• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of embojLink to Publisher's site
EMBO J. Feb 16, 2011; 30(4): 731–743.
Published online Jan 14, 2011. doi:  10.1038/emboj.2010.359
PMCID: PMC3041955

The Arabidopsis CUL4–DDB1 complex interacts with MSI1 and is required to maintain MEDEA parental imprinting

Abstract

Protein ubiquitylation regulates a broad variety of biological processes in all eukaryotes. Recent work identified a novel class of cullin-containing ubiquitin ligases (E3s) composed of CUL4, DDB1, and one WD40 protein, believed to act as a substrate receptor. Strikingly, CUL4-based E3 ligases (CRL4s) have important functions at the chromatin level, including responses to DNA damage in metazoans and plants and, in fission yeast, in heterochromatin silencing. Among putative CRL4 receptors we identified MULTICOPY SUPPRESSOR OF IRA1 (MSI1), which belongs to an evolutionary conserved protein family. MSI1-like proteins contribute to different protein complexes, including the epigenetic regulatory Polycomb repressive complex 2 (PRC2). Here, we provide evidence that Arabidopsis MSI1 physically interacts with DDB1A and is part of a multimeric protein complex including CUL4. CUL4 and DDB1 loss-of-function lead to embryo lethality. Interestingly, as in fis class mutants, cul4 mutants exhibit autonomous endosperm initiation and loss of parental imprinting of MEDEA, a target gene of the Arabidopsis PRC2 complex. In addition, after pollination both MEDEA transcript and protein accumulate in a cul4 mutant background. Overall, our work provides the first evidence of a physical and functional link between a CRL4 E3 ligase and a PRC2 complex, thus indicating a novel role of ubiquitylation in the repression of gene expression.

Keywords: Arabidopsis, CUL4, parental imprinting, Polycomb repressive complex 2, seed development

Introduction

Regulation of protein stability by the ubiquitin/proteasome system participates in a broad variety of physiologically and developmentally controlled processes in all eukaryotes (Ciechanover et al, 2000; Smalle and Vierstra, 2004). In this pathway, a critical step involves ubiquitin ligases (E3s), which facilitate the transfer of ubiquitin moieties to a substrate protein, the preparative step for degradation via the 26S proteasome. Among the different E3 enzymes, the composition of CUL4-based E3 ligases (CRL4s) was only recently identified (Higa and Zhang, 2007). CUL4 binds RBX1 to recruit a specific E2 ubiquitin-conjugating enzyme, and also binds DDB1, an adaptor protein, which itself associates with a substrate receptor. Affinity purification of CLR4s from mammalian cells identified various WD40 proteins as possible substrate receptors (Angers et al, 2006; He et al, 2006; Higa et al, 2006; Jin et al, 2006). Many of these proteins, also called DDB1 and CUL4-associated factors (DCAFs), contain WDxR motifs that are required for efficient DDB1 binding. However, for most of them, their roles and substrates remain unknown. In humans, about 90 different DCAFs have been predicted (He et al, 2006), suggesting the existence of a large number of CRL4s. A similar number of WD40 repeat proteins harbouring at least one WDxR motif have been identified in the model plant Arabidopsis thaliana (Lee et al, 2008). One of the predicted Arabidopsis DCAFs is MULTICOPY SUPPRESSOR OF IRA1 (MSI1), which belongs to an evolutionary conserved protein family (reviewed in Hennig et al, 2005), whose founding member is MSI1 from yeast (Ruggieri et al, 1989). In both metazoans and plants, MSI1-like proteins are part of several protein complexes involved in diverse chromatin functions (reviewed in Hennig et al, 2005). In particular, MSI1 has been proposed to maintain epigenetic memory during development by targeting silencing complexes to chromatin.

In Arabidopsis, MSI1 is essential for plant reproductive development (Köhler et al, 2003; Guitton et al, 2004). In msi1 mutants, seeds abort when the mutant allele is inherited from the mother regardless of the paternal contribution. In such seeds, the endosperm (an embryo nourishing tissue) does not cellularize, whereas the embryo exhibits cell-cycle and developmental defects. msi1 mutants have a strong penetrance of autonomous endosperm development in the absence of fertilization and form rare parthenogenetic embryos (Köhler et al, 2003; Guitton and Berger, 2005). MSI1 is part of the FIS–PRC2 complex together with at least three other proteins, MEDEA (MEA), FERTILIZATION-INDEPENDENT SEED2 (FIS2) and FERTILIZATION-INDEPENDENT ENDOSPERM (FIE), which is required for normal seed development (Köhler et al, 2003). MEA encodes a SET-domain-containing histone methyltransferase homologous to Drosophila Enhancer of Zeste (Grossniklaus et al, 1998) and regulates the imprinted expression of itself, as well as of its target gene PHERES1 (PHE1), encoding a MADS-domain transcription factor (Köhler et al, 2005). Imprinting regulation by FIS–PRC2 involves the silencing of the paternal allele of MEA and the maternal allele of PHE1, respectively (Köhler et al, 2005; Baroux et al, 2006; Gehring et al, 2006; Jullien et al, 2006). In contrast, auto-repression of the maternal MEA allele is FIS–PRC2 independent (Baroux et al, 2006).

Here, we report that all WD40 repeat MSI1-like proteins from various organisms carry at least one conserved WDxR motif, a signature of DCAFs. Arabidopsis MSI1 physically interacts with DDB1A and is part of a CUL4–DDB1A–MSI1 protein complex. Functional analysis revealed that CUL4, as well as the Arabidopsis DDB1 homologs, are essential for seed production. Importantly, the cul4 mutation leads to autonomous endosperm development and loss of parental MEA imprinting, that is reactivation of the paternal MEA allele, supporting a functional link of this E3 ligase and the FIS–PRC2 complex.

Results

MSI-like proteins are evolutionary conserved WD40 proteins that carry WDxR motifs

Recent work identified DDB1 and DCAFs as possible substrate receptors of CRL4 E3 ligases (reviewed in Lee and Zhou, 2007). The largest class of DCAFs are WD40 repeat proteins, which interact with DDB1 via one or several conserved WDxR motifs. The Arabidopsis genome encodes 237 WD40 repeat proteins; however, only a subset of them (~80 proteins) carry one or more WDxR motif(s) (Lee et al, 2008 and our unpublished data). Among these proteins we identified MSI1 and four other Arabidopsis MSI1-related proteins, named MSI2–MSI5 (reviewed in Hennig et al, 2005). When all MSI1-like proteins from plant and non-plant organisms were compared, it appeared that most of them share a highly conserved WDxR motif (Figure 1). In metazoans, MSI1-like proteins exhibit also a second WDxR motif, which is less conserved in plants, but is also present in fungi. Therefore, most if not all MSI1-like proteins are structurally related to DCAFs.

Figure 1
Alignments of MSI1-like proteins and WDxR motifs. All five Arabidopsis MSI1-like protein sequences (MSI1, AT5G58230; MSI2, AT2G16780; MSI3, AT4G35050; MSI4, AT2G19520 and MSI5, AT4G29730) were used to identify MSI1-like proteins by BLAST (Altschul et ...

MSI1 associates with DDB1A and CUL4 in Arabidopsis

We first investigated whether MSI1 interacts with DDB1A in a yeast two-hybrid assay. Similarly to DDB2 (Molinier et al, 2008), which served as a positive control, MSI1 and DDB1A interacted, although the interaction was weak as yeast growth was only detected on (-LWH) medium (Figure 2A). We further confirmed this interaction by an in vitro pull-down assay. In this experiment, a fusion protein between glutathionine-S-transferase (GST) and DDB1A, GST-DDB1A, was incubated with in vitro translated, 35S-methionine-labelled MSI1 or DDB2. Consistently, MSI1 and DDB2 co-precipitated with GST-DDB1A, but not with GST alone (Figure 2B). To provide evidence for a physical interaction between both proteins in plant cells, we carried out bimolecular fluorescence complementation (BiFC) experiments. Plasmids YC-MSI1 and YN-DDB1A were co-bombarded into etiolated mustard hypocotyls. A strong YFP signal was observed in the nucleus of 81% examined cells (35/43; Figure 2C). These data are similar to those obtained with cells transformed with the positive control YN-DDB1A+YC-DDB2 (43/46). Only a weak fluorescence signal was observed after bombardment with the following plasmid combinations YN-DDB1A+YC-BPM3 (9/35) and YN-BPM3+YC-MSI1 (2/27), where BPM3 (BTB/POZ-MATH3 protein encoded by At2g39760) is a nuclear cullin-ring ubiquitin ligase3 (CLR3) receptor, used here as a negative control. Taken together, our data clearly demonstrate a physical interaction between DDB1A and MSI1.

