• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of jbacterPermissionsJournals.ASM.orgJournalJB ArticleJournal InfoAuthorsReviewers
J Bacteriol. Mar 2011; 193(5): 1034–1041.
Published online Dec 17, 2010. doi:  10.1128/JB.00694-10
PMCID: PMC3067590

Inerolysin, a Cholesterol-Dependent Cytolysin Produced by Lactobacillus iners[down-pointing small open triangle]

Abstract

Lactobacillus iners is a common constituent of the human vaginal microbiota. This species was only recently characterized due to its fastidious growth requirements and has been hypothesized to play a role in the pathogenesis of bacterial vaginosis. Here we present the identification and molecular characterization of a protein toxin produced by L. iners. The L. iners genome encodes an open reading frame with significant primary sequence similarity to intermedilysin (ILY; 69.2% similarity) and vaginolysin (VLY; 68.4% similarity), the cholesterol-dependent cytolysins from Streptococcus intermedius and Gardnerella vaginalis, respectively. Clinical isolates of L. iners produce this protein, inerolysin (INY), during growth in vitro, as assessed by Western analysis. INY is a pore-forming toxin that is activated by reducing agents and inhibited by excess cholesterol. It is active across a pH range of 4.5 to 6.0 but is inactive at pH 7.4. At sublytic concentrations, INY activates p38 mitogen-activated protein kinase and allows entry of fluorescent phalloidin into the cytoplasm of epithelial cells. Unlike VLY and ILY, which are human specific, INY is active against cells from a broad range of species. INY represents a new target for studies directed at understanding the role of L. iners in states of health and disease at the vaginal mucosal surface.

The cholesterol-dependent cytolysins (CDCs) are a family of protein toxins produced by a wide range of Gram-positive bacteria. CDCs share several characteristics, including a four-domain structure, a requirement for membrane cholesterol for efficient activity, and an ability to form large pores in host cells, exceeding 150 Å in diameter (38). In general, soluble CDC monomers are secreted into the extracellular environment and bind to target cell membranes through direct recognition of cholesterol or, in the cases of the human-specific toxins vaginolysin (VLY) from Gardnerella vaginalis and intermedilysin (ILY) from Streptococcus intermedius, via recognition of human CD59 on the target cell surface (12, 14, 21). Following membrane association, CDCs oligomerize to form a prepore structure, a process that is dependent upon the availability of cholesterol (22-24, 34). In many cases, CDCs are required for virulence for their cognate organisms, and rather than acting solely as cytolytic toxins, CDCs may have more sophisticated roles in disease pathogenesis (15, 18, 30). Understanding CDC evolution and host specificity is of considerable interest and has been limited by incomplete knowledge of the diversity of the CDC family. In particular, characterization of cytolysins most closely related to those in which host specificity has evolved may provide additional insights into the mechanism and effects of such restriction.

Lactobacillus iners is a relatively recently recognized member of the human vaginal microbiota (9, 33, 42) that was initially overlooked because of its inability to grow on de Man-Rogosa-Sharpe agar, which is normally used to isolate vaginal lactobacilli. In healthy women, the vaginal microbiota is dominated by Lactobacillus species, with L. crispatus, L. gasseri, and L. jensenii being the most commonly cultivated (8). These organisms are thought to play a role in resistance of the vaginal tract to colonization by pathogens, possibly through the production of lactic acid. L. iners is unusual among lactobacilli in that it may be detected during bacterial vaginosis (BV), a state in which G. vaginalis generally predominates and other Lactobacillus species are only rarely found at the vaginal mucosal surface (7, 11, 40, 41). More recently, culture-independent studies of the vaginal microbiota have demonstrated that L. iners vaginal colonization may be considerably more prevalent than previously recognized, and in some cases it may be the most abundant organism detected (29, 36).

Other sequenced Lactobacillus strains lack identifiable CDC genes. Given the unusual biology of L. iners and its similarities to G. vaginalis, we performed a bioinformatic search for genes that might encode a CDC in the L. iners genome. Here we report the identification, cloning, and characterization of inerolysin (INY), the L. iners CDC. The description of INY expands the CDC family to include a nonspecific toxin with the greatest sequence similarity to VLY and ILY, the two species-specific members of the CDC family. Further study of this newly identified CDC will increase our understanding of the evolution of the CDC family and the role of L. iners in vaginal physiology.

MATERIALS AND METHODS

Reagents.

Reagents were obtained from Sigma-Aldrich or Fisher Scientific unless otherwise noted. Oligonucleotides were from Invitrogen.

Bacterial strains and cell lines.

L. iners strains were grown on human blood bilayer-Tween agar. L. iners type strain DSM 13335, the genome of which has been sequenced, was obtained from the Deutsche Sammlung von Mikroorganismen und Zellkulturen. L. iners clinical isolates CCUG38955A, CCUG44023, CCUG44137, CCUG44284, CCUG46933, CCUG28746, CCUG32387, CCUG24626, and CCUG35443B were obtained from the Culture Collection of the University of Göteborg. L. iners strain ATCC 55195 was obtained from the American Type Culture Collection. Eukaryotic cell lines HeLa (ATCC CCL-2) and COS-7 (CRL-1651) were maintained in minimum essential medium (MEM) supplemented with 10% fetal bovine serum (Invitrogen), 1 mM sodium pyruvate, and 10 μg/ml ciprofloxacin.

