• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of hhmipaAbout Author manuscriptsSubmit a manuscriptHHMI Howard Hughes Medical Institute; Author Manuscript; Accepted for publication in peer reviewed journal
Neuron. Author manuscript; available in PMC Jul 27, 2011.
Published in final edited form as:
PMCID: PMC3063404
HHMIMSID: HHMIMS269575

RIM Proteins Activate Vesicle Priming by Reversing Auto-Inhibitory Homodimerization of Munc13

Abstract

At a synapse, the presynaptic active zone mediates synaptic vesicle exocytosis. RIM proteins are active-zone scaffolding molecules that – among others – mediate vesicle priming, and directly or indirectly interact with most other essential presynaptic proteins. In particular, the Zn2+-finger domain of RIMs binds to the C2A-domain of the priming factor Munc13, which forms a homodimer in the absence of RIM, but a heterodimer with it. Here we show that RIMs mediate vesicle priming not by coupling Munc13 to other active zone proteins as thought, but by directly activating Munc13. Specifically, we found that the isolated Zn2+-finger domain of RIMs autonomously promotes vesicle priming by binding to Munc13, thereby relieving Munc13 homodimerization. Strikingly, constitutively monomeric mutants of Munc13 rescued priming in RIM-deficient synapses, whereas wild-type Munc13 did not. Both mutant and wild-type Munc13, however, rescued priming in Munc13-deficient synapses. Thus, homodimerization of Munc13 inhibits its priming function, and RIMs activate priming by disrupting Munc13 homodimerization.

INTRODUCTION

Neurotransmission is initiated when synaptic vesicles undergo exocytosis at the active zone, thereby releasing their neurotransmitter contents (Katz, 1969). Synaptic vesicle exocytosis is highly regulated, consistent with its role as the gatekeeper of neurotransmission (Stevens, 2003). Each event of exocytosis is induced by an action potential that induces Ca2+-influx via Ca2+-channels located in or near the active zone. The efficacy of action potential-induced exocytosis depends on at least three parameters: the local activity of voltage-gated Ca2+-channels, the number of release-ready vesicles, and the Ca2+-sensitivity of these vesicles. Remarkably, none of the proteins that mediate these parameters (i.e., Ca2+-channels, the presynaptic fusion machinery composed of SNARE- and SM-proteins, and the Ca2+-sensor synaptotagmin) is exclusively localized to the active zone. Instead, their functions are organized at presynaptic release sites by the protein components of active zones (Südhof, 2004; Wojcik and Brose, 2007).

Among active zone protein components, RIM proteins are arguably the most central elements (Mittelstaedt et al., 2010). RIMs directly or indirectly interact with all other active zone proteins (Wang et al., 2000 and 2002; Betz et al., 2001; Schoch et al., 2002; Ohtsuka et al., 2002; Ko et al., 2003), Ca2+-channels (Hibino et al., 2002; Kiyonaka et al., 2007; Kaeser et al., 2011), and the synaptic vesicle proteins Rab3 and synaptotagmin-1 (Wang et al., 1997; Coppola et al., 2001; Schoch et al., 2002). Consistent with a central role for RIMs in active zones, RIM proteins are essential for presynaptic vesicle docking, priming, Ca2+-channel localization, and plasticity (Koushika et al., 2001; Schoch et al., 2002 and 2006; Castillo et al., 2002; Calakos et al., 2004; Weimer et al., 2006; Gracheva et al., 2008; Kaeser et al., 2008 and 2011; Fourcaudot et al., 2008; Han et al., 2011). However, apart from recent progress in understanding the role of RIMs in vesicle docking and in localizing Ca2+-channels to active zones (Gracheva et al., 2008; Schoch et al., 2006; Kaeser et al., 2008 and 2011; Han et al., 2011), it remains unclear how RIMs perform their functions. This gap in our understanding arose in part because multiple RIM isoforms are co-expressed in vertebrates, creating redundancy (Wang and Südhof, 2003), and because presynaptic rescue experiments require expression of rescue proteins in all neurons that are being analyzed, which is technically difficult for large proteins like RIMs.

One of the best documented phenotypes in RIM-deficient neurons is a strong reduction in vesicle priming (Koushika et al., 2001; Schoch et al., 2002; Calakos et al., 2004; Kaeser et al., 2008 and 2011; Han et al., 2011). ‘Priming’ activates synaptic vesicles for exocytosis, thereby creating the readily-releasable pool (RRP) of vesicles. However, the nature of priming in general, and of the role of RIMs in priming in particular, remains unknown; even the relation of priming to docking – the process that physically attaches vesicles to the active zone, as analyzed by electron microscopy – is unclear. In pioneering work, Rosenmund and Stevens (1996) showed that vesicles in the RRP can be induced to undergo exocytosis by application of hypertonic sucrose, which triggers vesicle fusion by a Ca2+-independent, nano-mechanical mechanism. Although the non-physiological nature of the sucrose stimulus limits its usefulness (e.g., see Wu and Borst, 1999; Moulder and Mennerick, 2005), measurements of vesicle pool sizes using this stimulus have been successfully applied as an operational definition of the RRP in many studies (e.g., see Basu et al., 2005; Betz et al., 2001; Rosenmund et al., 2002). Here, we also employ this approach, with the understanding that the operational definition of the RRP as the sucrose-stimulated vesicle pool includes both docking and priming, since the two processes cannot be separated.

The synaptic vesicle membrane-fusion machinery is composed of SNARE- and SM-proteins, and constitutes a central element of priming; in addition, multiple other priming proteins have been characterized. Among these, the most important besides RIMs are likely Munc13s, which are multidomain proteins of active zones that are essential for all synaptic vesicle priming, and additionally participate in shaping short-term synaptic plasticity (Brose et al., 1995; Augustin et al., 1999; Rosenmund et al., 2002). Munc13s most likely function by interacting with SNARE proteins (Betz et al., 1997; Basu et al., 2005; Madison et al., 2005; Stevens et al., 2005; Guan et al., 2008); interestingly, they also directly bind to RIMs (Betz et al., 2001; Schoch et al., 2002; Dulubova et al., 2005). Most RIM isoforms contain an N-terminal Zn2+-finger domain that binds to the N-terminal C2A-domain of the Munc13 isoforms Munc13-1 and ubMunc13-2. Importantly, the Munc13 C2A-domain (which does not bind Ca2+, different from synaptotagmin C2-domains but similar to RIM C2-domains) forms a tight homodimer in the absence of the RIM Zn2+-finger; binding of the RIM Zn2+-finger to the Munc13 C2A-domain converts this homodimer into a RIM/Munc13 heterodimer (Dulubova et al., 2005, Lu et al., 2006). Furthermore, the Zn2+-finger domain of RIMs is flanked by α-helical sequences that bind to Rab3 (Wang et al., 1997). Thus, the N-terminal sequence of RIMs can mediate simultaneous binding of RIMs to Munc13 as a priming factor, and to Rab3 as a vesicle GTP-binding protein (Dulubova et al., 2005).