Figure 2
MSI1 forms a complex with DDB1A and CUL4. (A) Yeast two-hybrid experiments showing MSI1 interaction with DDB1A. Dilution series of yeast cells co-expressing the indicated proteins were grown for 3 days at 28°C on LWH (low-stringency selection) ...

Next, we tested whether MSI1 is also part of a protein complex containing Arabidopsis CUL4. Thus, we immunoprecipitated Arabidopsis CUL4 from plants expressing the MSI1–RFP fusion protein under the control of its own promoter (Chen et al, 2008). Hence, MSI1 was successfully co-immunoprecipitated in this assay (Figure 2D). Since CUL4 interacts with DDB1A (Bernhardt et al, 2006) our results, collectively, support the existence of a CUL4–DDB1A–MSI1 protein complex in Arabidopsis.

CUL4 and its adaptors DDB1A and DDB1B are required for embryogenesis

In Arabidopsis, loss-of-function of MSI1 causes maternal effect embryo lethality leading to seed abortion early in development (Köhler et al, 2003). We have previously isolated a T-DNA mutant, cul4-1 (Bernhardt et al, 2006), in which CUL4 expression was severely downregulated. Although viable cul4-1 homozygous mutants were obtained, these plants showed various developmental abnormalities (Bernhardt et al, 2006). When selfed, we noticed that cul4-1 homozygous plants exhibited altered seed development leading eventually to seed abortion (Supplementary Figure S1). Thus, we examined cul4-1 homozygous mutant seeds at different developmental stages (Figure 3). Already at the octant stage, we observed a lower proliferation of the endosperm (Figure 3B) while at later seed developmental stages we scored abnormally large endosperm nuclei and delayed embryo development (Figure 3D and F). Because of the pleiotropic and hypomorphic nature of the cul4-1 allele, we aimed to identify amorphic CUL4 loss-of-function mutants. As no such mutants were available in public collections, we screened a collection of Arabidopsis T-DNA insertion lines (Ríos et al, 2002). Two T-DNA insertions were identified within the coding region of CUL4, called cul4-2 and cul4-3 (Supplementary Figure S2A). Both cul4-2 and cul4-3 mutants were backcrossed to the wild type and Southern blots confirmed single T-DNA insertions. Although we genotyped 137 and 72 progeny from selfed cul4-2 and cul4-3 mutant plants, respectively, we were unable to identify homozygous mutants, suggesting that CUL4 is an essential gene in Arabidopsis.

Figure 3
Embryo and endosperm development is affected in cul4 mutant seeds. (A) Cleared seed with an embryo at the octant stage from the same cul4-1 homozygous mutant silique as the seed shown in (B). (B) Mutant embryo and endosperm with reduced proliferation ...

As both lines contained single T-DNA insertions with integral hygromycin selection markers, we self-pollinated cul4-2 and cul4-3 heterozygous plants and analysed the segregation of this marker among their progeny (Table I). This genetic analysis revealed a segregation ratio close to 2:1 consistent with nearly fully penetrant zygotic embryo lethality. Because the segregation ratio of the marker was slightly below 2:1 for the cul4-2 allele, suggesting a weak defect in gametophytic transmission, we performed reciprocal crosses with wild-type plants. The transmission efficiency of the marker was slightly reduced through both male and female gametophytes (Table I).

Table 1
Genetic analysis of cul4 mutant plants

Next, we examined mature siliques for the presence of aborted seeds. The number of aborted seeds was consistent with zygotic embryo lethality, where a segregation of aborted:normal seeds of 1:3 is expected (Table II; Supplementary Figure S1). To further investigate at which developmental stage embryogenesis is arrested, we analysed cleared seed specimens from siliques of selfed cul4-2 mutant plants at different developmental stages. At the octant stage, the mutant seeds exhibited a low number of large nuclei in the endosperm (Figure 3H). At later stages, embryos arrested their development at the globular stage with abnormal shapes and cell division defects in both the suspensor and the embryo proper (Figure 3J and L). Moreover, in cul4-2 homozygous mutant seeds, the endosperm was always severely underdeveloped with a dozen fewer enlarged, abnormal nuclei. When siliques were analysed at later stages, harbouring bent-cotyledon stage or mature wild-type sibling embryos, the arrested seeds had degenerated (not shown), indicating a strict arrest and not only a delay in seed development. Similar results were obtained with the cul4-3 mutant allele (Supplementary Figure S3B).

Table 2
Analysis of mature siliques

Because CUL4 interacts with DDB1 to form CRL4 E3 complexes, we also investigated whether DDB1 is required for embryogenesis. The Arabidopsis genome encodes two expressed DDB1-related proteins, named DDB1A (At4g05420) and DDB1B (At4g21100), exhibiting 89% sequence identity at the amino-acid level (Schroeder et al, 2002). DDB1A loss-of-function mutants are viable (Molinier et al, 2008). Therefore, we searched for T-DNA insertion mutants in the related DDB1B gene and identified one mutant, named ddb1b-1, from the SALK collection (SALK 061944) (Alonso et al, 2003). In the dbb1b-1 allele, the T-DNA interrupts the coding sequence in the last exon (Supplementary Figure S2B). Homozygous ddb1b-1 mutant plants developed normally and were fully fertile. To test whether DDB1A and DDB1B act redundantly during embryogenesis, the ddb1a-2 mutant was used to pollinate a homozygous ddb1b-1 mutant plant. Among the progeny of this cross, we selected F2 plants that were DDB1A/ddb1a-2 ddb1b-1/ddb1b-1 (referred as DDB1A/ddb1a ddb1b) and ddb1a-2/ddb1a-2 DDB1B/ddb1b-1 (referred as ddb1a DDB1B/ddb1b). Because both ddb1a-2 and ddb1b-1 mutants carry the same selection marker, we used PCR-based genotyping for further genetic analyses. Among the progeny of self-pollinated DDB1A/ddb1a ddb1b and ddb1a DDB1B/ddb1b plants, no double mutant were identified, despite the analysis of ~60 plants for each genotype (Table III).

Table 3
Genetic analysis of ddb1a ddb1b mutant plants

Next, we evaluated the effect of both DDB1-related genes on male and female gametophytic transmission (Table III). Reciprocal crosses between the different genotypes revealed that the two genes do not contribute equally to gametophyte development and/or function as indicated by unequal transmission defects: while in the absence of DDB1B, DDB1A is required for normal transmission through the male, the converse is true for the female gametophyte.

The number of aborted seeds was consistent with zygotic embryo lethality in self-pollinated ddb1a DDB1B/ddb1b plants (Table II). Light microscopic observations of cleared seeds revealed that double homozygous ddb1a dbb1b embryos derived from selfed DDB1A/ddb1a ddb1b (not shown) or ddb1a DDB1B/ddb1b (Supplementary Figure S3D)) mutants arrest at the globular stage, with a phenotype reminiscent of that of the cul4 mutants. Thus, both CUL4 and DDB1A/B functions are required for normal development of embryo and endosperm.

CUL4 is expressed during embryogenesis

To determine the expression pattern of CUL4 in reproductive tissues and during embryogenesis, we performed mRNA in situ hybridization experiments on sections of flower buds and developing siliques using CUL4-specific antisense and sense control probes. CUL4 transcripts were detected in the tissues of young flower buds, that is in petals, stamens, and carpels (Supplementary Figure S4A). A distinctive signal was observed in emerging ovules (Supplementary Figure S4B), but not in the developing embryo sac (Supplementary Figure S4E). After fertilization, the expression level of CUL4 was prominent in the developing embryo (Supplementary Figure S4C, D, G–L). The signal intensity decreased after the heart stage (Supplementary Figure S4I–G). This expression pattern correlates with the requirement of CUL4 for embryo development. In endosperm cells, the hybridization signal was low but detectable at all stages of seed development (Supplementary Figure S4C, D, G–L). Overall, the CUL4 expression pattern in developing seeds is consistent with the CUL4 loss-of-function phenotype.

