• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of plosonePLoS OneView this ArticleSubmit to PLoSGet E-mail AlertsContact UsPublic Library of Science (PLoS)
PLoS One. 2010; 5(12): e15887.
Published online Dec 29, 2010. doi:  10.1371/journal.pone.0015887
PMCID: PMC3012126

Mouse Survival Motor Neuron Alleles That Mimic SMN2 Splicing and Are Inducible Rescue Embryonic Lethality Early in Development but Not Late

Brian D. McCabe, Editor

Abstract

Spinal muscular atrophy (SMA) is caused by low survival motor neuron (SMN) levels and patients represent a clinical spectrum due primarily to varying copies of the survival motor neuron-2 (SMN2) gene. Patient and animals studies show that disease severity is abrogated as SMN levels increase. Since therapies currently being pursued target the induction of SMN, it will be important to understand the dosage, timing and cellular requirements of SMN for disease etiology and potential therapeutic intervention. This requires new mouse models that can induce SMN temporally and/or spatially. Here we describe the generation of two hypomorphic Smn alleles, SmnC-T-Neo and Smn2B-Neo. These alleles mimic SMN2 exon 7 splicing, titre Smn levels and are inducible. They were specifically designed so that up to three independent lines of mice could be generated, herein we describe two. In a homozygous state each allele results in embryonic lethality. Analysis of these mutants indicates that greater than 5% of Smn protein is required for normal development. The severe hypomorphic nature of these alleles is caused by inclusion of a loxP-flanked neomycin gene selection cassette in Smn intron 7, which can be removed with Cre recombinase. In vitro and in vivo experiments demonstrate these as inducible Smn alleles. When combined with an inducible Cre mouse, embryonic lethality caused by low Smn levels can be rescued early in gestation but not late. This provides direct genetic evidence that a therapeutic window for SMN inductive therapies may exist. Importantly, these lines fill a void for inducible Smn alleles. They also provide a base from which to generate a large repertoire of SMA models of varying disease severities when combined with other Smn alleles or SMN2-containing mice.

Introduction

The survival motor neuron (SMN) gene is ubiquitously expressed and encodes an essential protein that is required by all cells [1]. Low levels of SMN cause proximal spinal muscular atrophy (SMA), an autosomal recessive disease, and a common genetic cause of infant mortality [2], [3]. It is pathologically characterized by selective loss of lower motor neurons within the spinal cord, causing progressive muscle atrophy due to denervation. Proximal muscles within the limbs and trunk are more affected than distal muscle groups, but ultimately all muscles succumb to denervation causing paralysis, respiratory deficiency and ultimately death.

Clinically, SMA is heterogeneous and has been divided into three major groups based upon age at onset and achieved motor milestones [4], [5]. Genetically SMA is homogenous in that all forms of the disease are caused by homozygous deletion, rare subtle mutations, or gene conversion of the survival motor neuron-1 (SMN1) gene with concurrent retention of a linked paralog, survival motor neuron-2 (SMN2) [2], [6], [7]. Both SMN genes reside in a duplicated genomic region at 5q13, are transcribed, translated and 99.9% identical [2], [8], [9]. The key difference is a single, translationally silent nucleotide transition (C to T) at the +6 position within exon 7 that functionally distinguishes SMN1 from SMN2 and prevents SMN2 from fully compensating for SMN1 loss [2], [9], [10]. SMN1 contains a “C” nucleotide and produces full-length SMN transcripts (FL-SMN). In contrast, SMN2 contains a “T” nucleotide and primarily produces transcripts that lack exon 7 (SMNΔ7) and a small amount of FL-Smn. This is due to the simultaneous disruption of an ASF/SF2 exon splice enhancer (ESE) and creation of an exon splice silencer (ESS) in SMN2 [11], [12].

The SMN2 copy number in an individual can vary from one to six and it is this variability that is mainly responsible for the clinical spectrum seen in SMA patients [13]. Since every SMA patient has at least one functioning SMN2 gene, it has become a target for therapeutic interventions, and most pre-clinical studies have focused on up-regulating SMN levels by some means [14], [15], [16], [17], [18], [19], [20], [21], [22], [23], [24]. An important point of all SMN-dependent therapies is an understanding of when, where and how much SMN induction is required, and how this might change for the various clinical forms of SMA. The dosage, timing and cellular requirements of SMN in different tissues should not be overlooked as there is mounting evidence in humans and mice that suggest non-motor neuron targets such as heart, autonomic and vascular systems may require consideration [25], [26], [27], [28]. Although some data is already available and demonstrates a therapeutic window of opportunity to affect a benefit for severe SMA mice [15], [17], [29], a new panel of mice is required in which SMN can be induced temporally and/or spatially to refine and extend current results.