Together, the structural and genetic data on the Munc13/RIM/Rab3 complex prompted the hypothesis that RIMs function in synaptic vesicle priming by recruiting Munc13 to the active zone and stabilizing it there, and that the crucial function of RIMs is to co-localize Munc13 with synaptic vesicles via their N-terminal sequences, and with other active zone proteins and Ca2+-channels via their C-terminal sequences (Wang et al., 1997, 2000, and 2002; Betz et al., 2001; Schoch et al., 2002; Ohtsuka et al., 2002; Ko et al., 2003; Andrews-Zwilling et al., 2008; Kaeser et al., 2008 and 2011). In the present paper, we have tested this hypothesis using rescue experiments with newly generated conditional double knockout (DKO) mice targeting all major presynaptic RIM isoforms (Kaeser et al., 2011). Unexpectedly, we find that RIMs do not act during vesicle priming as classical scaffolding proteins, i.e. that their mechanism of action does not require the close co-localization of target proteins. Instead, we show that the isolated RIM Zn2+-finger domain is sufficient for activating priming, and that it functions by binding to Munc13, thereby disrupting Munc13 homodimers. Specifically, we show that mutant, constitutively monomeric forms of Munc13 can reverse the priming deficiency in RIM-deficient synapses, whereas wild-type Munc13 cannot, but strikingly both monomeric and wild-type Munc13 rescue priming in Munc13-deficient synapses. Thus, RIMs switch on Munc13’s priming function by disrupting the auto-inhibitory homodimerization of Munc13.

RESULTS

RIM deletion reduces the priming capacity of active zones

We recently generated conditional DKO mice in which cre recombinase deletes expression of all multidomain presynaptic RIM isoforms (i.e., RIM1α, 1β, 2α, 2β, and 2γ; Kaeser et al., 2011). To explore how RIMs function in synaptic vesicle priming, we cultured hippocampal neurons from conditional RIM DKO mice, and infected them either with a lentivirus expressing inactive mutant (Control), or active wild-type EGFP-tagged cre-recombinase (referred to as ‘cDKO’ neurons). Measurements of spontaneous excitatory and inhibitory ‘mini’ synaptic events (mEPSCs and mIPSCs, respectively) showed that the frequency of mEPSCs and mIPSCs was decreased >10- and >3-fold, respectively, in RIM-deficient neurons, whereas their amplitudes were unchanged (Figs. 1A and 1B). This finding supports previous data that RIMs are essential for a normal presynaptic release probability in excitatory and inhibitory synapses (Schoch et al., 2002 and 2006; Calakos et al., 2005, Kaeser et al., 2008 and 2011, Han et al., 2011; see also Fig. S1). Thus, in the following we analyzed only inhibitory synaptic transmission that does not exhibit network activity, and is easier to evaluate in cultured neurons (Maximov et al., 2007).

Figure 1
Conditional deletion of RIM1α, 1β, 2α, 2β, and 2γ dramatically decreases the RRP size

Assessments of the RRP in RIM-deficient cDKO neurons using a 30 s application of hypertonic sucrose uncovered a >4-fold decrease in the RRP size (Fig. 1C). Hypertonic sucrose induces an initial release transient that corresponds to the RRP, and then transitions into a steady-state phase that corresponds to the continuous stimulation of the exocytosis of vesicles refilling the RRP (Rosenmund and Stevens, 1997). Comparison of release triggered during the initial transient (i.e., the first 10 s of sucrose application) or during the steady-state phase (i.e., the last 15 s of the application) revealed that the RIM deletion suppressed both phases equally (Fig. 1C). Plots of the cumulative charge transfer showed that the kinetics of sucrose-induced release were unchanged (Fig. 1D). These findings indicate that the RIM deletion decreased the total capacity of the RRP, but not its steady-state refilling rate.

Measurements of the levels of active zone proteins and of other essential presynaptic proteins in RIM-deficient neurons uncovered only a single major change: a decrease in Munc13-1 levels in the cDKO neurons lacking all presynaptic RIM isoforms (Fig. 1E), which was slightly larger than that observed previously in brains from mice lacking only RIM1α (Schoch et al., 2002). Thus, deletion of RIMs does not produce a global change in the composition of the release machinery, but a discrete change in one particular interacting protein, Munc13.

We next characterized the dynamics of the RRP in RIM-deficient synapses. Measurements of the refilling of the RRP after sucrose-induced depletion, using a second sucrose stimulus applied at variable interstimulus intervals, showed that although the RRP in RIM-deficient synapses is massively reduced, its relative refilling rate is unchanged (Fig. 2A). We then used a more physiological stimulus for monitoring the RRP recovery after sucrose-induced depletion, and applied isolated action potentials at increasing intervals after RRP depletion (Fig. 2B). Again, RIM-deficient synapses exhibited a normal relative rate of recovery after sucrose depletion.

Figure 2
Differential effects of the RIM deletion on RRP capacity and refilling rates

Finally, we examined the recovery of synaptic responses after the RRP had been depleted by a 50 Hz stimulus train applied for 1 s (Fig. 2C). The amount of release triggered during the stimulus train appeared decreased in RIM-deficient synapses, consistent with a decrease in the RRP, and no synaptic responses were detectablye at the end of the train in either control or RIM-deficient synapses (Fig. S2A), suggesting that the RRP was depleted.

During the initial recovery period, control and RIM-deficient cDKO neurons exhibited an identical absolute recovery rate of IPSCs, and an increased relative recovery rate. After the initial period, however, the IPSCs in control neurons continued to increase because their RRP was not yet refilled, whereas the IPSCs in RIM-deficient neurons exhibited no further increase, presumably because their smaller RRP was already full after a short recovery period (Fig. 2C). These results suggest that the RRP in RIM-deficient synapses refills relatively faster after depletion with a stimulus train than after depletion by hypertonic sucrose, possibly because the Ca2+-dependent acceleration of vesicle priming is relatively more effective in the RIM-deficient synapses.