Cloning and expression of CDCs.

The open reading frame (ORF) containing INY lacking its predicted signal sequence was amplified by PCR from L. iners DSM 13335 genomic DNA using primers NheI-INY-F (GCCGCCGCTAGCAATACTGAGCCAAAAACAGCTATTG) and XhoI-INY-R (GCCGCCCTCGAGTTAGTCATTTTTTACTTCTTCTTTG; restriction sites are underlined). The listeriolysin O (LLO) ORF lacking its predicted signal sequence was amplified by PCR from L. monocytogenes BAA751 genomic DNA using primers BamHI-LLO-F (GCCGCCGGATCCAAGGATGCATCTGCATTCAATAAAG) and LLO-R-XhoI (GCCGCCCTCGAGTTATTCGATTGGATTATCTAC). The pneumolysin (PLY) ORF was amplified from Streptococcus pneumoniae strain D39 genomic DNA using primers NdeI-PLY-F (GCCGCCCATATGGCAAATAAAGCAGTAAATGAC) and PLY-R-XhoI (GCCGCCCTCGAGCTAGTCATTTTCTACCTTATCTTC). The ILY ORF lacking its predicted signal sequence was amplified from S. intermedius ATCC 27335 genomic DNA using primers BamHI-ILY-F (GCCGCCGGATCCGCATTCGCTGAAACACCTACC) and ILY-R-XhoI (GCCGCCCTCGAGTTAATCAGTGTTATCTTTCAC). Amplifications were performed using Phusion proofreading polymerase (New England BioLabs). A vector encoding a codon-optimized VLY sequence (predicted amino acid sequence identical to that of the VLY from G. vaginalis ATCC 14018 lacking the signal sequence, codon optimized for expression in E. coli) flanked by NdeI and XhoI restriction sites was purchased from GenScript. The products were cloned via the indicated restriction sites into the pET28a vector (Novagen) in order to generate N-terminally hexahistidine-tagged constructs, verified by sequencing, and transformed into T7 Express Iq competent E. coli (New England BioLabs).

Expression strains were grown in LB with 50 μg/ml kanamycin for 5 h, and protein expression was induced with 1 mM isopropyl-β-d-thiogalactopyranoside (IPTG) for 4.5 h. Bacterial cells were pelleted by centrifugation and lysed in a buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole) containing a protease inhibitor cocktail and Benzonase nuclease. Lysates were cleared by centrifugation, and supernatants containing His-tagged proteins were purified with Ni-nitrilotriacetic acid agarose beads (Qiagen) according to the manufacturer's instructions. Purified proteins were dialyzed against lipopolysaccharide-free phosphate-buffered saline (PBS) with 1 mM CaCl2 and 1 mM MgCl2 overnight at 4°C, and protein concentrations were determined by a modified Bradford assay (Bio-Rad).

Detection of the INY gene in isolates of L. iners.

The presence of the gene for INY in several clinical isolates of L. iners was detected by PCR from genomic DNA using primers INY-test-F (CAGCAACACCTGGGTTAGAACTATC) and INY-test-R (CAGGTGCTCTTTTCAAGGCAGAC), targeting an internal region of the INY ORF. Amplification was carried out using Taq DNA polymerase (NEB).

Bioinformatic analysis.

Protein sequence prediction and alignment were carried out using MacVector software (version 11; MacVector Inc.). Other sequences were obtained from the GenBank/Entrez Protein database (National Center for Biotechnology Information [NCBI]). N-terminal signal sequences were predicted with SignalP (version 3.0, available at http://www.cbs.dtu.dk/services/SignalP/) (2). Alignments for phylogenetic analysis were done in BioEdit v7.04 (Ibis Therapeutics) using ClustalW for amino acids and then toggled back to nucleotides for further analysis.

Phylogenetic analyses.

Phylogenetic analyses were performed using three methods: neighbor joining (NJ), maximum parsimony (MP), and maximum likelihood (ML). The optimal trees obtained by all of these techniques were almost identical. NJ analysis was done with PAUP (37) by using the minimum evolution criterion, allowing branch length to be negative except when calculating tree scores (for which they were set to zero) and breaking ties randomly. MP analyses were also done in PAUP using 1,000 random addition (RA) steps, followed by tree branch reconnection (TBR) swapping using the Multrees option in PAUP. Gaps were treated as a state, and all characters and state transformations were weighted equally. Bootstrap values were calculated using 100 bootstrap iterations using 100 replicates of RA, followed by TBR, in each iteration. ML analyses were performed with RAxML Blackbox (http://phylobench.vital-it.ch/raxml-bb/index.php) using a GTR+Gamma+I model. Node support was assessed with 100 rapid bootstrap replicates using RAxML.

INY Western blotting.