In this study, we report the generation and characterization of two Smn progenitor alleles, SmnC-T-Neo and Smn2B-Neo. They were designed to stimulate Smn exon 7 alternative splicing, which normally does not occur in the mouse [30], [31]. SmnC-T-Neo and Smn2B-Neo are severe hypomorphs that cause embryonic lethality when in a homozygous state due to the presence of a loxP- flanked neomycin (neo) gene resistance cassette that hinders Smn expression. However, in the presence of Cre recombinase, the embryonic lethality can be rescued by neo excision, while still maintaining Smn exon 7 alternative splicing via our introduced mutations. In vitro and in vivo experiments demonstrate the utility of these mice to be used as inducible Smn alleles when combined with Cre transgenic lines. Using a tamoxifen-inducible Cre line we show that embryonic lethality can be rescued early in gestation but not late. As a final point, the SmnC-T-Neo and Smn2B-Neo lines were specifically designed to be progenitor alleles, so that potentially three useful lines of mice could be generated from each targeting event. Importantly, these lines alter the endogenous Smn locus so they mimic SMN2 exon 7 alternative splicing and the situation of SMA patients, which is reduction of Smn protein levels, not absence of protein. When used as inducible Smn alleles, they increase Smn levels under the normal regulation of the endogenous locus, while still mimicking SMN2 splicing.

Results

Generation and germline transmission of SmnC-T-Neo and Smn2B-Neo alleles

Based on our previous studies we designed two replacement vectors, p(SmnC-T-Neo) and p(Smn2B-Neo) and introduced two different mutations into the endogenous Smn locus by homologous recombination. The first mimics human SMN2 and is a C-T transition at position 6 of exon 7, referred to hereafter as the C-T mutation. The second mutation alters the central portion of the ESE where hTra2-Beta1 binds Smn exon 7 (GGA to TTT), and we refer to this mutation as the 2B mutation [32] (Figure 1A). It is known that this binding site is important for SMN exon 7 processing [33]. For both replacement vectors the positive selection cassette, pgk-neo, was inserted into the unique BamHI site ~180 bp distal to exon 7 in the antisense orientation to Smn transcription. This was specifically done as an additional way to potentially hinder Smn processing. We also flanked (“floxed”) the pgk-neo cassette with loxP sites so that it could be excised with Cre recombinase in future experiments to leave the endogenous locus with a minimal amount of alteration.

Figure 1
Generation of mutant Smn alleles.

Homologous recombinant embryonic stem cell clones were identified by Southern blot hybridization (Figure 1B) and two independent clones for each construct used to generate chimeras. Germline transmission was confirmed through direct sequencing of Smn exon 7 PCR products (Figure 1C). We refer to these progenitor lines as SmnC-T-Neo (official name Smn1tm2Cdid) and Smn2B-Neo (official name Smn1tm1Cdid) as they retain the floxed pgk-neo selection cassette within Smn intron 7. All subsequent experiments reported herein were performed after backcrossing to C57Bl/6 mice for at least three generations.

SmnC-T-Neo and Smn2B-Neo alleles express very small amounts of Smn

To evaluate the effects of C-T-Neo and 2B-Neo mutations on Smn exon 7 processing, all major organs including spinal cord and skeletal muscle from postnatal tissues of heterozygous mice were analyzed by reverse transcription-polymerase chain reaction (RT-PCR). SmnC-T-Neo/WT mice produced both FL-Smn and Δ7Smn transcripts as did Smn2B-Neo/WT mice (data not shown). We performed a series of intercrosses for each allele during the course of this study. Of 229 and 281 pups genotyped at weaning from SmnC-T-Neo/WT and Smn2B-Neo/WT intercrosses, respectively, none were found to be homozygous (Table 1). To identify when during development SmnC-T-Neo/C-T-Neo and Smn2B-Neo/2B-Neo embryos were dying, we performed a series of timed matings. For SmnC-T-Neo/WT intercrosses at 9.5 days post-coitum (E9.5), a total of 58 embryos were analyzed. While near mendelian ratios of wild type (SmnWT/WT), heterozygous (SmnC-T-Neo/WT) and homozygous mutants (SmnC-T-Neo/C-T-Neo) were identified by genotyping, developmental delays of homozygous mutant SmnC-T-Neo/C-T-Neo embryos (11/58; 19%) were visible (Table 1 and Figure 2, panels a–h). Although at E12.5 we could still detect SmnC-T-Neo/C-T-Neo embryos (5/56; 9%), it was clear that all were developmentally delayed and some were undergoing resorption (Table 1 and Figure 2, panels i–p). By E15.5 only wild type and heterozygous SmnC-T-Neo/WT embryos were present (Table 1).

Figure 2
Whole mount analysis of embryos.
Table 1
Genotype of SmnC-T-Neo and Smn2B-Neo intercross progeny.

Our results for embryo analysis from Smn2B-Neo/WT intercrosses were more dramatic. We analyzed 84 embryos at E9.5 and while we could detect Smn2B-Neo/2B-Neo homozygotes (14/84; 17%), these embryos were more developmentally delayed than the SmnC-T-Neo/C-T-Neo embryos and were starting to be reabsorbed (Table 1 and Figure 2 panels a'–h'). At E12.5 all Smn2B-Neo/2B-Neo homozygotes that we could detect were dead and at different levels of resorption (Table 1 and Figure 2, panels i'–p'). By E15.5 only wild type and heterozygous Smn2B-Neo/WT embryos were present (Table 1).