The RIM Zn2+-finger acts autonomously in synaptic vesicle priming

A plausible hypothesis is that RIM acts in vesicle priming via Munc13, the dominant priming factor in the presynaptic active zone (Augustin et al., 1999; Varoqueaux et al., 2002). RIM proteins bind to Munc13 via their Zn2+-finger domain (Betz et al., 2001; Schoch et al., 2002; Dulubova et al., 2005); binding is mediated by two critical lysine residues in the RIM Zn2+-finger domain (K144 and K146) whose mutation blocks Munc13 binding (Dulubova et al., 2005; Lu et al., 2006). To ensure that the Zn2+-finger is the only RIM sequence that binds to Munc13, we examined the interaction of ubMunc13-2 with wild-type and mutant RIM1α in transfected HEK293 cells by imaging the Munc13-dependent recruitment of RIM1α to the membrane (Fig. 3B) or by crosslinking studies (Fig. 3C). We used a RIM1α mutant that contains glutamate substitutions in the two lysine residues of the Zn2+-finger domain that are critical for Munc13 binding (the K144/6E mutation); this mutation blocks binding of the RIM Zn2+-finger to the Munc13 C2A-domain (Dulubova et al., 2005). Furthermore, we used the ubMunc13-2 isoform of Munc13 because this isoform was characterized best in previous rescue experiments (e.g., see Rosenmund et al., 2002; Junge et al., 2005; Shin et al., 2009). Both the imaging and the crosslinking experiments showed that full-length wild-type RIM1α was tightly bound to ubMunc13-2, whereas the Zn2+-finger domain mutants of full-length RIM1α was not, indicating that RIM1α binds to ubMunc13-2 only via their Zn2+-finger domain, and no other sequence (Figs. 3B, 3C and S3A). Note that chemical crosslinking of proteins by glutaraldehyde is an inherently low-efficiency technique which depends on the precise distance of reactive groups in a protein complex and on the concentration of the crosslinking agent. As a result, the degree of RIM-Munc13 crosslinking observed here does not reflect the stoichiometry of the RIM/Munc13 complex, and the crosslinking data are most meaningfully interpreted as the differences between the wild-type and mutant RIM and Munc13 proteins, as evidenced by the loss of high-molecular weight crosslinked proteins with mutant RIM1αK144/6E that does not bind to Munc13. In contrast to crosslinking results, co-localization in the imaging results does give a representation of how much of the RIM and Munc13 proteins are in a true complex, suggesting that there is stoichiometric binding for the wild-type but not mutant proteins (Figs. 3B and 3C).

Figure 3
RIM N-terminal domains mediate synaptic vesicle priming

We then tested whether Munc13-binding by the RIM Zn2+-finger domain is required for RIM-dependent vesicle priming by expressing rescue proteins in RIM-deficient neurons. Wild-type RIM1α and RIM1β reversed the decrease in spontaneous mini release in RIM-deficient neurons; in fact, RIM1α appeared to even enhance spontaneous release (Fig. 3D). The Zn2+-finger domain mutation in RIM1α and RIM1β, however, impaired rescue. Moreover, RIM1α and RIM1β both rescued the impairment in sucrose-induced release in RIM-deficient neurons; again, the Zn2+-finger mutation partly blocked this rescue in RIM1α, and completely in RIM1β (Figs. (Figs.3E3E and S3C). Overall, these experiments indicate that in RIM proteins, the Zn2+-finger domain is the major effector domain for priming; moreover, the experiments show that RIM1α may mediate rescue more efficiently than RIM1β, consistent with the notion that the N-terminal Rab3-binding activity of RIM1α (which is absent from RIM1β; Kaeser et al., 2008) contributes to release.

We next asked whether the RIM Zn2+-finger requires the context of other C-terminal domains of RIM to promote priming, as would be expected for a scaffolding protein, or whether it acts autonomously. We examined rescue with RIM1α fragments composed of either only its N-terminal Rab3- and Munc13-binding sequences (referred to as the RIM-RZ fragment), or of its C-terminal fragment containing the PDZ-, C2A- and C2B-domains and the RIM-BP binding sequence (referred to as the RIM-PASB fragment; Fig. 4A). Surprisingly, the N-terminal RIM-RZ fragment was sufficient to rescue vesicle priming in RIM-deficient neurons, whereas the C-terminal PASB-fragment had no rescue effect (Figs. 4B-4D; note that the RIM-PASB fragment efficiently rescues the Ca2+-influx impairment in RIM-deficient neurons [Kaeser et al., 2011]). Importantly, the N-terminal RIM-RZ fragment did not significantly alter vesicle priming when overexpressed in wild-type neurons (Fig. S4). Different from release induced by hypertonic sucrose, not only the N-terminal but also the C-terminal RIM1α fragments produced significant rescue of release stimulated by a 10 Hz train of action potentials (Fig. 4E). This result is consistent with completely separated roles of the N-terminal RIM domains in vesicle priming and of the C-terminal RIM domains in boosting local Ca2+-influx (Kaeser et al., 2011).

Figure 4
RIM N-terminal domains are necessary and sufficient for priming

The rescue of priming in RIM-deficient neurons by the RIM-RZ fragment alone is surprising, because it suggests that RIM does not act as a classical scaffolding protein that functions by recruiting multiple other proteins via its N- and C-terminal domains to the same subcellular location. However, the RIM-RZ fragment still binds to two proteins in a trimeric complex – Rab3 and Munc13 (Dulubova et al., 2005). Thus, its rescue activity could either be mediated by coupling Rab3 on synaptic vesicles to Munc13 in the active zone, or it could be due to autonomous functions of each of its binding activities.

To distinguish between these two possibilities, we systematically eliminated Rab3- and Munc13-binding from the RIM-RZ fragment, the former by using the equivalent fragment from RIM1β which lacks Rab3 binding (RIM-Z), and the latter by introducing the Zn2+-finger mutations into the RIM-RZ and RIM-Z fragments (Fig. 5A). Rescue experiments with these fragments showed that both the RIM-RZ and the RIM-Z fragment rescued ~40-60% of the decrease in spontaneous (Fig. 5B) and sucrose-evoked release (Figs. (Figs.5C5C and S5), whereas the Zn2+-finger mutations blocked part of the rescue in RIM-RZ, and all of the rescue in the RIM-Z fragment. Thus, the isolated Rab3- and Munc13-binding domains of RIMs act as autonomous switches to activate priming, and their actions are independent of each other and additive, with the RIM Zn2+-finger domain having a bigger effect size than the RIM Rab3-binding domain.

Figure 5
Munc13-binding by the N-terminal RIM Zn2+-finger domain autonomously activates vesicle priming

Constitutively monomeric mutant of Munc13 rescues loss of priming in RIM-deficient neurons

The unexpected ability of the isolated RIM Zn2+-finger to activate priming in RIM-deficient neurons indicates that RIMs prime vesicle fusion by an autonomous effect of their Zn2+-finger, and suggests that the Zn2+-finger promotes priming by converting an auto-inhibitory Munc13 C2A-domain homodimer into an active Zn2+-finger/C2A-domain heterodimer (Fig. 6A). However, other mechanisms of action for the Zn2+-finger are also possible; for example, the RIM Zn2+-finger could bind to other, as yet unidentified targets, or binding of the RIM Zn2+-finger to Munc13 may induce other downstream effects in addition to disrupting the C2A-domain homodimer.