The indicated L. iners strains were grown in Columbia broth with 5% defibrinated sheep blood and 10% fetal bovine serum for 2 days at 37°C in 5%CO2. Bacterial cells were pelleted by centrifugation and lysed with BugBuster Protein Extraction Reagent (Novagen) containing Benzonase nuclease. Supernatants were concentrated from 5 ml to 500 μl using an Amicon 10-kDa centrifugal filtration device (Millipore). Supernatants were run on a 4 to 12% gradient polyacrylamide gel (Invitrogen). Proteins were transferred to polyvinylidene difluoride (PVDF) membrane, blocked with 5% milk, and probed with one of two murine anti-PLY monoclonal antibodies as indicated below (Santa Cruz Biotechnology, 1:1,000 dilution, or Novacastra, 1:250,000 dilution). The primary antibody was detected with horseradish peroxidase-conjugated anti-mouse IgG by enhanced chemiluminescence.

Live-cell imaging of phalloidin entry into epithelial cells.

HeLa cells were grown to confluence on uncoated glass bottom culture dishes (MatTek) and washed in PBS with 1 mM CaCl2 and 1 mM MgCl2. Phalloidin-Alexa Fluor 568 (Invitrogen) was added to a final concentration of 3.3 nM, and the cells were treated with INY (final concentration, 1.8 μg/ml) or a vehicle control. Images were acquired on a Zeiss AxioObserver inverted microscope with appropriate filters every 30 s.

Fluorescence spectroscopy.

Unfolding of LLO and INY was measured over time by monitoring the change in 1-anilinonaphthalene-8-sulfonic acid (ANS; Molecular Probes) fluorescence. Purified LLO or INY was diluted to a final concentration of 1 μM in 2 ml of buffer C (35 mM sodium phosphate, 125 mM sodium chloride) in a quartz cuvette. Fluorescence was monitored continuously for 30 min in a spectrophotometer with excitation and emission wavelengths set to 371 nm and 483 nm, respectively.

Erythrocyte lysis assays.

The use of human erythrocytes from healthy adult volunteers after verbal informed consent was obtained was approved by the Columbia University Institutional Review Board (protocol IRB-AAAC5641). Defibrinated sheep and horse blood was obtained from Fisher Scientific. Erythrocytes were washed in sterile PBS with 1 mM CaCl2 and 1 mM MgCl2. For endpoint assays, 100 μl of a 1% washed erythrocyte solution was mixed with 100 μl of toxin in a 96-well V bottom plate and incubated for 30 min at 37°C and 5% CO2. After 30 min, the plates were spun at 2,000 rpm to pellet erythrocytes. Supernatant was removed, and the optical density at 415 nm (OD415) was measured. In the indicated experiments, the toxin was incubated with cholesterol dissolved in chloroform or with chloroform alone (vehicle control) for 10 min at room temperature before use. In some experiments, the assay was carried out in the presence of dithiothreitol (DTT) or a vehicle control. In the indicated experiments, toxin was incubated with polyclonal anti-VLY rabbit serum or preimmune control rabbit serum (25) on a rotary shaker for 20 min at 4°C. For the kinetic assay, absorbance at 700 nm was measured every minute with an Infinite 200 microplate reader (Tecan). In those experiments in which the pH was adjusted, hemolysis assays were carried out in the presence of buffer C (35 mM sodium phosphate, 125 mM sodium chloride) as previously described (31). In the indicated experiment, INY and LLO were preincubated at either 23°C or 37°C for 20 min before use in an endpoint hemolysis assay.

LDH assay.

HeLa cells were grown to confluence in a 24-well plate and weaned from serum and antibiotics overnight. Cells were incubated with toxin diluted in MEM for the indicated time periods. A 150-μl volume of supernatant was used to assay lactate dehydrogenase (LDH) release with the Cytotoxicity Detection Kit (Roche). The 100% lysis control was an identical well of HeLa cells concurrently treated with 1% Triton X-100 in MEM.

Epithelial p38 MAPK phosphorylation.

HeLa cells were grown to confluence in a 24-well plate and weaned from serum and antibiotics overnight. Cells were incubated with CDCs diluted in MEM for the indicated time periods. Cells were lysed in radioimmunoprecipitation assay buffer (20 mm Tris [pH 7.4], 137 mM NaCl, 10% glycerol, 2 mm EDTA [pH 8.0], 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate [SDS]) with protease inhibitors and phosphatase inhibitor cocktail (Sigma), separated on a 4 to 12% polyacrylamide gel, and transferred to a PVDF membrane. Membranes were blocked in 5% milk in Tris-buffered saline-Tween 20, probed with phospho-p38 mitogen-activated protein kinase (MAPK) antibody (Cell Signaling; 1:1,000), and detected with anti-rabbit IgG (1:5,000) by enhanced chemiluminescence. Blots were stripped in 4 N NaOH for 30 min, reblocked in 5% milk, and reprobed using anti-p38 MAPK antibody (Cell Signaling; 1:1,000).

Statistical analyses.

Hemolysis assay results are expressed as average values from six readings from one representative experiment. Each experiment was repeated three times. Data were analyzed by one-way analysis of variance, followed by Tukey's posttest. For the antibody protection assay and pH-dependent activity assay, the data shown are from one representative experiment. Data were analyzed by Student t test. A P value of <0.05 was considered significant. All statistical analyses were carried out using Prism 4 software (GraphPad).

Nucleotide sequence accession numbers.