Imprinted expression of MEA is lost in cul4 mutants

MSI1 is a component of the FIS–PRC2 complex, which is required for seed development (Köhler et al, 2003). However, MSI1 was also found in other protein complexes potentially involved in chromatin functions (Hennig et al, 2005). Thus, we wondered whether loss of CUL4 and/or DDB1 activity affects PRC2-like functions during plant reproduction. In contrast to the msi1 mutant, cul4-1 siliques did not show a clear elongation after emasculation (Supplementary Figure S5A). Nevertheless, we observed 16% (n=229) and 3.6% (n=224) of autonomous endosperm division in homozygote cul4-1 and heterozygote cul4-2 mutants, respectively (Supplementary Figure S5B). As expected, no extra divisions were observed in wild-type ovules (n=71) (Supplementary Figure S5B). Thus, although at a lower penetrance, cul4 mutants share the fis class phenotype of endosperm initiation in the absence of fertilization (Ohad et al, 1996; Chaudhury et al, 1997; Grossniklaus and Vielle-Calzada, 1998; Kiyosue et al, 1999; Köhler et al, 2003; Guitton et al, 2004). Next, we investigated whether mutations of CUL4 affect parental imprinting of MEA and/or PHE1, two genes that are regulated by the FIS–PRC2 complex (Köhler et al, 2003, 2005; Baroux et al, 2006; Gehring et al, 2006; Jullien et al, 2006). We used sequence polymorphisms between different Arabidopsis accessions to distinguish parental alleles. Interestingly, we detected paternal MEA expression in the cul4-1 mutant (Figure 4A). It is noteworthy that repression of the paternal MEA allele in the control experiment was not complete, as a weak but detectable expression was observed when Columbia (Col-0) pollen was used. Indeed, previous genetic analyses suggested that Col-0 carries a paternal modifier of mea seed abortion (Vielle-Calzada et al, 1999), and it is possible that this leads to a weak de-repression of the paternal MEA allele. However, full expression of paternal MEA allele was only observed 3 days after pollination (DAP) when cul4-1 or cul4-1 ddb1a pollen was used.

Figure 4
MEA parental imprinting is lost in cul4 mutants. (A) Parental allele-specific expression analysis of MEA in wild-type, cul4-1 and cul4-1 ddb1a-2 seeds at 3 DAP. For MEA expression, Col-0 was crossed with the RLD accession. (B) Representative confocal ...

To further investigate the loss of repression of the paternal MEA allele in the cul4-1 or cul4-1 ddb1a mutants, we introgressed the pMEA::MEA-YFP reporter gene (Wang et al, 2006a) into the cul4-1 and cul4-2 mutant backgrounds. When pMEA::MEA-YFP line in a Col-0 background was used to pollinate Col-0 plants, we observed by confocal microscopy a detectable fluorescence signal in the endosperm of about half of the seeds (Figure 4B; Table IV). This result is inconsistent with a full repression of the paternal MEA allele in the Col-0 background, but is in agreement with our results using sequence polymorphisms (see above). A similar result was observed when the cul4-1 hypomorphic mutant was used as a female and pollinated with wild-type pollen carrying the pMEA::MEA-YFP reporter. However, when we used the cul4-2 pMEA::MEA-YFP pollen to fertilize Col-0 plants, we observed a stronger fluorescence signal in some seeds (Figure 4B), supporting a reactivation of the paternal pMEA::MEA-YFP reporter gene if derived from cul4 mutant pollen.

Table 4
Paternal MEA-YFP signal detection in wild-type and cul4 mutants

To better deplete CUL4 activity in such experiments, we combined the weak cul4-1 with the strong cul4-2 alleles. When homozygous cul4-1 plants were used as a female and pollinated with pollen from cul4-2 heterozygote plants, we observed a category of seeds (~50%), which arrested at the late globular stage, thus corresponding to cul4-1/cul4-2 homozygous embryos. In these seeds, the underdeveloped endosperm contained large coenocytic cells (Supplementary Figure S6) and degenerated at 4 DAP. Interestingly, ~70% of seeds were scored for a fluorescent signal when the cul4-1 mutant was pollinated with pollen from cul4-2 pMEA::MEA-YFP plants (Table IV). The fluorescence signal was particularly strong in the aberrant endosperm of arrested cul4-1/cul4-2 seeds at 2 and 3 DAP (Figure 4B). This finding was further supported by the accumulation of paternally expressed MEA-YFP protein in this cross, as detected by western blotting (Figure 4C). Thus, our results indicate that CUL4 is necessary to maintain repression of the paternal MEA allele.

Since the PRC2 complex mediates trimethylation of histone H3 at the lysine residue 27 (H3K27me3) (Gehring et al, 2006; Jullien et al, 2006; Makarevich et al, 2006), we investigated whether CUL4 knockdown affects histone methylation. Interestingly, chromatin immunoprecipitation (ChIP) analysis performed on young siliques revealed a decrease in H3K27 trimethylation at the MEA locus (Figure 5B). It is remarkable that a similar effect was not observed when ChIP assays were performed with young floral buds (Figure 5A), suggesting that CUL4 is involved in the maintenance rather than in the establishment of those histone repressive marks.

Figure 5
CUL4 knockdown induces loss of the repressive H3K27me3 mark on both MEA and PHE1 loci in young siliques. Relative levels of histone modifications on PHE1 and MEA chromatin examined after ChIP assays using anti-H3K27me3 and anti-H3ac antibodies. Chromatin ...

In vegetative tissues, both alleles of MEA are silenced by PRC2 complexes through the deposition of H3K27me3 marks on chromatin (Gehring et al, 2006; Jullien et al, 2006). Thus, we tested whether CUL4 is also required to repress MEA later during development. Indeed, MEA expression was detected in homozygous cul4-1 knockdown plants, though to a lesser extend than in a mutant compromised in the SET-domain protein CURLY LEAF (CLF) used here as control (Supplementary Figure S7). Moreover, ChIP analysis revealed that MEA reactivation was correlated with a decrease in H3K27 trimethylation (Supplementary Figure S7C).

PHE1 3′ region maintains maternal PHE1 repression in cul4 mutants

An intriguing observation was that in contrast to MEA, we did not observe the activation of the maternal PHE1 allele in the cul4 knockdown mutant when using the different Arabidopsis accessions (Figure 6A). Nevertheless, when examining H3K27 trimethylation at the PHE1 locus (Figure 5), we observed a clear reduction in the repressive histone marks, to a similar level as at the MEA locus. Although parental imprinting of both genes requires the FIS–PRC2, it was however recently found that Polycomb-dependent silencing is necessary but not sufficient to establish PHE1 imprinting. Indeed, a distantly located region downstream of the PHE1 locus, named DMR (differentially methylated region), has also an important function in silencing the maternal PHE1 allele (Makarevich et al, 2008). Thus, it is possible that the reduction in repressive histone methylation marks seen in cul4-1 is not sufficient to impair maternal PHE1 silencing. To examine this possibility, we took advantage of the PHE1-GUS reporter construct, which contains the ~3 kbp promoter sequence but no 3′ regulatory elements (Köhler et al, 2003). The paternally derived PHE1-GUS transgene was similarly expressed in wild-type (n=55; Figure 6B) and cul4-2 heterozygote mutant seeds (n=49; Figure 6C). Expression of the maternally derived PHE1-GUS was mainly restricted to the chalazal endosperm when pollinated with wild-type pollen (Figure 6B). In contrast, 3 DAP with heterozygote cul4-2 pollen, the maternally derived PHE-GUS transgene was expressed at a higher level in about half of the seeds (56 out of 118 seeds exhibited GUS staining in the endosperm; Figure 6C). A similar result was observed with pollen from heterozygote msi1 mutant plants (78 out of 148 seeds exhibited GUS staining in the endosperm; Figure 6D). Thus, paternally expressed CUL4 and MSI1 are both required to maintain the silencing of the maternal PHE1-GUS reporter, suggesting haplo-insufficiency. It is, therefore, likely that the silencing of endogenous maternal PHE1 is maintained in cul4 mutant seeds due to additional regulatory elements, most likely located in the 3′ region of the gene (Makarevich et al, 2008).