Figure 6
Constitutively monomeric mutant ubMunc13-2 bypasses the loss of priming in RIM-deficient neurons

The hypothesis that the RIM Zn2+-finger domain promotes priming by disrupting Munc13 homodimers predicts that constitutively monomeric Munc13 should be able to rescue the impairment of priming observed in RIM-deficient neurons, which would not be the case if the RIM Zn2+-finger bound to other targets, or produced other effects on Munc13. Thus, to test this hypothesis, we expressed in RIM-deficient neurons wild-type ubMunc13-2 (as a control) and mutant ubMunc13-2 that is constitutively monomeric (to examine the role of Munc13 monomerization by the RIM Zn2+-finger). We chose a previously characterized Munc13 point mutation (K32E) that does not interfere with RIM binding by Munc13, but converts the Munc13 C2A-domain into a constitutive monomer (Lu et al., 2006, Fig. 6A).

Expression of wild-type Munc13 had no significant effect on the decreased mini frequency in cDKO neurons, but mutant, constitutively monomeric Munc13 rescued ~50% of the impairment (Fig. 6B). Strikingly, when we measured the RRP using hypertonic sucrose, wild-type Munc13 overexpression again had no significant rescue effect, but the constitutively monomeric Munc13 mutant nearly completely rescued the decrease in the RRP in RIM-deficient neurons (Figs. (Figs.6C6C and S6A). Overexpression of wild-type or mutant ubMunc13-2 in wild-type neurons did not significantly alter the mini frequency and RRP size (Fig. 6B and 6C, right panels). Immunostaining with pan-Munc13 or ubMunc13-2 antibodies confirmed that both wild-type and mutant, constitutively monomeric Munc13 were similarly expressed, and partially localized to synapsin-positive presynaptic terminals (Fig. 6D). Immunoblotting and quantitative RT-PCR further showed that there were no significant differences in expression levels of the two Munc13 constructs (Figs. S6B and S6C). Together, these data show that the differential rescue effects of wild-type and mutant Munc13 are a function of Munc13 monomerization, and are not due to differences in expression levels and/or synaptic targeting. Thus, a mutation that renders Munc13 constitutively monomeric serves as a second-site suppressor of the RIM deletion phenotype, bypassing the requirement for RIM in vesicle priming .

Does the rescue with wild-type or constitutively monomeric mutant Munc13 restore physiological synaptic responses, and does it alter the Ca2+-sensitivity of release? To address this question, we measured action potential-evoked IPSCs as a function of the extracellular Ca2+-concentration (Figs. (Figs.6E6E and S6D – S6F). Again, expression of wild-type Munc13 had no detectable effect on the massive decrease in IPSC amplitudes produced by the RIM deletion, whereas expression of constitutively monomeric mutant Munc13 rescued approximately half of the decrease in synaptic responses induced by deletion of RIMs (Fig. 6E), similar to the rescue of the mIPSC frequency (Fig. 6B). When we analyzed the Ca2+-dependence of the IPSCs by fitting the data to a Hill function, mutant or wild-type Munc13 had no effect on the decreased apparent Ca2+-affinity of release induced by the RIM deletion (Figs. (Figs.6E6E and S6D). This result supports the notion that the impaired Ca2+-channel localization in RIM-deficient synapses is not restored by overexpression of constitutively monomeric or wild-type Munc13 because the Ca2+-channel localization depends on a direct interaction of RIM with Ca2+-channels (Kaeser et al., 2011), which is independent of Munc13.

So far, our data suggest that RIMs promote vesicle priming by disrupting the Munc13 C2A-homodimer. However, it is possible that the Munc13 C2A-domain performs an additional function which is activated when it is released from the homodimer, i.e., that it is not the homodimer per se that is inhibitory, but that the homodimer occludes a critical additional activity of the C2A-domain. To test this possibility, we investigated a truncation mutant of Munc13 that lacks the C2A-domain, and thus cannot mediate any C2A-domain dependent activity, including homodimerization (referred to as ubMunc13-2ΔC2A, Fig. 7A). Experiments in transfected HEK293 cells confirmed that as expected, this N-terminally truncated Munc13 mutant does not interact with RIM1α, nor does it form homodimers (Figs. 7B, 7C and S7A). This Munc13 mutant also largely rescued the mini frequency (Fig. 7D), and entirely reversed the loss of vesicle priming in RIM-deficient neurons (Fig. 7E). Thus, monomeric Munc13 does not require its N-terminal C2A-domain to rescue the priming impairment in RIM-deficient neurons, and the C2A-domain thus likely acts to inhibit the Munc13 priming function by homodimerization, which is reversed by RIM.

Figure 7
The ubMunc13-2 C2A-domain is dispensable for rescuing the RRP in RIM-deficient neurons

Wild-type and monomeric Munc13 rescue priming in Munc13-deficient synapses

In RIM-deficient cDKO neurons, Munc13 levels are reduced by 70% (Fig. 1E). Our data show, however, that RIMs do not mediate priming by simply stabilizing Munc13 levels since wild-type Munc13 cannot rescue the RIM-deficiency phenotype. Instead, we find that RIMs act by activating Munc13, and suggest furthermore that the major function of the Munc13 C2A-domain is to auto-inhibit Munc13 function by homodimerization in the absence of RIM, with the auto-inhibition being reversed when RIMs disrupt the homodimerization. However, it is possible that the Munc13 C2A-domain performs additional RIM-independent functions in release that would be mediated in our rescue experiments by the continued presence of wild-type Munc13 in the RIM-deficient neurons. To test this possibility, we characterized the ability of wild-type and mutant ubMunc13-2 to rescue the reduced priming observed in neurons with strong reductions in total Munc13 levels. If our conclusions were correct, both wild-type and monomeric ubMunc13-2 should rescue priming in these neurons, because RIM is present to monomerize wild-type Munc13, and because mutant ubMunc13-2K32E lacking homodimerization should be constitutively active. Furthermore, monomeric mutant ubMunc13-2ΔC2A unable to bind RIMs should also rescue priming, in line with previous reports suggesting that the MUN domain of Munc13 is the minimal domain required for Munc13 mediated vesicle priming (Basu et al., 2005; Madison et al., 2005; Stevens et al., 2005).

To suppress Munc13 levels, we screened shRNAs against Munc13-1. We identified one shRNA (KD91) that strongly diminished Munc13-1 mRNA and protein levels (Figs. 8A and 8B; ~80% knockdown [KD] efficiency). We then cultured neurons from constitutive Munc13-2 KO mice (Varoqueaux et al., 2002), and infected them either with lentiviruses expressing the Munc13-1 KD shRNA, or with empty control lentiviruses in addition to lentiviruses expressing rescue proteins (Fig. S8A-S8C).