The accession number for INY from L. iners DSM 13335 is ZP_05744302 (annotated as perfringolysin O). Protein sequence data for PLY from S. pneumoniae TIGR4, R6, and Taiwan19F-14 are available from the NCBI under accession numbers AAK75991, AAL00542.1, and ACO23064.1, respectively. Other NCBI accession numbers are as follows: VLY from G. vaginalis ATCC 14019 and ATCC 14018, ACD39460 and ACD39459, respectively; ILY from S. intermedius UNS38 and UNS46, BAE16324 and BAA89790, respectively; LLO from L. monocytogenes NICBP 54006, ACF40759; ivanolysin (IVN) from Listeria ivanovii 16328, P31831; anthrolysin O (ALO) from Bacillus anthracis A0248, YP_002867524; cereolysin (CER) from Bacillus cereus B16, AAX88798; mitilysin (MLY) from Streptococcus mitis R5II, ABK58696; suilysin (SLY) from Streptococcus suis 3, CAC94852; perfringolysin O (PFO) from Clostridium perfringens 13, NP_561079; alveolysin (ALV) from Paenibacillus alvei, AAA22224; pyolysin (PYO) from Arcanobacterium pyogenes BBR1, AAC45754. Corresponding nucleotide sequences were obtained from records linked to these amino acid sequences.

RESULTS

The genome of L. iners contains a putative CDC.

A basic local alignment search tool search of the draft L. iners DSM 13335 genome sequence revealed an ORF with 51.9% identity and 68.4% similarity to VLY, the G. vaginalis CDC. This ORF was not found in available genome sequences from other Lactobacillus species (data not shown). The ORF contained a predicted signal sequence with a predicted cleavage site between amino acids 31 and 32. Primers were created to amplify a region in the ORF from DSM 13335 and were subsequently used to detect the presence of this putative CDC in the genomes of several other clinical isolates of L. iners (Fig. (Fig.1A).1A). A band of approximately 700 bp was detected after PCR of each of the 11 L. iners strains tested, indicating that the presence of this putative toxin is common to this species and not solely a feature of DSM 13335. The predicted amino acid sequence of INY exhibits sequence similarity and identity with diverse CDC family members (Table (Table1),1), with the greatest similarity to ILY and VLY, the human-specific CDCs. The nucleotide sequences of INY were used to generate phylogenetic trees by the NJ, MP, and ML methods, all of which displayed essentially the same topology (Fig. (Fig.1B).1B). These trees demonstrated that the putative CDC produced by L. iners falls into the Streptococcus CDC group including PLY and ILY and is more distantly related to CDCs from Listeria, Clostridium, and Bacillus. All 11 of the INY sequences were on a single branch with bootstrap support of 100%.

FIG. 1.
The genome of L. iners contains an ORF encoding a putative CDC. (A) Detection of the gene for INY in genomic DNA from several strains of L. iners. Numbers are strain identifiers, and MW represents the molecular weight marker. E. coli DNA was included ...
TABLE 1.
Similarities and identities of the primary amino acid sequences of INY and other CDCs

The predicted INY ORF from L. iners DSM 13335 was cloned into the pET28a expression vector in order to generate an N-terminal hexahistidine fusion, and recombinant INY (rINY) protein was purified. SDS-polyacrylamide gel electrophoresis analysis revealed a protein with a size of approximately 55 kDa (Fig. (Fig.2A).2A). By Western blotting, INY was detected using a monoclonal antibody directed against PLY (Fig. (Fig.2B),2B), as well as a polyclonal antibody against VLY (data not shown). In order to determine whether INY was produced and secreted, we assayed the culture supernatants of several L. iners strains for the presence of this putative CDC. A band consistent with the size of processed (lacking the signal sequence) INY was detected in the supernatants of all of the L. iners strains but not in the culture supernatant of E. coli (Fig. (Fig.2C).2C). Additionally, a higher-molecular-weight band was detected in L. iners supernatants which may represent either unprocessed INY released upon bacterial lysis or INY that has undergone an unclear type of posttranslational modification. There was variation among the L. iners strains with respect to the amount of INY produced (Fig. (Fig.2C2C).

FIG. 2.
Production of rINY and detection of INY in supernatants of L. iners. (A) Purification of an approximately 55-kDa protein (rINY) from E. coli. Lane MW contained protein molecular mass standards. (B) INY and PLY (10 μg/lane) were detected by an ...

INY is a functional broad-host-range cytolysin and is inhibited by anti-VLY antibody.

rINY lysed murine, ovine, and human erythrocytes in a dose-dependent manner (Fig. (Fig.3A).3A). This lack of species specificity was in contrast to the previously described human specificity of ILY (Fig. (Fig.3B)3B) and was consistent with the behavior of PLY from Streptococcus pneumoniae (Fig. (Fig.3C).3C). Polyclonal anti-VLY antibody protected ovine erythrocytes from INY-mediated lysis in a dose-dependent manner (Fig. (Fig.3D3D).

FIG. 3.
Non-species-restricted hemolytic activity of INY. Lysis of murine, human, and ovine erythrocytes by (A) INY, (B) ILY, and (C) PLY. (D) Polyclonal anti-VLY antibody inhibits the activity of INY (1.5 μg/ml) on ovine erythrocytes. *, P < ...

Cholesterol inhibits INY activity.