Figure 6
Paternally expressed CUL4 and MSI1 are required to maintain maternal repression of the PHE1-GUS reporter. (A) Parental allele-specific expression analysis of PHE1 in wild-type and cul4-1 seeds at 3 DAP. For PHE1 expression, Col-0 was crossed with C24. ...

MEA transcript and protein accumulate in CUL4-deficient seeds

Next, we investigated the kinetics of both MEA transcripts and protein accumulation. The Col-0 pMEA::MEA-YFP line was self-pollinated and MEA-YFP mRNA and protein levels were determined before and during the first 3 DAP. While the MEA mRNA level gradually decreased after pollination, MEA protein quickly disappeared and was hardly detectable at 2 DAP (Figure 7A). Thus, the MEA protein level is highly dynamic and seems under both transcriptional and post-transcriptional control. Therefore, we investigated MEA-YFP protein accumulation in cul4 mutant plants. It is noteworthy that the pMEA::MEA-YFP transgene was partially silenced in the cul4-2 background. This phenomenon, at least in part, could explain the lower MEA-YFP protein content detected in the mutant (Figure 7B). Since MEA transcript levels did not decay in the cul4-2 mutant (Figure 7B), it seems that the MEA-YFP protein accumulation mainly reflects transcriptional regulation by CUL4, though a post-transcriptional regulation cannot be excluded. Nevertheless, our results clearly demonstrate that CUL4 activity is necessary to restrict MEA expression during seed development.

Figure 7
MEA expression in developing fruits of wild-type and cul4 mutant plants. (A, B) MEA-YFP mRNA and protein levels in developing fruits of self-fertilized Col-0 (A) and cul4-2 heterozygote mutant plants (B). Relative levels of total MEA (blue bars) and ...

Discussion

MSI1 is a well-characterized WD40 protein with several functions in the control of chromatin dynamics and gene expression (Hennig et al, 2005). In particular, MSI1 was identified as a subunit of the FIS–PRC2 complex (Köhler et al, 2003), which regulates parental imprinting during seed development. Here, we provide evidence that CUL4–DDB1 physically associates with MSI1 and is involved in the regulation of the FIS–PRC2 in Arabidopsis. However, because the MSI1 protein associates with additional protein complexes such as chromatin assembling factor 1 (CAF-1) and a complex with the retinoblastoma-related protein (Exner et al, 2006; Jullien et al, 2008), we do not exclude the possibility that CUL4–DDB1 acts at more than one level.

In flowering plants, imprinting has been mostly studied in the endosperm, which is a terminal tissue developing after fertilization of the central cell (reviewed in Grossniklaus, 2005; Feil and Berger, 2007; Köhler and Weinhofer-Molisch, 2010). Thus far, several genes have been found to be maternally expressed but paternally silenced including MEA, FIS2 and FWA (Vielle-Calzada et al, 1999; Kinoshita et al, 1999, 2004; Jullien et al, 2006). In particular, the paternal silencing of MEA requires the activity of the FIS–PRC2, which mediates trimethylation of histone H3 at the lysine residue 27 (H3K27me3) (Gehring et al, 2006; Jullien et al, 2006; Makarevich et al, 2006). In contrast, the MADS-box gene PHE1 is predominantly expressed from the paternal allele while the maternal allele is downregulated (Köhler et al, 2005). The maternal PHE1 allele is repressed through the combined action of the FIS–PRC2 containing MEA and the unmethylated DNA state of a DMR in the 3′ region of PHE1 (Köhler et al, 2005; Makarevich et al, 2006). In sperm cells, the DMR is most likely methylated by the maintenance DNA methyltransferase MET1, preventing silencing and leading to an active paternal PHE1 allele (Makarevich et al, 2008).

In line with a role of CUL4–DDB1 in the regulation of the FIS–PRC2 complex, we could show that reduced CUL4 activity leads to autonomous endosperm division, although at a lower penetrance than in some other fis class mutants (Ohad et al, 1996; Chaudhury et al, 1997; Köhler et al, 2003; Guitton et al, 2004). However, the percentage of seeds with a fis phenotype observed in cul4 (3.6–16%) is rather similar to that of mea mutants ranging from 3 to 20% (Grossniklaus and Vielle-Calzada, 1998; Kiyosue et al, 1999). For mea this low penetrance can be explained due to functional redundancy with its paralogue SWINGER (Wang et al, 2006a). Moreover, we showed that paternal MEA silencing was lost when CUL4 function was compromised. Consistently, H3K27me3 repressive marks were significantly reduced in the cul4-1 knockdown mutant. A similar reduction in H3K27me3 marks was also observed at the PHE1 locus, albeit this was not sufficient to abolish downregulation of the maternal PHE1 allele, most likely because of the presence of additional regulatory mechanisms depending on DNA methylation (Makarevich et al, 2008).

Several observations suggest that CUL4–DDB1 is not required for the establishment of MEA paternal silencing, but rather for its maintenance. First, we never observed paternal MEA reactivation in the pollen of cul4 knockdown or null mutants (data not shown). Second, we only visualized a strong paternal MEA expression 2–3 DAP, but not at 1 DAP. Third, ChIP experiments failed to reveal a loss of H3K27me3 marks at the MEA locus in the young floral buds, but only became evident after fertilization in young siliques. Finally, we also found that CUL4 participates in the maintenance of MEA repression at a later developmental stage (e.g. in 17-day-old plants), which depends on another form of PRC2 containing CLF as the histone methyltransferase.

Whether CUL4 and DDB1 only associate transiently or are more stable components of the FIS–PRC2 complex will need further investigations. However, it is noteworthy that MSI1 together with FIE, MEA and FIS2 were found in a very large protein complex of about 650 kDa (Köhler et al, 2003), leading the authors to speculate that other proteins associate with FIS–PRC2. Another intriguing observation is that the PRC2 core component FIE, which is also part of various other forms of PRC2 in Arabidopsis (Pien and Grossniklaus, 2007), was predicted to interact with DDB1 based on its structure (Lee et al, 2008). Thus, not only one but even two PRC2 components may recruit CUL4 to the FIS–PRC2. Moreover, because metazoan homologs of Arabidopsis MSI1-like proteins, such as the retinoblastoma-binding proteins P55 in Drosophila and RbAp48 in mammals, have structural features of typical CUL4 substrate receptors, it is probable that our findings will extend to other organisms beyond plants.

Although CUL4–DDB1 is involved in FIS–PRC2 functions, CUL4 loss-of-function mutations do not phenocopy all aspects of fis class mutants. In particular, we did not observe in cul4 mutants as strong penetrance of autonomous endosperm development as in msi1 mutants (Köhler et al, 2003; Guitton et al, 2004), nor the presence of parthenogenetic embryos (Guitton and Berger, 2005). This could be explained by at least two different features that distinguish cul4 from the fis class mutants. First, recent work suggests that Arabidopsis CUL4 is also involved in cell-cycle regulation (Marrocco et al, 2010; Roodbarkelari et al, 2010), as it has been shown in metazoans (Jin et al, 2006; Abbas et al, 2008; Havens and Walter, 2009). Thus, instead to promote cell proliferation in the endosperm as observed in the fis class mutants, the loss of CUL4 restricts cell division in this tissue counteracting its fis phenotype. Second, the cul4-1 knockdown does not affect parental imprinting of all FIS–PRC2 targets. In particular, we did not observe the de-repression of the maternal PHE1 allele, although we found a decrease in H3K27 methylation at this locus. PHE1 encodes a MADS-domain transcription factor (Köhler et al, 2003), while misexpression in fis class mutants, but not in cul4-1, could explain some phenotypic differences during seed development.