Figure 8
Wild-type and constitutively monomeric mutant ubMunc13-2 rescue priming in Munc13-deficient neurons

Munc13-deficient neurons exhibited a significant decrease in mini frequency and RRP size (Figs. 8C-8F). Both parameters were rescued by re-expression of wild-type ubMunc13-2, of mutant ubMunc13-2K32E containing the C2A-domain point mutation, or of mutant ubMunc13-2ΔC2A in which the C2A-domain is deleted (Figs. 8C-8F, and S8D-8E). These data rule out nonspecific effects during the rescue of priming in RIM-deficient neurons by the various Munc13 mutants, and – more importantly – confirm that RIMs serve as a molecular switch that disrupts Munc13 homodimers in synaptic vesicle priming.

DISCUSSION

In the present study, we explore the mechanism of action of RIM and Munc13 proteins in synaptic vesicle priming. We make three principal observations that are unexpected in view of current ideas about RIM and Munc13 function and vesicle priming, namely (i) that the RIM Zn2+-finger domain activates priming autonomously as a switch, not by mediating the co-assembly of multiple proteins into a protein complex at the active zone, (ii) that the RIM Zn2+-finger switches on priming by activating Munc13, and does so by disrupting constitutive Munc13 homodimers produced by their C2A-domain, and (iii) that C2A-domain mediated homodimerization of Munc13 inhibits its priming function in the absence of RIM, but is disinhibited by the RIM Zn2+-finger (Fig. 8G). Note that we refer to priming in a broad sense, defined operationally as the process that renders vesicles sensitive to stimulation by hypertonic sucrose, and do not attempt to differentiate between stages of vesicle docking and priming. The distinction between docking and priming is classically made by electron microscopy, but the case of Munc13 illustrates how tenuous this distinction can be. Although in traditional electron microscopy experiments, no docking defect in Munc13-deficient synapses was observed (Augustin et al., 1999; Varoqueaux et al., 2002), a recent study using high-pressure freezing reached the opposite conclusion (Siksou et al., 2009). It is unclear which of the two electron microscopy approaches renders a ‘true’ picture; thus, we make no attempt to tease apart physical vesicle attachment (docking) and conversion of attached into release-ready vesicles (priming), but use the term ‘priming’ in a generic sense as defined above.

RIMs act in priming as molecular switches, not as scaffolds mediating co-assembly of multiple proteins

Classical scaffolding molecules often act by producing the co-localization of multiple downstream effectors (Mishra et al., 2007; Pawson and Scott, 2010). RIMs were presumed to act as scaffolds in this sense because of their domain structure (Schoch et al., 2002). However, we find that surprisingly, the RIM Zn2+-finger autonomously promotes vesicle priming by directly activating Munc13. With this observation, we revise our previous conclusions based on peptide injections into the calyx of Held synapse (Dulubova et al., 2005), which seemed to suggest that uncoupling the domains of RIM suppresses their function. The present genetic approach is a more definitive approach than peptide injections, as it does not depend on unphysiologically high protein levels to achieve a dominant-negative effect, but utilizes rescue of a loss-of-function state as an assay. It seems likely that the high peptide concentrations used previously produce unintended effects unrelated to the normal function of RIM, illustrating the general difficulty of interpreting experiments in which a protein fragment is introduced into a wild-type synapse at high concentrations (Südhof, 2004).

If RIM proteins are not scaffolds for the co-assembly of proteins into complexes, why do they have a multidomain structure? One possibility is that the autonomous function of the RIM Zn2+-finger domain in priming is subject to intramolecular regulation, which could be involved in the role of RIM in long-term presynaptic plasticity (Castillo et al., 2002; Chevalayre et al., 2007; Fourcaudot et al., 2008; Kaeser et al., 2008). Another possibility is that assembly of the autonomous functions of different RIM domains into a single protein ensures the right relative activity of these domains, i.e., a constant ratio of their activities. A third possibility is that this arrangement may be economical in terms of organizing the expression and localization of so many activities mediated by different domains.

RIMs switch on priming by disrupting Munc13 homodimers

Crystal structures revealed that the Munc13 C2A-domain forms a tight homodimer with nanomolar affinity; this dimer is disrupted by binding of the RIM Zn2+-finger, resulting in Zn2+-finger/C2A-domain heterodimers (Dulubova et al., 2005; Lu et al., 2006). Our results suggest that Munc13 homodimerized by its C2A-domain is inactive in priming, but activated by the RIM Zn2+-finger binding which disrupts the homodimer. The strongest evidence for this conclusion comes from the suppression of the priming phenotype in RIM-deficient synapses by mutant, constitutively monomeric Munc13, but not by wild-type Munc13 (Figs. (Figs.66 and and7).7). Note that the constitutively monomeric Munc13 mutants rescued only the priming deficit of RIM-deficient neurons, not their Ca2+-triggering phenotype, which manifested in a ~50% rescue of synaptic strength in the RIM-deficient neurons by the mutant Munc13 (Fig. 6E). Furthermore, whereas only mutant, constitutively monomeric Munc13 but not wild-type Munc13 rescued priming in RIM-deficient neurons, both mutant Munc13 and wild-type Munc13 rescued priming in Munc13-deficient neurons (Fig. 8). An alternative hypothesis to the model proposed here is that an as yet unidentified protein binds to the Munc13 C2A-domain and inhibits Munc13 function, and that this protein is displaced by the RIM Zn2+-finger. However, this hypothesis would require that the putative Munc13-binding protein has nanomolar affinity for Munc13 (since it has be stronger than Munc13 homodimerization) that it is nevertheless displaced from Munc13 by RIM. In addition, the putative Munc13-binding protein would be required to bind to the site of Munc13 homodimerization, effectively suppressing it because the C2A-domain would always be either bound to RIM or to the other protein. Viewed together, these improbable requirements render the alternative hypothesis highly unlikely and non-parsimonious.

The Munc13 C2A-domain functions as an auto-inhibitory module which blocks priming by homodimerization

The auto-inhibitory function of the Munc13 C2A-domain is surprising since no other C2-domain has been associated with a comparable function. Of four principal synaptic Munc13 isoforms (Munc13-1, ubMunc13-2, bMunc13-2, and Munc13-3), only the first two contain a C2A-domain (Brose et al., 1995; Augustin et al.; 1999, Koch et al., 2000), raising the question of how the other two Munc13 isoforms (which are less abundant) are regulated, and whether they are possibly controlled by a different RIM-dependent mechanism. It seems likely that Munc13 acts on SNARE proteins in priming (Basu et al., 2005; Madison et al., 2005; Stevens et al., 2005; Guan et al., 2008), but the mechanisms of Munc13 function in priming, and of the inactivation of Munc13 function by homodimerization, remain unclear. One possibility is that homodimeric Munc13 is inherently unstable and becomes degraded in RIM-deficient neurons, thereby accounting for the priming phenotype and the reduced Munc13 levels in RIM-deficient neurons (Fig. 1, and Schoch et al., 2002). However, overexpression of wild-type Munc13 did not rescue the priming phenotype in RIM-deficient neurons, suggesting that simply increasing Munc13 levels is not sufficient to rescue priming in RIM-deficient synapses. Another possibility is that homodimeric Munc13 is not correctly targeted to synapses, and becomes degraded if it is not in the correct location (Andrews-Zwilling et al., 2006; Kaeser et al., 2009). Although possible, this hypothesis appears rather unlikely given the rescue of the RIM- and Munc13-deficiency phenotypes by N-terminally truncated Munc13 (Figs. (Figs.77 and and8),8), which suggests that Munc13 is transported to synapses without RIM proteins and without binding to RIM proteins. Independent of which explanation will turn out to be correct, the mechanism of Munc13 activation we identify here is opposite to what is classically observed for signal transduction events, where dimerization is usually activating, whereas in our case it is inhibitory, suggesting a more diverse range of biological activation mechanisms than previously envisioned.