CDCs bind cholesterol through a mechanism dependent on a Thr-Leu pair located in CDC domain 4 (10). This Thr-Leu pair is conserved in INY (Thr-507 and Leu-508 in INY from strain DSM 13335). The presence of excess cholesterol inactivates CDCs (3, 12, 13, 19, 20, 32). Exogenous cholesterol inhibited INY-mediated lysis of ovine erythrocytes in both endpoint and kinetic assays (Fig. (Fig.44).

FIG. 4.
Cholesterol-dependent hemolytic activity of INY. (A) INY (1.25 μg/ml) was incubated with ovine erythrocytes in the presence of the indicated concentrations of cholesterol or a vehicle control. P values for this and subsequent figures: *, ...

INY activity is enhanced by DTT.

CDCs were formerly known as “thiol-activated cytolysins,” which denoted the increase in lytic activity seen in many CDCs in the presence of reducing agents (3, 4, 13, 19, 32). Thiol activation is dependent on the sequence of the undecapeptide, a highly conserved 11-amino-acid sequence in domain 4. The consensus undecapeptide, ECTGLAWEWWR, has a cysteine residue in the second position. This cysteine residue must be maintained in a reduced state for full toxin activity. Both ILY and VLY have unusual undecapeptides that lack this cysteine. However, the predicted primary amino acid sequence of INY contains the consensus undecapeptide. Thus, we predicted that INY would be thiol activated. Addition of DTT to a concentration of INY (200 ng/ml) that brought about low-level (<30%) lysis alone led to a modest increase in the efficiency of lysis (Fig. (Fig.55).

FIG. 5.
INY is a thiol-activated cytolysin. (A) INY (200 ng/ml) was incubated in the presence of various concentrations of DTT or a vehicle control for 5 min at room temperature. This toxin was then used in endpoint (A) and kinetic (B) hemolysis assays.

Effect of pH on hemolytic activity.

The CDCs have various pH-dependent activity profiles. ILY has activity across a wide pH range (19), while LLO (produced by L. monocytogenes) has an acidic pH optimum, consistent with its function within a vacuole during the Listeria life cycle (31). The hemolytic activity of INY was measured as a function of pH and compared to the hemolytic activities of several other CDCs (Fig. (Fig.6A).6A). ILY and VLY were active at neutral pH and demonstrated a significant decrease in activity at pH 4.5. This reduction in ILY activity at acidic pH was consistent with a previous report (19). In contrast, INY demonstrated greater activity at a more acidic pH (4.5 to 6.0), with decreased function at pH 7.4 (Fig. (Fig.6A6A).

FIG. 6.
pH-dependent activity of INY. (A) INY, ILY, and VLY (125 ng/ml) were incubated with human erythrocytes in an endpoint hemolysis assay under various pH conditions at 37°C. (B) INY and LLO (125 ng/ml) were preincubated at the indicated temperature ...

The molecular basis of pH dependence has been extensively investigated for LLO (31). To gain further insights into the pH-dependent activity of INY, we compared the activity of INY to that of LLO as a function of both pH and temperature. It has been previously shown that LLO responds to a pH increase by rapid unfolding and loss of activity. Maximal unfolding of LLO requires increases in both temperature and pH. With an increased pH, INY rapidly lost activity at both 23°C and 37°C (Fig. (Fig.6B).6B). This is in contrast to LLO, which showed a slight decrease with an increase in either pH or temperature and a more pronounced decrease in activity upon incubation at increased pH and increased temperature. Toxin unfolding in response to pH, as has been demonstrated for LLO, was measured using the fluorescent probe ANS, which binds hydrophobic sites on proteins. Addition of LLO to a solution of ANS led to an increase in fluorescence (Fig. (Fig.6C)6C) that was considerably more pronounced at pH 7.4. In contrast, INY demonstrated only a slight increase in fluorescence over time at pH 7.4, as well as pH 5.5 (Fig. (Fig.6D6D).

INY forms functional pores in epithelial cells and activates proinflammatory signaling.

L. iners colonizes the vaginal epithelium, and epithelial cells may represent a more physiologically relevant target for INY than erythrocytes. INY lysed human cervical epithelial (HeLa) cells in a dose-dependent manner, albeit at higher concentrations than those required for hemolysis (Fig. (Fig.7A).7A). This effect was not restricted to HeLa cells, as both COS-7 (Fig. (Fig.7B)7B) and A549 (data not shown) cells were susceptible to INY-mediated lysis. Epithelial cells detect sublytic concentrations of pore-forming toxins and initiate p38 MAPK signaling through a mechanism dependent on sensation of osmotic stress (27). Consistent with the activity of other pore-forming toxins, INY activated p38 MAPK at sublytic concentrations (3 μg/ml) in both HeLa (Fig. (Fig.7C)7C) and COS-7 (Fig. (Fig.7D)7D) cells. Phalloidin, which is normally restricted from the interior of the cell, gains access to the cytoplasm of HeLa cells following treatment with INY (Fig. (Fig.7E),7E), consistent with the formation of functional pores.

FIG. 7.
INY induces epithelial cell lysis at high concentrations and activates proinflammatory signaling at low concentrations. HeLa (A) or COS-7 (B) cells were incubated with increasing concentrations of INY, and epithelial cell lysis was measured by LDH release. ...