Ubiquitylation has already been linked to Polycomb-mediated repression (reviewed in Niessen et al, 2009). Indeed, the human PRC1 complex exhibits an E3 ligase activity for histone H2A (Wang et al, 2004), which is triggered by two of its subunits, RING1 and RNF2 (also referred to RING1B or RING2) (de Napoles et al, 2004; Buchwald et al, 2006). In the prevailing model, PRC1 binds to histone H3K27me3 to catalyse monoubiquitination of histone H2A, which in turn could interfere with the transcriptional machinery or chromatin remodelling proteins to repress transcription of target genes (Stock et al, 2007; Zhou et al, 2008). Moreover, it was recently shown that a tight balance between histone H2A ubiquitylation and deubiquitylation is important for Polycomb-mediated repression in Drosophila (Scheuermann et al, 2010). Arabidopsis also contains RING-domain proteins that, together with LHP1, may fulfil PRC1-like functions (Xu and Shen, 2008), most likely via histone H2A ubiquitylation (Bratzel et al, 2010).

Our finding that the CUL4–DDB1MSI1 E3 ligase is required in the maintenance of FIS–PRC2-dependent parental imprinting in Arabidopsis raises the question which substrate(s) are targeted for ubiquitylation in this process. One possibility is that CUL4–DDB1MSI1 ubiquitylates directly one of the FIS–PRC2 subunits.

We initially speculated that MSI1 could be either a substrate or a substrate receptor of this E3 ligase, or even both. Thus, we introgressed the pMSI::MSI1–RFP reporter gene (Chen et al, 2008) into the cul4-1 mutant background and checked for MSI1 protein accumulation. However, when cul4-1 pMSI::MSI1–RFP plants were self-pollinated, the MSI1–RFP protein level was only slightly higher than in a wild-type background (Supplementary Figure S8), suggesting that MSI1 protein turnover is not controlled by CUL4.

In contrast, we noticed that MEA protein does not decay after pollination in cul4 mutants. Thus, it is possible that ubiquitylation controls its stability, although we cannot exclude that this accumulation mainly results from the persistence of the MEA transcript. Nevertheless, unscheduled MEA protein accumulation may alter FIS–PRC2 activity by, for example, titering some of its components or associated proteins. This may also explain the paradox why in the presence of more MEA protein, repression of the paternal MEA allele is lost.

Finally, it is also possible that CUL4–DDB1MSI1 acts at the FIS–PRC2 level by a mechanism that does not imply protein degradation. In this respect, it is well established that CRL4 E3 ligases trigger different kinds of non-proteolytic ubiquitylation reactions, including the assembly of K63-linked polyubiquitin chains and monoubiquitylation. Thus, in the process of nucleotide excision repair after UV damage, a CUL4–DDB1DDB2 E3 ligase (DDB2 being a WD40 substrate receptor) triggers non-proteolytic ubiquitylation of XPC (xeroderma pigmentosum complementation group C) to permit its binding to damaged DNA (Sugasawa et al, 2005) where it induces histone ubiquitylation, presumably to modify the chromatin structure at the sites of DNA lesions (Kapetanaki et al, 2006; Wang et al, 2006b). Interestingly, the fission yeast Cul4 associates with Clr4 histone methyltransferase and is required for RNAi-mediated heterochromatin formation (Hong et al, 2005; Jia et al, 2005), although the CUL4-mediated modifications, which are involved in this process, remain unknown. Future investigations will identify CUL4–DDB1MSI1 E3 substrates and clarify its function(s) in PRC2-dependent epigenetic regulation.

Materials and methods

Plant material and growth conditions

The Arabidopsis ddb1a-2 mutant is described in Molinier et al (2008). The ddb1b-1 (SALK 061944) mutant was identified using the web-assisted program at http://signal.salk.edu/cgi-bin/tdnaexpress. The precise location of the T-DNA in ddb1b-1 mutant was determined by sequencing, showing an insertion after nucleotide 6211 in the last exon of DDB1B. The cul4-1 (GABI-KAT 600H03) mutant is described in Bernhardt et al (2006). The cul4-2 (Koncz 42460) and cul4-3 (Koncz 57891) mutants were identified by PCR screening of the Köln Arabidopsis T-DNA mutant collection (Ríos et al, 2002). The precise location of the T-DNA in cul4-2 and cul4-3 was determined by sequencing, showing an insertion after nucleotide 4478 in the 14th exon and after nucleotide 2718 in the 7th intron of CUL4, respectively.

For in vitro culture, seeds were surface sterilized using the ethanol method, plated on GM medium (MS salts (Duchefa, The Netherlands), 1% sucrose, 0.8% agar, pH 5.8) in the presence or absence of a selectable agent, stored 2 to 3 days at 4°C in the dark, and then transferred to a plant growth chamber under a 16-h/8-h photoperiod (22uC/20uC). For soil-cultured plants, seeds were sown (20/pot) and put at 4°C in the dark during 3 days. Two weeks later, single plants were transferred to pots in the greenhouse and kept under a regime of 16 h/8 h photoperiod (20uC/16uC; 70% humidity).

Yeast two-hybrid assays

The DDB2 and MSI1 cDNAs were cloned as fusions to the GAL4 activation domain and the DBB1A cDNA fused to the GAL4-binding domain, respectively, in Gateway-compatible pGAD424gate and pGBT9gate (Ghent plasmids collection, http://bccm.belspo.be/index.php) yeast two-hybrid vectors. The yeast strain AH109 (Clontech) was transformed with the appropriate combinations of bait and prey vectors. Transformants were selected on synthetic (SD)/-Leu/-Trp (-LW) media and interactions were tested on SD/-Leu/-Trp/-His (-LWH) or SD/-Leu/-Trp/-Ade (-LWA) media, allowing growth for 4 days at 28°C.

GST pull-down assay

The full-length DDB1A cDNA was cloned into Gateway vector pDEST15 (Invitrogen) by recombination for expression in Escherichia coli BL21AI (Invitrogen). In this construct GST is placed in frame at the N-terminus of DDB1A protein. After 4 h of 0.2% Arabinose induction at 16°C, the fusion proteins were purified on bulk gluthatione-sepharose following the manufacturer's instructions (GE Healthcare). For GST pull-down assays, DDB2 and MSI1 proteins were translated in vitro, using the TNT7-coupled wheat germ extract system (Promega) and radiolabelled with [35S]-methionine. Purified GST-DDB1A or control GST proteins, immobilized on glutathione-sepharose beads, were incubated for 2 h at 4°C with equal amounts of 35S-methionine-labelled DDB2 and MSI1 protein following the manufacturer's instructions (GE Healthcare). Labelled DDB2 and MSI1 proteins were detected by autoradiography.

Bimolecular fluorescence complementation

The DDB1A, DDB2 and MSI1 coding sequences were cloned into the split YFP destination vectors by recombination (Invitrogen) in order to obtain the YN-DDB1A, YC-DDB2 and YC-MSI1 constructs. The YN-, YC- and 35S-CPRF2-CFP vectors and split YFP experiments were performed as described in Stolpe et al (2005). Vectors bearing YN or YC either alone or fused to BPM3 (At2g39760) were used as negative controls. Images were recorded 20 h after bombardment with a Nikon fluorescent stereomicroscope E800 equipped with a 40 × water immersion optic by using CFP- and YFP-specific filters.

Immunoprecipitation experiments

Total soluble proteins were extracted from pMSI1::MSI1–RFP plants (Chen et al, 2008) using buffer A (100 mM NaHPO4 pH 8.0, 1% Triton × 100, protease inhibitor mix (Complete; Roche Molecular Biochemical)). Immunoprecipitation assay was performed using anti-CUL4 polyclonal antibody coupled to ProteinA-sepharose beads. The MSI1–RFP protein was detected using anti-DsRed antibodies (Clontech Laboratories Cat#632496) diluted 1:1000 (v:v).