Outlook

The current study identifies a molecular mechanism involved in vesicle priming by the active zone, but raises new questions. At a basic level, how is an active zone generated – what protein nucleates its assembly? The fact that the RIM Zn2+-finger alone is active suggests that it acts downstream of Munc13 targeting to active zones, and cannot physically tether Munc13 to them; similarly, Munc13 is not essential for targeting other proteins to active zones, and thus also not involved in their recruitment to active zones. Clearly, despite its central function, RIM alone does not organize the active zone, an activity that may be carried out by an overlapping set of several proteins instead of a single master regulator. Another important question is how RIM proteins contribute to long-term synaptic plasticity – is this mediated by a coordination of their various functions, or by one particular aspect? With the present results we now know of two switches at the active zone that involve RIM and regulate synaptic neurotransmitter release: the GTP-dependent interaction of Rab3 with RIMs, and the Zn2+-finger mediated RIM-dependent monomerization of Munc13. Given RIM’s and Rab3’s central roles in all known forms of long-term presynaptic plasticity (e.g., Castillo et al., 1997 and 2002; Chevaleyre et al., 2007; Fourcaudot et al., 2008, Kaeser et al., 2008), a plausible hypothesis is that these switches could be regulated by synaptic activity, and thus mediate such plasticity, an exciting hypothesis that would account for the enormous effects of presynaptic plasticity on neurotransmitter release.

EXPERIMENTAL PROCEDURES

Primary hippocampal cultures, lentiviral infections and rescue constructs

High density hippocampal cultures were prepared from new born mice and infected with lentiviruses as described (Kaeser et al., 2009). The RIM1 rescue constructs were generated from rat RIM1α (Wang et al., 1997) or RIM1β (Kaeser et al., 2008) and are described in the supplemental methods. The GFP-tagged rat ubMunc13-2 lentivirus was previously published (Rosenmund et al., 2002). In contrast to the RIM rescue constructs which were expressed bicistronically with an IRES sequence (Kaeser et al., 2009, 2010), the Munc13-overexpression experiments were performed by superinfection of cre-infected cultures with Munc13-expressing lentiviruses.

Electrophysiology

Whole-cell patch-clamp recordings were performed in cultured hippocampal neurons at DIV13-15 as described (Maximov et al., 2007, Kaeser et al., 2009, Kaeser et al., 2008, Maximov et al., 2005). The extracellular solution contained (in mM) 140 NaCl, 4 KCl, 2 CaCl2, 2 MgCl2, 10 HEPES-NaOH pH 7.3, and 10 glucose, with 315 mOsm. Glass pipettes (3-5 MΩ) were filled with an internal solution containing (in mM) 145 CsCl, 5 NaCl, 10 HEPES-CsOH pH 7.3, 10 EGTA, 4 MgATP and 0.3 Na2GTP, with 305 mOsm. mEPSCs and mIPSCs were recorded in the presence of 1 μM TTX plus either 50 μM picrotoxin and 50 μM APV (mEPSCs) or 10 μM CNQX and 50 μM D-APV (mIPSCs), respectively. For measurement of readily-releasable pool (RRP), 0.5 M hypertonic sucrose was perfused with a picospritzer in the presence of 1 μM TTX (except for the experiments in Fig. 2B, where TTX was omitted), 10 μM CNQX and 50 μM D-APV. Ca2+-titrations experiments were performed as described (Kaeser et al, 2011). RRP rescue efficacy was calculated according to following equation: % = (mean rescue charge transfer – mean cDKO charge transfer) / (mean control charge transfer – mean cDKO charge transfer) * 100, where the mean charge transfer is the average of sucrose induced charges of neurons recorded in the same batch of culture. Data were acquired with a multiclamp 700B amplifier using pClamp9, sampled at 10 Hz, and filtered at 1 Hz. In all experiments, the experimenter was blind to the genotype.

Protein quantitations in brain homogenates and in neuronal cultures

Neurons were harvested in a detergent free buffer, homogenized with a glass-teflon homogenizer, and spun at 256,000 x g for 30 min, and the pellet was used for protein quantitations. Protein contents were adjusted by use of a BCA protein assay kit (Pierce Biotechnology). 20 μg of protein was loaded per lane on standard SDS/Page gels for Western blotting, and 125iodine-labelled secondary antibodies were used for detection as previously described (Kaeser et al., 2008), and valosin-containing protein (VCP), GDP dissociation inhibitor (GDI) and β-actin were used as internal standards.

Protein interaction assays

Munc13/RIM colocalization experiments in transfected HEK293T cells were performed as described (Andrews-Zwilling et al., 2006). Crosslinking experiments were performed in transfected HEK293T cells, and was induced with 0.008% glutaraldehyde after membrane recruitment of Munc13 with phorbol esters. Detailed experimental protocols are in the supplemental methods.

Immunofluorescence staining of cultured neurons

Cultured neurons were fixed in 4% paraformaldehyde/phosphate-buffered saline, permeabilized in 0.1% Triton X-100/3% bovine serum albumin/phosphate-buffered saline and incubated overnight with anti-Munc13 rabbit polyclonal antibodies (41, 1:2000), or anti-ubMunc13-2 rabbit polyclonal antibodies (52, 1:2000), and anti-synapsin mouse monoclonal antibodies (Synaptic Systems, 1:1000). Alexa-Fluor 546 anti-mouse and Alexa-Fluor 633 anti-rabbit secondary antibodies were used for detection. Images were acquired with a Leica TCS2 confocal microscope with identical settings applied to all samples in an experiment. Single confocal sections were recorded at 1 airy unit pinhole. Scale bar 5 μm.

Munc13-1 knockdown

The Munc13-1 knockdown sequence (KD91, GCCTGAGATCTTCGAGCTTAT) was expressed from an H1 promotor sequence in a lentiviral vector, and was followed by a ubiquitin promoter driven mCherry. Munc13-deficient neurons were generated by Munc13-1 knockdown in Munc13-2 constitutive knockout neurons (Varoqueaux et al., 2002).