DISCUSSION

The vaginal mucosa is home to a complex ecosystem, with a microbiota that may remain stable over time or may undergo profound and rapid shifts, leading to disease states such as BV. Culture-based studies formed the foundation of our understanding of the vaginal microbiota, but more recent nucleic acid-based culture-independent investigations have deepened our understanding of vaginal ecology (29, 36, 42). Most vaginal lactobacilli exert a protective effect and provide resistance to colonization by pathogens via the production of several antimicrobial substances. L. iners is an atypical organism recently identified as a member of the vaginal microbiota and may have pathogenic rather than (or perhaps in addition to) protective effects. We have characterized INY, a CDC family member and the first candidate virulence factor for L. iners.

At the primary amino acid sequence level, INY is most similar to the human-specific CD59-dependent toxins VLY and ILY; however, its lytic activity is neither species nor cell type specific. A putative CD59 binding site has been reported for ILY (16), but this sequence is not present in VLY. Thus, an overall basis for CDC host specificity has not been defined. INY represents the nearest neighbor of the CD59-dependent CDCs and may serve as a useful tool for further evolutionary and functional comparisons.

A hallmark of the unique biology of L. iners is its ability to continue to colonize the vagina under conditions under which other lactobacilli cannot, including during BV (35, 43). INY is a thiol-activated, cholesterol-inhibitable toxin that is secreted by growing L. iners. Sublytic concentrations of INY activate p38 phosphorylation in human genital tract epithelial cells. This is a conserved and tightly regulated response to membrane disruption and osmotic stress (1, 27). INY pores are sufficient to allow entry of molecules from the extracellular space into the cytoplasm, as demonstrated with fluorescent phalloidin (Fig. (Fig.6).6). This effect may be of particular importance in immune responses to polymicrobial colonization (26, 28). Cytolysin production may provide defensive functions by killing professional immune cells, may make available new anatomic niches by disrupting epithelial barriers, or may allow bacteria to access sequestered sources of nutrients such as iron from within erythrocytes. We hypothesize that CDC secretion, a feature common to G. vaginalis and L. iners, may be an important factor in survival in the inhospitable environment of BV, though at the highest extremes of vaginal pH (>6.0), INY may be inactive. Human α-defensins, which inactivate CDCs (17), are decreased during BV (39), and this deficiency may allow INY-mediated cellular damage to occur.

INY has pH-dependent activity, with optimal target cell lysis observed at acidic pH. This behavior is similar to that of LLO, the CDC produced by L. monocytogenes, which has a pH optimum of 5.5 (13). The pH dependence of LLO is an atypical form of CDC regulation. Unlike LLO, INY is extremely sensitive to the effects of pH, with minimal activity at neutral pH. Furthermore, analysis of the predicted protein sequence of INY indicates that it lacks the triad of acidic residues, Glu-247, Asp-320, and Glu-208, implicated in pH-dependent LLO unfolding. Using a fluorescent probe, we showed that while LLO unfolded rapidly at pH 7.4 and 37°C, INY did not show significant unfolding under any of the conditions tested (Fig. (Fig.6).6). The finding that INY is more active at acidic pH is consistent with its activity at the vaginal mucosal surface, where the pH is generally maintained between 4 and 5, and suggests that this toxin may mediate epithelial cell damage in this niche. Of note, VLY, the CDC produced by G. vaginalis, had greatly reduced activity at pH 4.5, indicating that it may be of greater importance during episodes of BV, once the vaginal pH has already increased. We speculate that these toxins could be present concurrently under some conditions and that they might act together in the setting of intermediate pH.

Antibodies against other CDCs, including PLY and VLY, may bind and inhibit INY, as may host antimicrobial peptides. Cauci et al. showed that local antitoxin IgA responses were correlated with mucosal cytokine levels and with BV diagnosis (5, 6). Cross-reactivity between anti-VLY and anti-INY immunoglobulins may have implications for the efficiency of the host response to BV and for resolution of disease. The reversible deficiency of antimicrobial peptides observed in BV (39) may be important because of their antitoxin, as well as their antimicrobial, effects. Continued investigations of INY may help shed light on CDC evolution and on the role of L. iners in vaginal health and disease.

ADDENDUM IN PROOF

After the submission of our manuscript but prior to publication, a paper describing whole-genome sequencing of L. iners strain AB-1 was published (J. M. Macklaim, G. B. Gloor, K. C. Anukam, S. Cribby, and G. Reid, Proc. Natl. Acad. Sci. U. S. A. doi:10.1073/pnas.l000086l07, 8 November 2010, posting date). In this work, the L. iners cholesterol-dependent cytolysin was identified and described.

Footnotes

[down-pointing small open triangle]Published ahead of print on 17 December 2010.