The embryonic lethality of SmnC-T-Neo/C-T-Neo and Smn2B-Neo/2B-Neo embryos occurs later than SmnΔ7/Δ7 embryos, who die at E7.5 [34], [35]. This suggested that a small amount of FL-Smn was being produced. To determine whether this was the case, we analyzed RNA from E9.5 wild type, heterozygous and homozygous SmnC-T-Neo and Smn2B-Neo embryos by RT-PCR. Both FL-Smn and Δ7Smn were produced from heterozygous and homozygous SmnC-T-Neo and Smn2B-Neo embryos in contrast to wild type Smn embryos (SmnWT) (Figure 3A). Furthermore, the SmnC-T-Neo allele consistently produced more transcripts that contained Smn exon 7 than the Smn2B-Neo allele. Direct sequencing of the FL-Smn amplicon from SmnC-T-Neo/C-T-Neo embryos identified only the mutant “T” nucleotide at position +6 of Smn exon 7, as would be expected from homozygous mutant embryos (Figure 3B). Likewise, FL-Smn amplicons from Smn2B-Neo/2B-Neo embryos only expressed the 2B (TTT) mutation (data not shown).

Figure 3
Smn transcript analysis analysis of E9.5 embryos.

To quantify the amount of FL-Smn and Δ7Smn transcripts that were produced in each of the genotypes from our intercross experiments, we designed two novel taqman assays for use in quantitative reverse transcription PCR (qRT-PCR). The first assay specifically detected Smn exon 7 in the presence of either the wild type, C-T or 2B mutation with similar efficiency. The second assay detected Δ7Smn transcripts. The values of FL-Smn from our SmnC-T-Neo and Smn2B-Neo genotypes were compared to the expression of SmnWT E9.5 embryos derived from the same intercross to reduce variability. Overall, the amount of FL-Smn varied with our different genotypes (Figure 3C and Table 2). SmnC-T-Neo/C-T-Neo embryos produced 20±5% FL-Smn, whereas Smn2B-Neo/2B-Neo embryos produced 15±3% and these values were not statistically significant from each other (p = 0.43). This indicated that each SmnC-T-Neo and the Smn2B-Neo allele produced ~10% and ~7.5% FL-Smn transcripts, respectively. These results are consistent with SmnC-T-Neo/WT (62±12%) and Smn2B-Neo/WT (59±7%) embryos, if you consider that ~50% of FL-Smn transcripts are derived from the SmnWT allele (Figure 3C and Table 2).

Table 2
qRT-PCR analysis of E9.5 Smn embryos.

We also quantified the amount of Δ7Smn from our SmnC-T-Neo and Smn2B-Neo genotypes by comparing them to Δ7Smn transcripts derived from spinal cord samples of SmnΔ7/WT mice [34]. Smn2B-Neo/2B-Neoembryos expressed the greatest amount of Δ7Smn transcripts, whereas the SmnC-T-Neo/WT embryos expressed the least (Figure 3A and 3C). Using this data in conjunction with our FL-Smn data we were able to generate a FL-Smn: Δ7Smn ratio for each genotype using the ΔΔCt values. The ratio for SmnΔ7/WT mice was approximately equal to 1.0 (1.022±0.018) and served as a control. The wild type allele (WT) only produces transcripts that contain Smn exon 7, whereas the SmnΔ7 allele only produces transcripts that lack exon 7 due to the absence of the exon in the genome of this allele [34]. In comparison, SmnC-T-Neo/WT mice produced about 12-fold more (11.98±0.929) FL-Smn than Δ7Smn transcripts. However, in homozygous embryos (SmnC-T-Neo/C-T-Neo) the ratio was almost equal to 1.0 (0.989±0.068) and this is consistent with the visual inspection of end-point RT-PCR (Figure 3A). Interestingly, we found the FL-Smn: Δ7Smn ratio to be 10-fold less in Smn2B-Neo/2B-Neo embryos (0.178±0.022) as compared to SmnC-T-Neo/C-T-Neo embryos even though the amount of FL-Smn produced from either the SmnC-T-Neo or Smn2B-Neo allele was not significantly different (p = 0.43). The change in ratio is due to the high levels of Δ7Smn transcripts that Smn2B-Neo/2B-Neo embryos produced and is consistent with the splicing pattern and transcript ratios of SMN2 where the majority of SMN2 transcripts lack exon 7.