Miscellaneous

SDS/PAGE gels and immunoblotting were done according to standard methods described in the supplemental materials (Kaeser et al., 2009; Kaeser et al., 2008). In all experiments, the experimenter was blind to the condition/genotype. All animal experiments were performed according to institutional guidelines. All data are shown as means ± SEM. Statistical significance was determined by one-way ANOVA (electrophysiological recordings), or Student’s t-test (all other experiments). All numerical and statistical values and the tests used can be found in the Suppl. Tables 1-7.

HIGHLIGHTS

  1. RIM proteins determine the capacity of the readily-releasable pool of vesicles
  2. The N-terminal zinc-finger domain of RIM autonomously activates vesicle priming
  3. The RIM zinc-finger domain promotes priming by disrupting Munc13 homodimers
  4. Mutant, constitutively monomeric Munc13 bypasses RIM function in vesicle priming

Supplementary Material

01

ACKNOWLEDGEMENTS

We thank H. Ly for technical assistance, Dr. Nils Brose for the gift of Munc13-antibodies and Munc13-2 KO mice, Dr. Z. Pang for the ubMunc13-2ΔC2A construct, and members of the Südhof lab for comments. This work was supported by grants from the NIH (NINDS 33564 to T.C.S., DA029044 to P.S.K.), and by a Swiss National Science Foundation Postdoctoral Fellowship (to P.S.K.).