REFERENCES

1. Aguilar, J. L., et al. 2009. Phosphatase-dependent regulation of epithelial mitogen-activated protein kinase responses to toxin-induced membrane pores. PLoS One 4:e8076. [PMC free article] [PubMed]
2. Bendtsen, J. D., H. Nielsen, G. von Heijne, and S. Brunak. 2004. Improved prediction of signal peptides: SignalP 3.0. J. Mol. Biol. 340:783-795. [PubMed]
3. Billington, S. J., B. H. Jost, W. A. Cuevas, K. R. Bright, and J. G. Songer. 1997. The Arcanobacterium (Actinomyces) pyogenes hemolysin, pyolysin, is a novel member of the thiol-activated cytolysin family. J. Bacteriol. 179:6100-6106. [PMC free article] [PubMed]
4. Billington, S. J., J. G. Songer, and B. H. Jost. 2001. Molecular characterization of the pore-forming toxin, pyolysin, a major virulence determinant of Arcanobacterium pyogenes. Vet. Microbiol. 82:261-274. [PubMed]
5. Cauci, S. 2004. Vaginal immunity in bacterial vaginosis. Curr. Infect. Dis. Rep. 6:450-456. [PubMed]
6. Cauci, S., S. Driussi, S. Guaschino, M. Isola, and F. Quadrifoglio. 2002. Correlation of local interleukin-1beta levels with specific IgA response against Gardnerella vaginalis cytolysin in women with bacterial vaginosis. Am. J. Reprod. Immunol. 47:257-264. [PubMed]
7. De Backer, E., et al. 2007. Quantitative determination by real-time PCR of four vaginal Lactobacillus species, Gardnerella vaginalis and Atopobium vaginae indicates an inverse relationship between L. gasseri and L. iners. BMC Microbiol. 7:115. [PMC free article] [PubMed]
8. Donati, L., et al. 2010. Vaginal microbial flora and outcome of pregnancy. Arch. Gynecol. Obstet. 281:589-600. [PubMed]
9. Falsen, E., C. Pascual, B. Sjoden, M. Ohlen, and M. D. Collins. 1999. Phenotypic and phylogenetic characterization of a novel Lactobacillus species from human sources: description of Lactobacillus iners sp. nov. Int. J. Syst. Bacteriol. 49(Pt. 1):217-221. [PubMed]
10. Farrand, A. J., S. LaChapelle, E. M. Hotze, A. E. Johnson, and R. K. Tweten. 2010. Only two amino acids are essential for cytolytic toxin recognition of cholesterol at the membrane surface. Proc. Natl. Acad. Sci. U. S. A. 107:4341-4346. [PMC free article] [PubMed]
11. Ferris, M. J., J. Norori, M. Zozaya-Hinchliffe, and D. H. Martin. 2007. Cultivation-independent analysis of changes in bacterial vaginosis flora following metronidazole treatment. J. Clin. Microbiol. 45:1016-1018. [PMC free article] [PubMed]
12. Gelber, S. E., J. L. Aguilar, K. L. Lewis, and A. J. Ratner. 2008. Functional and phylogenetic characterization of vaginolysin, the human-specific cytolysin from Gardnerella vaginalis. J. Bacteriol. 190:3896-3903. [PMC free article] [PubMed]
13. Geoffroy, C., J. L. Gaillard, J. E. Alouf, and P. Berche. 1987. Purification, characterization, and toxicity of the sulfhydryl-activated hemolysin listeriolysin O from Listeria monocytogenes. Infect. Immun. 55:1641-1646. [PMC free article] [PubMed]
14. Giddings, K. S., J. Zhao, P. J. Sims, and R. K. Tweten. 2004. Human CD59 is a receptor for the cholesterol-dependent cytolysin intermedilysin. Nat. Struct. Mol. Biol. 11:1173-1178. [PubMed]
15. Glomski, I. J., M. M. Gedde, A. W. Tsang, J. A. Swanson, and D. A. Portnoy. 2002. The Listeria monocytogenes hemolysin has an acidic pH optimum to compartmentalize activity and prevent damage to infected host cells. J. Cell Biol. 156:1029-1038. [PMC free article] [PubMed]
16. Hughes, T. R., et al. 2009. Identification of the high affinity binding site in the Streptococcus intermedius toxin intermedilysin for its membrane receptor, the human complement regulator CD59. Mol. Immunol. 46:1561-1567. [PMC free article] [PubMed]
17. Lehrer, R. I., et al. 2009. Human alpha-defensins inhibit hemolysis mediated by cholesterol-dependent cytolysins. Infect. Immun. 77:4028-4040. [PMC free article] [PubMed]
18. Madden, J. C., N. Ruiz, and M. Caparon. 2001. Cytolysin-mediated translocation (CMT): a functional equivalent of type III secretion in gram-positive bacteria. Cell 104:143-152. [PubMed]
19. Nagamune, H., et al. 1996. Intermedilysin, a novel cytotoxin specific for human cells secreted by Streptococcus intermedius UNS46 isolated from a human liver abscess. Infect. Immun. 64:3093-3100. [PMC free article] [PubMed]
20. Palmer, M. 2001. The family of thiol-activated, cholesterol-binding cytolysins. Toxicon 39:1681-1689. [PubMed]
21. Polekhina, G., K. S. Giddings, R. K. Tweten, and M. W. Parker. 2005. Insights into the action of the superfamily of cholesterol-dependent cytolysins from studies of intermedilysin. Proc. Natl. Acad. Sci. U. S. A. 102:600-605. [PMC free article] [PubMed]