To correlate FL-Smn transcripts to Smn protein we performed western blot analysis of single E9.5 embryos for each possible genotype. We had difficulty detecting Smn in homozygous mutant embryos, and the level varied between mutants of the same genotype (Figure 3D). In general, the level of Smn correlated with the severity of the mutant embryo when we retrospectively compared Smn levels to our whole mount mutant embryo images (Figure 3D and Figure 2). The level of Smn protein in SmnC-T-Neo/C-T-Neo embryos ranged from 2–5% and in Smn2B-Neo/2B-Neo embryos it was about 1–3%. This was an unexpected finding based on our FL-Smn expression data from SmnC-T-Neo/C-T-Neo and Smn2B-Neo/2B-Neo embryos and was most likely caused by the compromised physiological state of the SMA embryos, a lack of stability of higher order Smn complexes from low Smn levels and transcriptional and/or translational hindrance from the floxed pgk-neo cassette. Since the later was the only one that we could directly test, we removed the floxed pgk-neo cassette from the germline using homozygous EIIa-Cre transgenic mice that ubiquitously express Cre recombinase very early in embryogenesis [36]. This increased Smn protein levels from <5% for homozygous SmnC-T-Neo and Smn2B-Neo embryos to >30% for a single SmnC-T allele and ~16% for a single Smn2B allele (data not shown and will be reported elsewhere). Collectively, these results confirm that our SmnC-T-Neo and Smn2B-Neo alleles are severe hypomorphs. They express very low amounts of Smn due to the nature of our introduced mutations as well as the presence of a floxed pgk-neo selection cassette that hinders Smn expression. These alleles are “repairable” and have the potential to be used as inducible Smn alleles that mimic SMN2 splicing. To determine this directly, the following in vitro and in vivo experiments were designed to address the ability of SmnC-T-Neo and Smn2B-Neo alleles to be utilized as inducible Smn alleles by excision of the floxed pgk-neo cassette.

Induction of Smn expression in vitro

We determined the ability of our progenitor alleles to induce Smn levels through excision of the floxed pgk-neo cassette in vitro using primary murine embryonic fibroblasts (MEFs). For these experiments, we used our SmnC-T-Neo allele in combination with a tamoxifen (TM) inducible Cre allele, CreEsr1[37]. We established and cultured MEF lines from two SmnC-T-Neo/WT;CreEsr1 embryos and compared untreated MEF cultures to those treated with TM. Excision of floxed pgk-neo by CreEsr1 was monitored at the DNA level by three primer PCR analysis (Figure 4A). The reaction amplified all three possible Smn alleles: WT (470 bp), C-T-Neo (500 bp) and C-T (577 bp) (Figure 5B). MEFs treated with TM demonstrated excision of the floxed pgk-neo cassette from the SmnC-T-Neo allele (Figure 4B, lanes 4 and 5). A low level of excision was also noted in cells without TM treatment; we attributed this to the previously reported <0.1% spontaneous Cre activity that was reported for this line [37] (Figure 4B, lanes 2 and 3). We then correlated pgk-neo excision with an increase in FL-Smn expression by directly sequencing RT-PCR products from treated and untreated MEFs. A clearly discernable “T” nucleotide was present in those cells treated with TM and absent in the untreated cultures indicating an increase of Smn expression specifically from our mutant allele (Figure 4C). This was substantiated and quantified by qRT-PCR analysis which showed an 83% increase in FL-Smn transcripts and a 30% reduction in Δ7Smn transcripts between treated and untreated cultures (Figure 4D). Therefore, addition of tamoxifen to cultures of SmnC-T-Neo/WT;CreEsr1 MEFs increased FL-Smn expression through excision of the floxed pgk-neo cassette in Smn intron 7 and demonstrates the inducible nature of these alleles in vitro.

Figure 4
Smn expression is efficiently induced from the SmnC-T-Neo allele in vitro.
Figure 5
Smn induction in adults and embryos from a single injection of tamoxifen.

The ability of our Smn alleles to be Cre responsive in post natal somatic tissues was determined by single intraperitoneal (i.p.) injections [9 mg/40 g body weight] of TM or vehicle (corn oil) to 2–4 month old SmnC-T-Neo/WT;CreEsr1 mice. They were euthanized five days post-injection and DNA from kidney, spinal cord, skeletal muscle, forebrain and cerebellum were used as template in PCR to determine floxed pgk-neo excision. Vehicle injected SmnC-T-Neo/WT;CreEsr1 mice had a low level of DNA excision consistent with background levels of CreEsr1 (Figure 5A, lane 2). SmnC-T-Neo/WT mice without CreEsr1 showed no excision of the floxed pgk-neo cassette (Figure 5A, lane 3). In contrast, excision occurred in all tissues examined from SmnC-T-Neo/WT;CreEsr1 mice after a single i.p. injection (Figure 5A, lane 4), hence somatically changing the SmnC-T-Neo allele to a SmnC-T allele.

Induction of Smn in SmnC-T-Neo/C-T-Neo;CreEsr1 embryos early, but not late, rescues embryonic lethality