Histology and microscopy

Developing seeds were prepared from siliques of different developmental stages and directly mounted on microscope slides in a clearing solution of 8:2:1 chloral hydrate:distilled water:glycerol as described in Grini et al (2002). Observations were performed with a Zeiss Axiophot or a Leica DMR microscope under differential interference contrast (DIC) × 20 and × 40 optics. For YFP marker analysis, seeds from dissected siliques at different DAP were mounted in a 1:10 glycerol:distilled water. Specimens were observed under a Zeiss confocal laser-scanning microscope. Histochemical assays to detect GUS activity were performed as described in Capron et al (2003).

In situ hybridization

In situ hybridization was performed on the 10-μm Paraplast Plus (Sigma) sections as described in Brukhin et al (2005). For probe synthesis, the fragment spanning the region of the CUL4 (At5g46210) cDNA from 1501 to 2000 (500 bp) sequence was used. The fragment was inserted into the pGemT plasmid (Promega). Sense and antisense digoxygenin-UTP-labelled riboprobes were generated by run-off transcription using T7 and Sp6 RNA polymerases, respectively. The probes were hydrolyzed into 120 bp fragments in carbonate buffer, pH=10.2 for 59 min at 60°C.

RNA extraction and RT–PCR analysis

RNAs from siliques at 3 DAP and from 17-day-old plantlets were prepared with the Trizol reagent (Invitrogen). In all, 5 μg of total RNA was treated with Dnase1 kit (Fermentas) and reverse transcribed with Superscript III Reverse Transcriptase kit (Invitrogen). To detect PHE1 and MEA mRNA, allele-specific RT–PCR was performed as described previously in Kinoshita et al (1999) and Köhler et al (2005). Primers used to amplify the control GAPDH (glyceraldehyde-3-phosphate dehydrogenase) RNA, were GAPDH3′ (5′-GTAGCCCCACTCGTTGTCGTA-3′) and GAPDH5′ (5′-AGGGTGGTGCCAAGAAGGTTG-3′). To detect DDB1B, specific primers DDB1FWD (5′GGAAAATGAACCAACTAAGGAAGG-3′) and DDB1bREV (5′AGAGCTTGGATTTGCTTCAGTG-3′) were used. To detect EF1α-specific primers EF1Fwd (5′-TTGCTCCACAGGATTGACCACTG-3′) and EF1Rev 5′-TCACTTCGCACCCTTCTTGACG-3′) were used.

Quantitative PCR

Total RNA for quantitative PCR (qPCR) was extracted from inflorescences and siliques at different DAP of pMEA::MEA-YFP plants in Col-0 and cul4-2 heterozygous mutant backgrounds, respectively, using the kit RNeasy MINI PLUS (Qiagen). In all, 2 μg of total RNA was reverse transcribed with Superscript III Reverse Transcriptase kit (Invitrogen). PCR was performed using gene-specific primers in a total volume of 10 μl SYBR Green Master mix (Roche) on a Lightcycler LC480 apparatus (Roche) according to the manufacturer's instructions.

The mean value of three replicates was normalized using the ACTIN2 (AT3G18780), GAPDH (AT3G26650) genes as internal controls.

Primer list:

MEA: GCAGGACTATGGTTTGGATG and CACCTTGAGGTAACAATGCTC

YFP: ATATCATGGCCGACAAGCA and GAACTCCAGCAGGACCATGT

ACTIN2: CTTGCACCAAGCAGCATGAA and CCGATCCAGACACTGTACTTCCTT

GAPDH: TTGGTGACAACAGGTCAAGCA and AAACTTGTCGCTCAATGCAATC

Chromatin immunoprecipitation

ChIP experiments were performed as described by Jiang et al (2008) using young flowers before fertilization and young siliques around 3 DAP as well as 17-day-old plants. A measure of 5 ml mixed tissue powder was prepared after cross-linking DNA with proteins by formaldehyde. Preparation of chromatin, sonication, and immunoprecipitation using anti-H3 (05-499; Millipore), anti-trimethyl-histone H3K27 (07-449; Millipore) and anti-acetyl-H3 (06-599; Millipore) antibodies were carried out using Millipore ChIP kit according to the manufacturer's instructions. The immunoprecipitated DNA was analysed by real-time qPCR using MEA primers (region −700–1500; Baroux et al, 2006) and PHE1 primers (Makarevich et al, 2006). FUSCA primers (Kwon et al, 2009) were used as internal standards for normalization. Data analysis was done as described in Mutskov and Felsenfeld (2004). Experiment was performed three times using independent biological samples.

Protein extraction and immunoblotting

Total proteins were extracted from Col-0 and cul4 siliques at 1, 2 and 3 DAP using denaturating buffer as described in Büche et al (2000). A measure of 40 μg of total protein extracts were separated on SDS–PAGE gels and blotted onto Immobilon-P membrane (Millipore). The MSI1–RFP protein was detected by using the anti-DsRed antibody (Clontech Laboratories Cat#632496) diluted 1:1000 (v:v), whereas the MEA-YFP protein was identified by using a Rabbit anti-GFP polyclonal antibody diluted 1:10 000 (v/v).

Supplementary Material

Supplementary Figure S1:
Supplementary Figure S2:
Supplementary Figure S3:
Supplementary Figure S4:
Supplementary Figure S5:
Supplementary Figure S6:
Supplementary Figure S7:
Supplementary Figure S8:
Supplementary Figure Legends:
Review Process File:

Acknowledgments

We acknowledge M Bureau for help with confocal imaging, C Baroux for help in analysing cul4 mutant seed defects, F Berger for providing several reporter constructs. Funding was provided by the CNRS, the French National Research Agency ANR (BLAN07-3_188961) and the EU NoE (Rubicon LSHG-CT-2005-018683). Work in UG's laboratory was supported by the University of Zürich, the Novartis Foundation and the Swiss National Science Foundation (31-112489).

Footnotes

The authors declare that they have no conflict of interest.