22. Ramachandran, R., A. P. Heuck, R. K. Tweten, and A. E. Johnson. 2002. Structural insights into the membrane-anchoring mechanism of a cholesterol-dependent cytolysin. Nat. Struct. Biol. 9:823-827. [PubMed]
23. Ramachandran, R., R. K. Tweten, and A. E. Johnson. 2004. Membrane-dependent conformational changes initiate cholesterol-dependent cytolysin oligomerization and intersubunit beta-strand alignment. Nat. Struct. Mol. Biol. 11:697-705. [PubMed]
24. Ramachandran, R., R. K. Tweten, and A. E. Johnson. 2005. The domains of a cholesterol-dependent cytolysin undergo a major FRET-detected rearrangement during pore formation. Proc. Natl. Acad. Sci. U. S. A. 102:7139-7144. [PMC free article] [PubMed]
25. Randis, T. M., R. Kulkarni, J. L. Aguilar, and A. J. Ratner. 2009. Antibody-based detection and inhibition of vaginolysin, the Gardnerella vaginalis cytolysin. PLoS One 4:e5207. [PMC free article] [PubMed]
26. Ratner, A. J., J. L. Aguilar, M. Shchepetov, E. S. Lysenko, and J. N. Weiser. 2007. Nod1 mediates cytoplasmic sensing of combinations of extracellular bacteria. Cell. Microbiol. 9:1343-1351. [PMC free article] [PubMed]
27. Ratner, A. J., et al. 2006. Epithelial cells are sensitive detectors of bacterial pore-forming toxins. J. Biol. Chem. 281:12994-12998. [PMC free article] [PubMed]
28. Ratner, A. J., E. S. Lysenko, M. N. Paul, and J. N. Weiser. 2005. Synergistic proinflammatory responses induced by polymicrobial colonization of epithelial surfaces. Proc. Natl. Acad. Sci. U. S. A. 102:3429-3434. [PMC free article] [PubMed]
29. Ravel, J., et al. 3 June 2010, posting date. Microbes and Health Sackler Colloquium: vaginal microbiome of reproductive-age women. Proc. Natl. Acad. Sci. U. S. A. doi:.10.1073/pnas.1002611107 [PMC free article] [PubMed] [Cross Ref]
30. Rosado, C. J., et al. 2008. The MACPF/CDC family of pore-forming toxins. Cell. Microbiol. 10:1765-1774. [PMC free article] [PubMed]
31. Schuerch, D. W., E. M. Wilson-Kubalek, and R. K. Tweten. 2005. Molecular basis of listeriolysin O pH dependence. Proc. Natl. Acad. Sci. U. S. A. 102:12537-12542. [PMC free article] [PubMed]
32. Shannon, J. G., C. L. Ross, T. M. Koehler, and R. F. Rest. 2003. Characterization of anthrolysin O, the Bacillus anthracis cholesterol-dependent cytolysin. Infect. Immun. 71:3183-3189. [PMC free article] [PubMed]
33. Shi, Y., L. Chen, J. Tong, and C. Xu. 2009. Preliminary characterization of vaginal microbiota in healthy Chinese women using cultivation-independent methods. J. Obstet. Gynaecol. Res. 35:525-532. [PubMed]
34. Soltani, C. E., E. M. Hotze, A. E. Johnson, and R. K. Tweten. 2007. Structural elements of the cholesterol-dependent cytolysins that are responsible for their cholesterol-sensitive membrane interactions. Proc. Natl. Acad. Sci. U. S. A. 104:20226-20231. [PMC free article] [PubMed]
35. Srinivasan, S., and D. N. Fredricks. 2008. The human vaginal bacterial biota and bacterial vaginosis. Interdiscip. Perspect. Infect. Dis. 2008:750479. [PMC free article] [PubMed]
36. Srinivasan, S., et al. 2010. Temporal variability of human vaginal bacteria and relationship with bacterial vaginosis. PLoS One 5:e10197. [PMC free article] [PubMed]
37. Swofford, D. L. 1998. PAUP: phylogenetic analysis using parsimony (*and other methods) 4.0 beta. Sinauer Associates, Sunderland, MA.
38. Tweten, R. K. 2005. Cholesterol-dependent cytolysins, a family of versatile pore-forming toxins. Infect. Immun. 73:6199-6209. [PMC free article] [PubMed]
39. Valore, E. V., D. J. Wiley, and T. Ganz. 2006. Reversible deficiency of antimicrobial polypeptides in bacterial vaginosis. Infect. Immun. 74:5693-5702. [PMC free article] [PubMed]
40. Verstraelen, H., et al. 2009. Longitudinal analysis of the vaginal microflora in pregnancy suggests that L. crispatus promotes the stability of the normal vaginal microflora and that L. gasseri and/or L. iners are more conducive to the occurrence of abnormal vaginal microflora. BMC Microbiol. 9:116. [PMC free article] [PubMed]
41. Wilks, M., et al. 2004. Identification and H(2)O(2) production of vaginal lactobacilli from pregnant women at high risk of preterm birth and relation with outcome. J. Clin. Microbiol. 42:713-717. [PMC free article] [PubMed]
42. Zhou, X., et al. 2004. Characterization of vaginal microbial communities in adult healthy women using cultivation-independent methods. Microbiology 150:2565-2573. [PubMed]
43. Zozaya-Hinchliffe, M., R. Lillis, D. H. Martin, and M. J. Ferris. 2010. Quantitative PCR assessments of bacterial species in women with and without bacterial vaginosis. J. Clin. Microbiol. 48:1812-1819. [PMC free article] [PubMed]

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...