The early lethality of SmnC-T-Neo/C-T-Neo embryos was determined to be caused by low Smn levels, thus we next sought to determine when during development, if at all, we could increase Smn levels and rescue the embryonic lethality phenotype. To this end we crossed SmnC-T-Neo/WT females to SmnC-T-Neo/WT;CreEsr1 males in order to produce SmnC-T-Neo/C-T-Neo;CreEsr1 embryos. Without TM treatment these embryos should undergo complete resorption between E12.5 and E15.5 (Figure 2 and Table 1). Pregnant females were injected with TM [3 mg/40 g body weight] at either E7.5 or E13.5. Only two litters (9 pups total) survived birthing from 7 dams injected at E7.5 and visibly pregnant at late gestation. Of these 9 pups, 1 was a SmnC-T-Neo/C-T-Neo;CreEsr1 pup and of similar size and appearance to its littermates. However, in both litters the dams failed to lactate and fostering was unsuccessful. Birthing and lactation problems are a known common side effect of TM administration, especially when given early during pregnancy [37]. To avert this problem we harvested embryos at E18.5, a late point in gestation, and well after a stage in development (E15.5) in which no viable homozygous SmnC-T-Neo/C-T-Neo embryos had previously been identified (Table 1). DNA prepared from yolk sacs or tails was used for PCR-based genotyping with the same 3-plex PCR assay used in Figures 4 and and5A.5A. This allowed us to identify and determine the efficiency of the floxed pgk-neo cassette excision. The presence or absence of the CreEsr1 transgene was determined in a separate reaction. In all embryos that carried both the SmnC-T-Neo allele and CreEsr1 transgene, the injection of TM induced excision of floxed pgk-neo, thus somatically changing the SmnC-T-Neo allele to a SmnC-T allele (Figure 5B, lanes 5-9). Smn induction of 4 litters at E7.5 resulted in a total of 32 embryos at E18.5 and five were found to be SmnC-T-Neo/C-T-Neo;CreEsr1 embryos (Table 3). All five of these embryos were viable, of similar size and indistinguishable from control embryos (Figure 5C). In contrast, TM injection of 6 litters at E13.5 resulted in no viable SmnC-T-Neo/C-T-Neo;CreEsr1 embryos at E18.5 (0/42) (Table 3). However, in each of these crosses we did identify a SmnC-T-Neo/C-T-Neo embryo that was negative for the CreEsr1 transgene although both were severely deformed, nonviable and undergoing resorption (Figure 5C). Chi-square statistics were used to compare the genetic ratios of induced embryos to expected normal mendelian ratios with the assumption that SmnC-T-Neo/C-T-Neo embryos would not be present at E18.5. Genotype ratios from embryos treated at E13.5 were not statistically significant from expected ratios, p = 0.84. However, the genotype ratios of embryos treated at E7.5 were significant, p = 0.05 (Table 3). Thus, increasing Smn levels rescues the embryonic lethality phenotype of SmnC-T-Neo/C-T-Neo;CreEsr1 embryos when induced early, but not late in development.

Table 3
Genotypes of Smn embryos at E18.5 exposed to tamoxifen at E7.5 or E13.5.

To quantify the level of Smn in these SmnC-T-Neo/C-T-Neo;CreEsr1 embryos, we performed western blot analysis and compared them to a series of control, age-matched embryos that titred Smn levels between 100% and 50%. In addition, we were able to extract a small amount of protein from one of the non-viable SmnC-T-Neo/C-T-Neo embryos for comparison to our induced embryos (Figure 5D). However, without Cre mediated excision of the floxed pgk-neo cassette, Smn levels in this embryo were below the limit of detection even though the loading control, β–tubulin was visualized (Figure 5D). Densitometry was performed on a separate western blot using the same samples for the other genotypes (Figure 5C). The excision of the floxed pgk-neo cassette in SmnC-T-Neo/C-T-Neo;CreEsr1 +TM embryos increased Smn protein levels to 70% of wild type expression (Figure 5D). This is greater than the 50% of Smn protein detected in heterozygous Smn null (SmnWT/-) embryos which develop normally and have a normal postnatal lifespan (Figure 5D) [1]. Furthermore, this is greater than the level of Smn expressed in our SmnC-T-Neo and Smn2B-Neo progenitor lines of mice that have a normal lifespan and are without phenotype.

Discussion

We specifically designed the targeting vectors used in this study to have a triple function so that a series of Smn alleles could be generated. The first was the introduction of mutations within known Smn exon 7 ESEs to mimic SMN2 exon 7 splicing and attenuate Smn expression. The second was the placement of the positive selection cassette within intron 7 with the aim of further diminishing the amount of Smn generated from these targeted alleles. It has previously been shown that selection cassettes located within introns or regulatory regions, such as pgk-neo that we used here, can hinder expression of targeted genes via transcriptional and/or translation interference either by design ([38]; additional examples cited in [39]) or inadvertently [40], [41], [42], which sometimes proves to be serendipitous [42]. The level of interference can be varied depending upon the orientation of the selection cassette if it has cryptic splice donor and acceptor sites, like the neo gene, [39] or they can be engineered. Here we used pgk-neo in the inverted orientation to Smn transcription as the cryptic splice sites were stronger. The third and final function of our design was to flank pgk-neo with loxP sites so that it could be removed with Cre recombinase. This allows the specific analysis of our introduced mutations within the context of a minimally altered genomic locus. Since the neo cassette hindered Smn expression as we designed, our alleles can be used to induce Smn expression while still mimicking SMN2 exon 7 alternative splicing. The conceptual properties of this targeting design are applicable to almost any gene targeting strategy and warrant consideration for those embarking on new projects.