References

  • Abbas T, Sivaprasad U, Terai K, Amador V, Pagano M, Dutta A (2008) PCNA-dependent regulation of p21 ubiquitylation and degradation via the CRL4Cdt2 ubiquitin ligase complex. Genes Dev 22: 2496–2506 [PMC free article] [PubMed]
  • Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK, Zimmerman J, Barajas P, Cheuk R, Gadrinab C, Heller C, Jeske A, Koesema E, Meyers CC, Parker H, Prednis L, Ansari Y, Choy N, Deen H et al. (2003) Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301: 653–657 [PubMed]
  • Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J Mol Biol 215: 403–410 [PubMed]
  • Angers S, Li T, Yi X, MacCoss MJ, Moon RT, Zheng N (2006) Molecular architecture and assembly of the DDB1-CUL4A ubiquitin ligase machinery. Nature 443: 590–593 [PubMed]
  • Baroux C, Gagliardini V, Page DR, Grossniklaus U (2006) Dynamic regulatory interactions of Polycomb group genes: MEDEA auto-regulation is required for imprinted gene expression in Arabidopsis. Genes Dev 20: 1081–1086 [PMC free article] [PubMed]
  • Bernhardt A, Lechner E, Hano P, Schade V, Dieterle M, Anders M, Dubin MJ, Benvenuto G, Bowler C, Genschik P, Hellmann H (2006) CUL4 associates with DDB1 and DET1 and its downregulation affects diverse aspects of development in Arabidopsis thaliana. Plant J 47: 591–603 [PubMed]
  • Büche C, Poppe C, Schäfer E, Kretsch T (2000) eid1: a new Arabidopsis mutant hypersensitive in phytochrome A-dependent high-irradiance responses. Plant Cell 12: 547–558 [PMC free article] [PubMed]
  • Buchwald G, van der Stoop P, Weichenrieder O, Perrakis A, van Lohuizen M, Sixma TK (2006) Structure and E3-ligase activity of the ring-ring complex of Polycomb proteins Bmi1 and Ring1b. EMBO J 25: 2465–2474 [PMC free article] [PubMed]
  • Bratzel F, López-Torrejón G, Koch M, Del Pozo JC, Calonje M (2010) Keeping cell identity in Arabidopsis requires PRC1 RING-finger homologs that catalyze H2A monoubiquitination. Curr Biol 20: 1853–1859 [PubMed]
  • Brukhin V, Gheyselinck J, Gagliardini V, Genschik P, Grossniklaus U (2005) The RPN1 subunit of the 26S proteasome in Arabidopsis is essential for embryogenesis. Plant Cell 17: 2723–2737 [PMC free article] [PubMed]
  • Capron A, Serralbo O, Fülöp K, Frugier F, Parmentier Y, Dong A, Lecureuil A, Guerche P, Kondorosi E, Scheres B, Genschik P (2003) The Arabidopsis anaphase-promoting complex or cyclosome: molecular and genetic characterization of the APC2 subunit. Plant Cell 15: 2370–2382 [PMC free article] [PubMed]
  • Chaudhury AM, Ming L, Miller C, Craig S, Dennis ES, Peacock WJ (1997) Fertilization-independent seed development in Arabidopsis thaliana. Proc Natl Acad Sci USA 94: 4223–4228 [PMC free article] [PubMed]
  • Chen Z, Tan JL, Ingouff M, Sundaresan V, Berger F (2008) Chromatin Assembly Factor1 regulates the cell cycle but not cell fate during male gametogenesis in Arabidopsis thaliana. Development 135: 65–73 [PubMed]
  • Ciechanover A, Orian A, Schwartz AL (2000) Ubiquitin-mediated proteolysis: biological regulation via destruction. Bioessays 22: 442–451 [PubMed]
  • de Napoles M, Mermoud JE, Wakao R, Tang YA, Endoh M, Appanah R, Nesterova TB, Silva J, Otte AP, Vidal M, Koseki H, Brockdorff N (2004) Polycomb group proteins Ring1A/B link ubiquitylation of histone H2A to heritable gene silencing and X inactivation. Dev Cell 7: 663–676 [PubMed]
  • Edgar RC (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32: 1792–1797 [PMC free article] [PubMed]
  • Exner V, Taranto P, Schönrock N, Gruissem W, Hennig L (2006) Chromatin assembly factor CAF-1 is required for cellular differentiation during plant development. Development 133: 4163–4172 [PubMed]
  • Feil R, Berger F (2007) Convergent evolution of genomic imprinting in plants and mammals. Trends Genet 23: 192–199 [PubMed]
  • Gehring M, Huh JH, Hsieh TF, Penterman J, Choi Y, Harada JJ, Goldberg RB, Fischer RL (2006) DEMETER DNA glycosylase establishes MEDEA Polycomb gene self-imprinting by allele-specific demethylation. Cell 124: 495–506 [PMC free article] [PubMed]
  • Grini PE, Jürgens G, Hülskamp M (2002) Embryo and endosperm development is disrupted in the female gametophytic capulet mutants of Arabidopsis. Genetics 162: 1911–1925 [PMC free article] [PubMed]
  • Grossniklaus U (2005) Genomic imprinting in plants: a predominantly maternal affair. In Annual Plant Reviews: Plant Epigenetics, (Meyer P, ed), Blackwell, Sheffield, UK pp. 174–200
  • Grossniklaus U, Vielle-Calzada J-P (1998) Parental conflict and infanticide during embryogenesis. Trends Plant Sci 3: 328
  • Grossniklaus U, Vielle-Calzada J-P, Hoeppner MA, Gagliano WB (1998) Maternal control of embryogenesis by MEDEA, a Polycomb group gene in Arabidopsis. Science 280: 446–450 [PubMed]
  • Guitton AE, Page DR, Chambrier P, Lionnet C, Faure JE, Grossniklaus U, Berger F (2004) Identification of new members of FERTILISATION INDEPENDENT SEED Polycomb group pathway involved in the control of seed development in Arabidopsis thaliana. Development 131: 2971–2981 [PubMed]
  • Guitton AE, Berger F (2005) Loss of function of MULTICOPY SUPPRESSOR OF IRA1 produces nonviable parthenogenetic embryos in Arabidopsis. Curr Biol 15: 750–754 [PubMed]
  • Havens CG, Walter JC (2009) Docking of a specialized PIP Box onto chromatin-bound PCNA creates a degron for the ubiquitin ligase CRL4Cdt2. Mol Cell 35: 93–104 [PMC free article] [PubMed]
  • He YJ, McCall CM, Hu J, Zeng Y, Xiong Y (2006) DDB1 functions as a linker to recruit receptor WD40 proteins to CUL4-ROC1 ubiquitin ligases. Genes Dev 20: 2949–2954 [PMC free article] [PubMed]
  • Hennig L, Bouveret R, Gruissem W (2005) MSI1-like proteins: an escort service for chromatin assembly and remodeling complexes. Trends Cell Biol 15: 295–302 [PubMed]
  • Higa LA, Wu M, Ye T, Kobayashi R, Sun H, Zhang H (2006) CUL4-DDB1 ubiquitin ligase interacts with multiple WD40-repeat proteins and regulates histone methylation. Nat Cell Biol 8: 1277–1283 [PubMed]
  • Higa LA, Zhang H (2007) Stealing the spotlight: CUL4-DDB1 ubiquitin ligase docks WD40-repeat proteins to destroy. Cell Div 2: 5. [PMC free article] [PubMed]
  • Hong EJ, Villén J, Gerace EL, Gygi SP, Moazed D (2005) A cullin E3 ubiquitin ligase complex associates with Rik1 and the Clr4 histone H3-K9 methyltransferase and is required for RNAi-mediated heterochromatin formation. RNA Biol 2: 106–111 [PubMed]
  • Howden R, Park SK, Moore JM, Orme J, Grossniklaus U, Twell D (1998) Selection of T-DNA-tagged male and female gametophytic mutants by segregation distortion in Arabidopsis. Genetics 149: 621–631 [PMC free article] [PubMed]
  • Jia S, Kobayashi R, Grewal SI (2005) Ubiquitin ligase component Cul4 associates with Clr4 histone methyltransferase to assemble heterochromatin. Nat Cell Biol 7: 1007–1013 [PubMed]
  • Jiang D, Wang Y, Wang Y, He Y (2008) Repression of FLOWERING LOCUS C and FLOWERING LOCUS T by the Arabidopsis Polycomb repressive complex 2 components. PLoS One 3: e3404. [PMC free article] [PubMed]
  • Jin J, Arias EE, Chen J, Harper JW, Walter JC (2006) A family of diverse Cul4-Ddb1-interacting proteins includes Cdt2, which is required for S phase destruction of the replication factor Cdt1. Mol Cell 23: 709–721 [PubMed]
  • Jullien PE, Katz A, Oliva M, Ohad N, Berger F (2006) Polycomb group complexes self-regulate imprinting of the Polycomb group gene MEDEA in Arabidopsis. Curr Biol 16: 486–492 [PubMed]