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

REFERENCES

  • Andrews-Zwilling YS, Kawabe H, Reim K, Varoqueaux F, Brose N. Binding to Rab3A-interacting molecule RIM regulates the presynaptic recruitment of Munc13-1 and ubMunc13-2. J Biol Chem. 2006;281:19720–19731. [PubMed]
  • Augustin I, Rosenmund C, Südhof TC, Brose N. Munc13-1 is essential for fusion competence of glutamatergic synaptic vesicles. Nature. 1999;400:457–461. [PubMed]
  • Augustin I, Betz A, Herrmann C, Jo T, Brose N. Differential expression of two novel Munc13 proteins in rat brain. Biochem J. 1999;337:363–71. [PMC free article] [PubMed]
  • Basu J, Shen N, Dulubova I, Lu J, Guan R, Guryev O, Grishin NV, Rosenmund C, Rizo J. A minimal domain responsible for Munc13 activity. Nat Struct Mol Biol. 2005;12:1017–1018. [PubMed]
  • Betz A, Okamoto M, Benseler F, Brose N. Direct interaction of the rat unc-13 homologue Munc13-1 with the N terminus of syntaxin. J Biol Chem. 1997;272:2520–2526. [PubMed]
  • Betz A, Thakur P, Junge HJ, Ashery U, Rhee JS, Scheuss V, Rosenmund C, Rettig J, Brose N. Functional interaction of the active zone proteins Munc13-1 and RIM1 in synaptic vesicle priming. Neuron. 2001;30:183–196. [PubMed]
  • Calakos N, Schoch S, Südhof TC, Malenka RC. Multiple roles for the active zone protein RIM1alpha in late stages of neurotransmitter release. Neuron. 2004;42:889–896. [PubMed]
  • Castillo PE, Janz R, Südhof TC, Tzounopoulos T, Malenka RC, Nicoll RA. Rab3A is essential for mossy fibre long-term potentiation in the hippocampus. Nature. 1997;388:590–593. [PubMed]
  • Castillo PE, Schoch S, Schmitz F, Sudhof TC, Malenka RC. RIM1α is required for presynaptic long-term potentiation. Nature. 2002;415:327–330. [PubMed]
  • Chevaleyre V, Heifets BD, Kaeser PS, Südhof TC, Castillo PE. Endocannabinoid-mediated long-term plasticity requires cAMP/PKA signaling and RIM1α Neuron. 2007;54:801–812. [PMC free article] [PubMed]
  • Coppola T, Magnin-Luthi S, Perret-Menoud V, Gattesco S, Schiavo G, Regazzi R. Direct interaction of the Rab3 effector RIM with Ca2+ channels, SNAP-25, and synaptotagmin. J Biol Chem. 2001;276:32756–32762. [PubMed]
  • Dulubova I, Lou X, Lu J, Huryeva I, Alam A, Schneggenburger R, Südhof TC, Rizo J. A Munc13/RIM/Rab3 tripartite complex: from priming to plasticity? Embo J. 2005;24:2839–2850. [PMC free article] [PubMed]
  • Fourcaudot E, Gambino F, Humeau Y, Casassus G, Shaban H, Poulain B, Lüthi A. cAMP/PKA signaling and RIM1α mediate presynaptic LTP in the lateral amygdala. Proc Natl Acad Sci USA. 2008;105:15130–15135. [PMC free article] [PubMed]
  • Gracheva EO, Hadwiger G, Nonet ML, Richmond JE. Direct interactions between C. elegans RAB-3 and Rim provide a mechanism to target vesicles to the presynaptic density. Neurosci Lett. 2008;444:137–142. [PMC free article] [PubMed]
  • Guan R, Dai H, Rizo J. Binding of the Munc13-1 MUN domain to membrane-anchored SNARE complexes. Biochemistry. 2008;47:1474–1481. [PubMed]
  • Han Y, Kaeser PS, Sudhof TC, Schneggenburger R. RIM determines Ca2+ channel density and vesicle docking at the presynaptic active zone. Neuron. 2011 in press. [PMC free article] [PubMed]
  • Hibino H, Pironkova R, Onwumere O, Vologodskaia M, Hudspeth AJ, Lesage F. RIM binding proteins (RBPs) couple Rab3-interacting molecules (RIMs) to voltage-gated Ca2+ channels. Neuron. 2002;34:411–423. [PMC free article] [PubMed]
  • Kaeser PS, Kwon HB, Chiu CQ, Deng L, Castillo PE, Südhof TC. RIM1α and RIM1β are synthesized from distinct promoters of the RIM1 gene to mediate differential but overlapping synaptic functions. J Neurosci. 2008;28:13435–13447. [PMC free article] [PubMed]
  • Kaeser PS, Deng L, Chavez AE, Liu X, Castillo PE, Südhof TC. ELKS2alpha/CAST deletion selectively increases neurotransmitter release at inhibitory synapses. Neuron. 2009;64:227–239. [PMC free article] [PubMed]
  • Kaeser PS, Deng L, Wang Y, Dulubova I, Liu X, Castillo PE, Rizo J, Südhof TC. RIM proteins tether Ca2+-channels to presynaptic active zones via a direct PDZ-domain interaction. Cell. 2011 in press. [PMC free article] [PubMed]
  • Koch H, Hofmann K, Brose N. Definition of Munc13-homology-domains and characterization of a novel ubiquitously expressed Munc13 isoform. Biochem J. 2000;349:247–53. [PMC free article] [PubMed]
  • Katz B. The Release of Neural Transmitter Substances. Liverpool Univ Press; Liverpool: 1969.
  • Kiyonaka S, Wakamori M, Miki T, Uriu Y, Nonaka M, Bito H, Beedle AM, Mori E, Hara Y, De Waard M, et al. RIM1 confers sustained activity and neurotransmitter vesicle anchoring to presynaptic Ca2+ channels. Nat Neurosci. 2007;10:691–701. [PMC free article] [PubMed]
  • Ko J, Na M, Kim S, Lee JR, Kim E. Interaction of the ERC family of RIM-binding proteins with the liprin-α family of multidomain proteins. J Biol Chem. 2003;278:42377–42385. [PubMed]
  • Koushika SP, Richmond JE, Hadwiger G, Weimer RM, Jorgensen EM, Nonet ML. A post-docking role for active zone protein Rim. Nat Neurosci. 2001;4:997–1005. [PMC free article] [PubMed]
  • Lu J, Machius M, Dulubova I, Dai H, Südhof TC, Tomchick DR, Rizo J. Structural basis for a Munc13-1 homodimer to Munc13-1/RIM heterodimer switch. PLoS Biol. 2006;4:e192. [PMC free article] [PubMed]
  • Madison JM, Nurrish S, Kaplan JM. UNC-13 interaction with syntaxin is required for synaptic transmission. Curr Biol. 2005;15:2236–2242. [PubMed]
  • Maximov A, Pang ZP, Tervo DG, Südhof TC. Monitoring synaptic transmission in primary neuronal cultures using local extracellular stimulation. Journal of Neuroscience Methods. 2007;161:75–87. [PubMed]
  • Maximov A, Tang J, Yang X, Pang ZP, Südhof TC. Complexin controls the force transfer from SNARE complexes to membranes in fusion. Science. 2009;323:516–521. [PMC free article] [PubMed]
  • Mishra P, Socolich M, Wall MA, Graves J, Wang Z, Ranganathan R. Dynamic scaffolding in a G protein-coupled signaling system. Cell. 2007;131:80–92. [PubMed]
  • Mittelstaedt T, Alvaréz-Baron E, Schoch S. RIM proteins and their role in synapse function. Biol Chem. 2010;391:599–606. [PubMed]
  • Moulder KL, Mennerick S. Reluctant vesicles contribute to the total readily releasable pool in glutamatergic hippocampal neurons. J Neurosci. 2005;25:3842–3850. [PubMed]
  • Ohtsuka T, Takao-Rikitsu E, Inoue E, Inoue M, Takeuchi M, Matsubara K, Deguchi-Tawarada M, Satoh K, Morimoto K, Nakanishi H, et al. Cast: a novel protein of the cytomatrix at the active zone of synapses that forms a ternary complex with RIM1 and munc13-1. J Cell Biol. 2002;158:577–590. [PMC free article] [PubMed]
  • Pawson CT, Scott JD. Signal integration through blending, bolstering and bifurcating of intracellular information. Nat Struct Mol Biol. 2010;17:653–658. [PMC free article] [PubMed]
  • Rosenmund C, Stevens CF. Definition of the readily releasable pool of vesicles at hippocampal synapses. Neuron. 1996;16:1197–1207. [PubMed]
  • Rosenmund C, Sigler A, Augustin I, Reim K, Brose N, Rhee JS. Differential control of vesicle priming and short-term plasticity by Munc13 isoforms. Neuron. 2002;33:411–424. [PubMed]
  • Schoch S, Castillo PE, Jo T, Mukherjee K, Geppert M, Wang Y, Schmitz F, Malenka RC, Südhof TC. RIM1α forms a protein scaffold for regulating neurotransmitter release at the active zone. Nature. 2002;415:321–326. [PubMed]
  • Schoch S, Mittelstaedt T, Kaeser PS, Padgett D, Feldmann N, Chevaleyre V, Castillo PE, Hammer RE, Han W, Schmitz F, et al. Redundant functions of RIM1α and RIM2α in Ca2+-triggered neurotransmitter release. Embo J. 2006;25:5852–5863. [PMC free article] [PubMed]
  • Siksou L, Varoqueaux F, Pascual O, Triller A, Brose N, Marty S. A common molecular basis for membrane docking and functional priming of synaptic vesicles. Eur J Neurosci. 2009;30:49–56. [PubMed]
  • Stevens CF. Neurotransmitter release at central synapses. Neuron. 2003;40:381–388. [PubMed]
  • Stevens DR, Wu ZX, Matti U, Junge HJ, Schirra C, Becherer U, Wojcik SM, Brose N, Rettig J. Identification of the minimal protein domain required for priming activity of Munc13-1. Curr Biol. 2005;15:2243–2248. [PubMed]
  • Südhof TC. The synaptic vesicle cycle. Annu Rev Neurosci. 2004;27:509–547. [PubMed]
  • Varoqueaux F, Sigler A, Rhee JS, Brose N, Enk C, Reim K, Rosenmund C. Total arrest of spontaneous and evoked synaptic transmission but normal synaptogenesis in the absence of Munc13-mediated vesicle priming. Proc Natl Acad Sci U S A. 2002;99:9037–9042. [PMC free article] [PubMed]
  • Wang Y, Südhof TC. Genomic definition of RIM proteins: evolutionary amplification of a family of synaptic regulatory proteins (small star, filled ) Genomics. 2003;81:126–137. [PubMed]
  • Wang Y, Liu X, Biederer T, Südhof TC. A family of RIM-binding proteins regulated by alternative splicing: Implications for the genesis of synaptic active zones. Proc Natl Acad Sci U S A. 2002;99:14464–14469. [PMC free article] [PubMed]
  • Wang Y, Okamoto M, Schmitz F, Hofmann K, Südhof TC. RIM is a putative Rab3 effector in regulating synaptic-vesicle fusion. Nature. 1997;388:593–598. [PubMed]
  • Wang Y, Sugita S, Südhof TC. The RIM/NIM family of neuronal C2 domain proteins. Interactions with Rab3 and a new class of Src homology 3 domain proteins. J Biol Chem. 2000;275:20033–20044. [PubMed]
  • Weimer RM, Gracheva EO, Meyrignac O, Miller KG, Richmond JE, Bessereau JL. UNC-13 and UNC-10/rim localize synaptic vesicles to specific membrane domains. J Neurosci. 2006;26:8040–8047. [PMC free article] [PubMed]
  • Wojcik SM, Brose N. Regulation of membrane fusion in synaptic excitation-secretion coupling: speed and accuracy matter. Neuron. 2007;55:11–24. [PubMed]
  • Wu LG, Borst JG. The reduced release probability of releasable vesicles during recovery from short-term synaptic depression. Neuron. 1999;23:821–832. [PubMed]
  • Xu-Friedman MA, Harris KM, Regehr WG. Three-dimensional comparison of ultrastructural characteristics at depressing and facilitating synapses onto cerebellar Purkinje cells. J Neurosci. 2001;21:6666–6672. [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...