Our allelic targeting strategy provides the opportunity to generate three mouse lines from each single allele. The first is the original progenitor alleles, SmnC-T-Neo and Smn2B-Neo. The second is these alleles in combination with a tissue specific or inducible Cre transgene for future time and cell-specific induction experiments. Finally, mouse lines possessing the point mutations themselves, SmnC-T and Smn2B, can be produced. Here we have focused on characterizing the first two lines of mice.

Mice heterozygous for the SmnC-T-Neo and Smn2B-Neo alleles were normal. When homozygous, these alleles caused embryonic lethality, even though full-length transcripts and small amounts of Smn protein could be detected. This result illustrates once again that a minimum amount of Smn is required by all cell types [1], [34], [35], [43], [44], and this appears to be about 5% during development in mice. Although we found no significant difference in mendelian ratios of homozygous mutants for either allele at E9.5, morphologically it was clear that the embryos were dead or extremely growth retarded and their ability to develop corresponded to their Smn levels. Embryonic lethality during this period of development is commonly caused by potential failures in gastrulation, defects in extra embryonic membrane functions such as vasculogenesis or hematopoiesis and/or cardiovascular failure [45]. Considering these possibilities, we were able to visualize swollen pericardial sacs in several of our SmnC-T-Neo/C-TNeo homozygous mutants at E11.5 (data not shown) or E12.5 that were not grossly deformed.

Functionally and molecularly the homozygous SmnC-T-Neo/C-T-Neo and Smn2B-Neo/2B-Neo hypomorphs are less severe than SmnΔ7/Δ7 homozygotes as they express small amounts of fully functional Smn protein and live slightly longer (E12 and E9 vs E7) [34], [35]. The SmnC-T-Neo/C-T-Neo homozygotes are generally less severe than the Smn2B-Neo/2B-Neo homozygotes due to the nature of the introduced mutations within exon 7 since the C-T mutation produces more FL-Smn transcripts than the 2B mutation. During the course of our molecular analyses there were two unexpected observations. First, we found that Δ7Smn transcripts from Smn2B-Neo/2B-Neo embryos were extremely high (12.44±3.44) vs. heterozygous Smn2B-Neo embryos (1.72±0.23). This may seem odd at first glance, but SMN together with other proteins functions in the assembly of small nuclear ribonucleoproteins (snRNPs), which are critical for pre-mRNA splicing [46], [47]. It has previously been demonstrated that low levels of SMN cause changes in snRNP abundance and splicing alterations [48], [49], [50], so it is possible that SMN regulates its own splicing of SMN2 exon 7. In fact, Jodelka et al. (2010) [51] has recently identified a feedback loop in which low SMN levels exacerbate SMN2 exon 7 skipping. This result helps explain the high degree of Δ7Smn transcripts from our Smn2B-Neo/2B-Neo embryos since they produce only 1-3% Smn protein. The second observation was the low amount of Smn protein (<5%) as compared to FL-Smn transcripts (10-20%) in our homozygous embryos. We predict this is caused by a combination of the degenerative state of the embryos, lack of higher order Smn complexes that can stabilize the protein, and the presence of the floxed pgk-neo cassette (as we designed), which creates hybrid Smn/neo transcripts and exerts transcriptional and translational repression. We show that removal of the pgk-neo cassette is able to relieve this repression.

As progress in developing SMN-dependent therapies moves forward, our understanding of when and where SMN is required for severe, intermediate and mild forms of SMA becomes important. This can be addressed using animal models since they can be genetically manipulated. SMA has already been modeled in a number of different organisms and each has its strengths [52], [53], but the most widely used to date have been SMA mouse models. The mouse models fall into two categories:1) transgenics bred onto Smn null or Δ7 backgrounds to rescue the embryonic lethality of homozygous Smn mutants to produce varying degrees of SMA severity, and 2) modifications of the endogenous Smn locus that reduce Smn expression. One conditional allele of Smn has been generated, a floxed allele of Smn exon 7, which can be combined with varying Cre transgenes for the temporal or spatial depletion of Smn. Although this is a very useful allele and conditional depletion experiments have been done [34], [43], [44], SMA is due to a paucity of Smn protein not complete absence of Smn protein. Currently lacking, and which we begin to fulfill here, is a panel of different Smn inducible alleles that can be used in future experiments to address the cellular and temporal requirements of Smn induction in varying SMA disease severities.

To validate the potential of SmnC-T-Neo and Smn2B-Neo to be utilized as inducible alleles, we used SmnC-T-Neo as a proof of concept allele. Using Smn C-T-Neo in combination with a tamoxifen inducible Cre transgenic mouse, CreEsr1, we derived primary MEF lines and proved that only in the presence of tamoxifen was Smn induced. This illustrates the efficacy of Smn induction in vitro and the potential of using these lines to establish Smn inducible culture models. In addition, a single i.p. injection of tamoxifen was able to excise the floxed pgk-neo cassette in somatic tissues of adult mice and embryos. Hence, the alleles can be used in future somatic experiments to assist in determining the cellular requirements of Smn. This can be achieved through genetic crosses of tissue-specific Cre lines or as shown here, through injections if the Cre lines are tamoxifen inducible. In addition, if the Smn C-T-Neo and/or Smn2B-Neo is used as the Smn mutant background in combination with SMN2 transgenic mice to achieve postnatal survival, new SMA models can potentially be generated with varying degrees of severity. Thus, the timing requirements of Smn inductive therapies could be addressed postnatally in severe, intermediate and mild forms of SMA. We are currently working to develop these models and determine this.