  • Jullien PE, Mosquna A, Ingouff M, Sakata T, Ohad N, Berger F (2008) Retinoblastoma and its binding partner MSI1 control imprinting in Arabidopsis. PLoS Biol 6: e194. [PMC free article] [PubMed]
  • Kapetanaki MG, Guerrero-Santoro J, Bisi DC, Hsieh CL, iæ-Otrin V, Levine AS (2006) The DDB1-CUL4ADDB2 ubiquitin ligase is deficient in Xeroderma pigmentosum group E and targets histone H2A at UV-damaged DNA sites. Proc Natl Acad Sci USA 103: 2588–2593 [PMC free article] [PubMed]
  • Kinoshita T, Yadegari R, Harada JJ, Goldberg RB, Fischer RL (1999) Imprinting of the MEDEA Polycomb gene in the Arabidopsis endosperm. Plant Cell 11: 1945–1952 [PMC free article] [PubMed]
  • Kinoshita T, Miura A, Choi Y, Kinoshita Y, Cao X, Jacobsen SE, Fischer RL, Kakutani T (2004) One-way control of FWA imprinting in Arabidopsis endosperm by DNA methylation. Science 303: 521–523 [PubMed]
  • Kiyosue T, Ohad N, Yadegari R, Hannon M, Dinneny J, Wells D, Katz A, Margossian L, Harada JJ, Goldberg RB, Fischer RL (1999) Control of fertilization-independent endosperm development by the MEDEA Polycomb gene in Arabidopsis. Proc Natl Acad Sci USA 96: 4186–4191 [PMC free article] [PubMed]
  • Köhler C, Hennig L, Bouveret R, Gheyselinck J, Grossniklaus U, Gruissem W (2003) Arabidopsis MSI1 is a component of the MEA/FIE Polycomb group complex and required for seed development. EMBO J 22: 4804–4814 [PMC free article] [PubMed]
  • Köhler C, Page DR, Gagliardini V, Grossniklaus U (2005) The Arabidopsis thaliana MEDEA Polycomb group protein controls expression of PHERES1 by parental imprinting. Nat Genet 37: 28–30 [PubMed]
  • Köhler C, Weinhofer-Molisch I (2010) Mechanisms and evolution of genomic imprinting in plants. Heredity 105: 57–63 [PubMed]
  • Kwon CS, Lee D, Choi G, Chung WI (2009) Histone occupancy-dependent and -independent removal of H3K27 trimethylation at cold-responsive genes in Arabidopsis. Plant J 60: 112–121 [PubMed]
  • Lee JH, Terzaghi W, Gusmaroli G, Charron JB, Yoon HJ, Chen H, He YJ, Xiong Y, Deng XW (2008) Characterization of Arabidopsis and rice DWD proteins and their roles as substrate receptors for CUL4-RING E3 ubiquitin ligases. Plant Cell 20: 152–167 [PMC free article] [PubMed]
  • Lee J, Zhou P (2007) DCAFs, the missing link of the CUL4-DDB1 ubiquitin ligase. Mol Cell 26: 775–780 [PubMed]
  • Makarevich G, Leroy O, Akinci U, Schubert D, Clarenz O, Goodrich J, Grossniklaus U, Köhler C (2006) Different Polycomb group complexes regulate common target genes in Arabidopsis. EMBO Rep 7: 947–952 [PMC free article] [PubMed]
  • Makarevich G, Villar CB, Erilova A, Köhler C (2008) Mechanism of PHERES1 imprinting in Arabidopsis. J Cell Sci 121: 906–912 [PubMed]
  • Marrocco K, Bergdoll M, Achard P, Criqui MC, Genschik P (2010) Selective proteolysis sets the tempo of the cell cycle. Curr Opin Plant Biol 13: 631–639 [PubMed]
  • Molinier J, Lechner E, Dumbliauskas E, Genschik P (2008) Regulation and role of Arabidopsis CUL4-DDB1A-DDB2 in maintaining genome integrity upon UV stress. PLoS Genet 4: e1000093. [PMC free article] [PubMed]
  • Mutskov V, Felsenfeld G (2004) Silencing of transgene transcription precedes methylation of promoter DNA and histone H3 lysine 9. EMBO J 23: 138–149 [PMC free article] [PubMed]
  • Niessen HE, Demmers JA, Voncken JW (2009) Talking to chromatin: post-translational modulation of Polycomb group function. Epigenetics Chromatin 2: 10. [PMC free article] [PubMed]
  • Ohad N, Margossian L, Hsu YC, Williams C, Repetti P, Fischer RL (1996) A mutation that allows endosperm development without fertilization. Proc Natl Acad Sci USA 93: 5319–5324 [PMC free article] [PubMed]
  • Pien S, Grossniklaus U (2007) Polycomb and trithorax group proteins in Arabidopsis. Biochim Biophys Acta 1769: 375–382 [PubMed]
  • Ríos G, Lossow A, Hertel B, Breuer F, Schaefer S, Broich M, Kleinow T, Jásik J, Winter J, Ferrando A, Farrás R, Panicot M, Henriques R, Mariaux JB, Oberschall A, Molnár G, Berendzen K, Shukla V, Lafos M, Koncz Z et al. (2002) Rapid identification of Arabidopsis insertion mutants by non-radioactive detection of T-DNA tagged genes. Plant J 32: 243–253 [PubMed]
  • Roodbarkelari F, Bramsiepe J, Weinl C, Marquardt S, Novák B, Jakoby MJ, Lechner E, Genschik P, Schnittger A (2010) Cullin 4-ring finger-ligase plays a key role in the control of endoreplication cycles in Arabidopsis trichomes. Proc Natl Acad Sci USA 107: 15275–15280 [PMC free article] [PubMed]
  • Ruggieri R, Tanaka K, Nakafuku M, Kaziro Y, Toh-e A, Matsumoto K (1989) MSI1, a negative regulator of the RAS-cAMP pathway in Saccharomyces cerevisiae. Proc Natl Acad Sci USA 86: 8778–8782 [PMC free article] [PubMed]
  • Scheuermann JC, de Ayala Alonso AG, Oktaba K, Ly-Hartig N, McGinty RK, Fraterman S, Wilm M, Muir TW, Müller J (2010) Histone H2A deubiquitinase activity of the Polycomb repressive complex PR-DUB. Nature 465: 243–247 [PMC free article] [PubMed]
  • Schroeder DF, Gahrtz M, Maxwell BB, Cook RK, Kan JM, Alonso JM, Ecker JR, Chory J (2002) De-etiolated1 and damaged DNA binding protein1 interact to regulate Arabidopsis photomorphogenesis. Curr Biol 12: 1462–1472 [PubMed]
  • Smalle J, Vierstra RD (2004) The ubiquitin 26S proteasome proteolytic pathway. Annu Rev Plant Biol 55: 555–590 [PubMed]
  • Stock JK, Giadrossi S, Casanova M, Brookes E, Vidal M, Koseki H, Brockdorff N, Fisher AG, Pombo A (2007) Ring1-mediated ubiquitination of H2A restrains poised RNA polymerase II at bivalent genes in mouse ES cells. Nat Cell Biol 9: 1428–1435 [PubMed]
  • Stolpe T, Süsslin C, Marrocco K, Nick P, Kretsch T, Kircher S (2005) In planta analysis of protein-protein interactions related to light signaling by bimolecular fluorescence complementation. Protoplasma 226: 137–146 [PubMed]
  • Sugasawa K, Okuda Y, Saijo M, Nishi R, Matsuda N, Chu G, Mori T, Iwai S, Tanaka K, Tanaka K, Hanaoka F (2005) UV-induced ubiquitylation of XPC protein mediated by UV-DDB-ubiquitin ligase complex. Cell 121: 387–400 [PubMed]
  • Vielle-Calzada J-P, Thomas J, Spillane C, Coluccio A, Hoeppner MA, Grossniklaus U (1999) Maintenance of genomic imprinting at the Arabidopsis MEDEA locus requires zygotic DDM1 activity. Genes Dev 13: 2971–2982 [PMC free article] [PubMed]
  • Wang H, Wang L, Erdjument-Bromage H, Vidal M, Tempst P, Jones RS, Zhang Y (2004) Role of histone H2A ubiquitination in Polycomb silencing. Nature 431: 873–878 [PubMed]
  • Wang D, Tyson MD, Jackson SS, Yadegari R (2006a) Partially redundant functions of two SET-domain Polycomb group proteins in controlling initiation of seed development in Arabidopsis. Proc Natl Acad Sci USA 103: 13244–13249 [PMC free article] [PubMed]
  • Wang H, Zhai L, Xu J, Joo HY, Jackson S, Erdjument-Bromage H, Tempst P, Xiong Y, Zhang Y (2006b) Histone H3 and H4 ubiquitylation by the CUL4-DDB-ROC1 ubiquitin ligase facilitates cellular response to DNA damage. Mol Cell 22: 383–394 [PubMed]
  • Xu L, Shen WH (2008) Polycomb silencing of KNOX genes confines shoot stem cell niches in Arabidopsis. Curr Biol 18: 1966–1971 [PubMed]
  • Zhou W, Zhu P, Wang J, Pascual G, Ohgi KA, Lozach J, Glass CK, Rosenfeld MG (2008) Histone H2A monoubiquitination represses transcription by inhibiting RNA polymerase II transcriptional elongation. Mol Cell 29: 69–80 [PMC free article] [PubMed]

Articles from The EMBO Journal are provided here courtesy of The European Molecular Biology Organization
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...