Suc-Royer I, Vayssière Ba, Ammann P, Martin P, Pinho S, Pognonec P, Mollat P, Niehrs C, Baron R, Rawadi G. Deletion of a Single Allele of the Dkk1 Gene Leads to an Increase in Bone Formation and Bone Mass. Journal of Bone and Mineral Research. 2006;21:934–945. [PubMed]
  • Mowen KA, Glimcher LH. Signaling pathways in Th2 development. Immunological Reviews. 2004;202:203–222. [PubMed]
  • Nardelli J, Thiesson D, Fujiwara Y, Tsai F-Y, Orkin SH. Expression and Genetic Interaction of Transcription Factors GATA-2 and GATA-3 during Development of the Mouse Central Nervous System. Developmental Biology. 1999;210:305–321. [PubMed]
  • Osada H, Grutz G, Axelson H, Forster A, Rabbitts TH. Association of erythroid transcription factors: complexes involving the LIM protein RBTN2 and the zinc-finger protein GATA1. Proceedings of the National Academy of Sciences of the United States of America. 1995;92:9585–9589. [PMC free article] [PubMed]
  • Pandolfi PP, Roth ME, Karis A, Leonard MW, Dzierzak E, Grosveld FG, Engel JD, Lindenbaum MH. Targeted disruption of the GATA3 gene causes severe abnormalities in the nervous system and in fetal liver haematopoiesis. Nat Genet. 1995;11:40–44. [PubMed]
  • Perez-Alvarado G, Miles C, Michelsen J, Louis H, Winge D, Beckerle M, Summers M. Structure of the carboxy-terminal LIM domain from the cysteine rich protein CRP. Nat Struct Biol. 1994;6:388–398. [PubMed]
  • Rawadi G, BV, Dunn F, Baron R, Roman-Roman S. BMP-2 controls alkaline phosphatase expression and osteoblast mineralization by a Wnt autocrine loop. J Bone Miner Res. 2003;18:1842–1853. [PubMed]
  • Rhodes KJ, Carroll KI, Sung MA, Doliveira LC, Monaghan MM, Burke SL, Strassle BW, Buchwalder L, Menegola M, Cao J, An WF, Trimmer JS. KChIPs and Kv4 {alpha} Subunits as Integral Components of A-Type Potassium Channels in Mammalian Brain. J Neurosci. 2004;24:7903–7915. [PubMed]
  • Sakamoto M, Hirata H, Ohtsuka T, Bessho Y, Kageyama R. The Basic Helix-Loop-Helix Genes Hesr1/Hey1 and Hesr2/Hey2 Regulate Maintenance of Neural Precursor Cells in the Brain. J Biol Chem. 2003;278:44808–44815. [PubMed]
  • Siegel MD, Zhang D-H, Ray P, Ray A. Activation of the Interleukin-5 Promoter by cAMP in Murine EL-4 Cells Requires the GATA-3 and CLE0 Elements. J Biol Chem. 1995;270:24548–24555. [PubMed]
  • Szabo SJ, Sullivan BM, Peng SL, Glimcher LH. Molecular mechanisms regulating Th1 immune response. Annual Review of Immunology. 2003;21:713–758. [PubMed]
  • van der Wees J, van Looij MAJ, de Ruiter MM, Elias H, van der Burg H, Liem S-S, Kurek D, Engel JD, Karis A, van Zanten BGA, De Zeeuw CI, Grosveld FG, van Doorninck JH. Hearing loss following Gata3 haploinsufficiency is caused by cochlear disorder. Neurobiology of Disease. 2004;16:169–178. [PubMed]
  • Van Esch H, Groenen P, Nesbit MA, Schuffenhauer S, Lichtner P, Vanderlinden G, Harding B, Beetz R, Bilous RW, Holdaway I, Shaw NJ, Fryns J-P, Van de Ven W, Thakker RV, Devriendt K. GATA3 haplo-insufficiency causes human HDR syndrome. Nature. 2000;406:419–422. [PubMed]
  • Wadman I, Osada H, Grutz G, Agulnick A, Westphal H, Rabbitts TH. The LIM-only protein Lmo2 is a bridging molecule assembling an erythroid, DNA-binding complex which includes the TAL1, E47, GATA-1 and Ldb1/NLI proteins. The EMBO Journal. 1997;16:3145–3157. [PMC free article] [PubMed]
  • Warchol ME. Cell Density and N-Cadherin Interactions Regulate Cell Proliferation in the Sensory Epithelia of the Inner Ear. J Neurosci. 2002;22:2607–2616. [PubMed]
  • Warchol ME, Montcouquiol M. Maintained Expression of the Planar Cell Polarity Molecule Vangl2 and Reformation of Hair Cell Orientation in the Regenerating Inner Ear. JARO in press. [PMC free article] [PubMed]
  • Xiong H, Kovacs I, Zhang Z. Differential distribution of KChIPs mRNAs in adult mouse brain. Molecular Brain Research. 2004;128:103–111. [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...