In a final experiment, we addressed whether the embryonic lethality of SmnC-T-Neo/C-T-Neo embryos could be rescued. We found that we could, if induction occurred early, around gastrulation (E7.5), but not late (E13.5), and the mutant embryos that were induced at E7.5 expressed ~70% Smn protein. This level of Smn protein is well above that of Smn+/− mice that have a normal lifespan [1] or heterozygous SMA model mice [(SMN2)Ahmb89+/+;Smn+/−; Jax strain 5024], which have no motor neuron loss and a normal lifespan [54]. At this point our work is unable to address the dosage and timing of Smn expression necessary to alleviate postnatal SMA disease, which is the time period when all, but the very most severely affected, SMA patients present with symptoms. However our results are important as they are consistent with the few pharmacological or gene therapy studies where a therapeutic window of opportunity to demonstrate a survival or functional benefit exists in severe SMA [15], [17], [29]. We all show that the earlier the intervention, the better the outcome. The mounting results of these types of studies are important points of consideration as clinical trials based on SMN-inductive therapies are designed, especially for the most severe SMA patients. It will be important for future studies to add and extend this work. For example, a paramount point is whether SMN inductive therapies can provide benefit during the lag/plateau phase of disease or prevent further deterioration of function from the point of treatment. We believe that the alleles we have generated here will be useful in developing the appropriate models to answer this question.

In conclusion, the gene targeting strategy that we utilized is applicable to almost all gene targeting projects. The strategy provides the potential to generate multiple lines of mice, including an inducible allele, from a single targeting event for the cost of extra effort put into the planning stage of vector design. As proof, we generated an allelic series of Smn mice. They produce small amounts of Smn, mimic SMN2 splicing and are inducible. While these are the first inducible Smn alleles to be described in the literature, other groups are also working to generate inducible Smn mice using different strategies such as Tet-on/off systems or other Cre-inducible alleles. As proven with the various transgenic models of SMA, all will play important and complimentary roles as we move forward to understand Smn function in health and disease, and progress towards developing a therapy for SMA.

Materials and Methods

Ethics Statement

All studies performed on mice were in accordance with the Institutional Animal Care and Use Committee regulations in place at Children's Memorial Research Center and specifically approved under protocols 2007-15, 2006-22 and 2008-03.

Construction of targeting vectors and generation of Chimeras

The replacement vectors, p(SmnC-T-Neo) and p(Smn2B-Neo) are shown schematically in Figure 1A. The total length of homology between the targeting vector and the endogenous Smn locus is 6.5 kb; the long arm is 5.0 kb and the short arm is 1.5 kb. The positive selection cassette, flox-pgk-neo was inserted into the unique BamHI site 180 bp distal to exon 7. This was done to increase the chance of homologous recombinant clones containing the C-T transition in exon 7 or the 2B mutation (GGA-TTT) in exon 7, since recombination is unlikely to occur within such a short distance between our modification and the positive selection cassette. The mutations were introduced via site directed mutagenesis of a smaller fragment and then re-subcloned into the targeting construct to avoid potential mutations generated by PCR. In total, after Cre excision of the pgk-neo cassette, ~90 bp will remain, of which, 34 bases correspond to the remaining loxP site. The 90 bp of sequence is located sufficiently distal to exon 7 and should not affect regulation or processing of the SmnC-T-Neo and Smn2B-Neo transcripts. The targeting constructs were electroporated into 129 ES cells and 4 independent homologous recombinant clones for each construct were identified. Two from each construct were used to generate chimeras by microinjecting ES cells into C57Bl/6 blastocysts.

Mice and Animal Care

Animals were kept in a controlled vivarium at 25°C and 50% humidity in a 12 hour light/12 hour dark photoperiod and monitored for health. Colonies were maintained by breeding mice heterozygous for the Smn mutant alleles. The official name for SmnC-T-Neo/+ mice is Smntm2Cdid. It is being placed at The Jackson laboratory in both C57BL/6 and FVB/N genetic backgrounds but currently lacks official strain designation. The official name of the Smn2B-Neo/+ mice is Smntm1Cdid and it is also being placed at The Jackson Laboratory in both C57BL/6 (Jax strain 008838) and FVB/N (JAX 008837) genetic backgrounds. The lines will be made available once they are on congenic C57Bl/6 and FVB/N genetic backgrounds.

Genotyping reactions

All PCR and RT-PCR experiments were performed on an Eppendorf Mastercycler®. SmnC-T-Neo/+ and Smn2B-Neo/+ adults (Table 1) were genotyped using forward primer #638 (5′-AATGTG TGC GAGGCCAGAGG-3′) found within the PGK promoter and reverse primer #637 (5′-TTTGGCAGACTT TAGCAGGGC-3′) within intron 7 multiplexed with an internal control set of primers that amplified Smn exon 4 using primers #379 (5′- AGGCGT TGAATGACATTCTC) and #380 (5′-GCCATACAAAGTGTTCACAC). Reaction conditions: 94°C/45 sec, 60°C/45 sec, 72°C/45 sec, 35 cycles. C-T-Neo or 2B-Neo alleles produced a 519 bp amplicon and the internal control amplified a 697 bp product. PCR products were resolved on a 1.5% agarose gel.

SmnC-T-Neo and Smn2B-Neo allelic embryos (Table 1) were genotyped using a three primer PCR reaction. The primers include Smn intron 6 forward, #721 (5′-TATCACTAAGTTGGGCGA AAG GG-3′), Smn intron 7 reverse, #636 (5′-TTTGGCAGACTT TAGCAGGGC-3′), and PGK promoter reverse primer #638 (5′-AATGTGTGCGAGGCCAGAGG-3′). Reaction conditions: 94°C/45 sec, 64°C/45 sec, 72°C/1 min, 35 cycles. The product sizes for the C-T-Neo and 2B-Neo alleles are 519 bp and 700 bp for the WT allele.

Analysis of pgk-neo excision was performed on MEF colonies, induced adults and embryos using a 3- primer PCR reaction with primers #638, intron 6 forward primer # 640, (5′- AACTCCGGGTCCTCCTTCCT) and #637 to amplify SmnWT (470 bp), SmnC-T-Neo (500 bp), and SmnCT (577 bp) alleles. Cre amplification utilized forward primer #162 (5′-CGCCGCATAACC AGTGAAAC-3′) and reverse primer #163 (5′-ATGTCCAATTTACTGACCG-3′) to amplify a 335 bp fragment.

Smn exon 7 was amplified for direct sequencing using primers forward intron 6 primer #58 (5′-CCTCCTTCCTCCTCATCTCAG-3′) and reverse intron 7 primer #62 (5′- AATTATACAAAAGGTAAAATTAGC) under standard cycling conditions. PCR products were purified with Montage PCR clean up column (Millipore) and sequenced using intron 6 primer #59 (5′-TCCAGCCGGGCTTGAATT).

RNA Transcript Analysis

RNA was extracted from tissues using TRIzol reagent (Invitrogen) in accordance with the manufacturer's directions. Samples were then treated with TURBO DNA-free reagents (Ambion) and first strand cDNA was prepared using SuperScript™ II Reverse Transcriptase (Invitrogen) and random hexamer primers (Roche, Nutley, NJ) according to the manufacturer.

The RT-PCR reaction to amplify both full length Smn and Δ7Smn mRNA used primers 455 and 495. All reactions used 100 ng cDNA in a mix of 10X buffer (20 mM Tris-HCl (pH 8.4), 50 mM KCl), 200 µM dNTP mix, 3 mM MgCl2, 7.5pM primers, and 1U taq polymerase. RT-PCR conditions were as follows: 94°C/45 sec, 60°C/45 sec, 72°C/45 sec, 30 cycles. RT-PCR reaction used to identify the full length products of homozygous mutant embryos (Fig. 3A) was performed using an exon 5 forward primer #741 (5′- TCCCTTCAGGACCACCAATA) and an exon 8 reverse primer #495. Reaction conditions were: 94°C/45 sec, 60°C/45 sec, 72°C/45 sec, 35 cycles. FL-Smn transcripts from MEFs that were used as a template in sequencing were amplified using primers #741 and# 495. Δ7Smn transcripts were amplified using exon 5-6 forward primer #490 (5′-CTTCAGGACCACCAATAA TC) and exon 6-8 reverse primer, #500 (5′-GACAGAGCTGAACAATAT). Both were sequenced with primer #490.

qRT-PCR was performed on cDNA prepared as described above. All reactions were performed in triplicate in a 20 ul final reaction volume. Since the assay on demand primer and probe available from ABI for Smn exon 7 are too close or overlap the C-T and 2B mutations and could hinder interpretation of results, we designed and validated FL-Smn and Δ7Smn assays to specifically amplify Smn transcripts with similar efficiencies between the WT, C-T and 2B mutations and not cross react with human SMN. Once validated these assays were prepared by ABI in a 20X mastermix to be similar to an assay on demand. FL-Smn was amplified and detected with primer #ABI-1, Smn678F (5′-TGGCTACCACACTGGCTACTATATG), primer #ABI-2, Smn678R (5′- GACACCCCATCTCCTGAGACA) and probe ABI-3, Smn678M1 (6FAM-CATACAAATTAAGAAGTTCAGC). Δ7Smn transcripts were amplified and detected with primer #ABI-4, Smn_EX6_8F (5′- GGCAGTATGCTAATCTCTTGGTACA), primer #ABI-5, Smn_EX6_8R (5′- CGACACCCCATCTCCTGAGA) and probe #ABI-6, Smn_EX6_8M1 (5′- 6FAM-CAGAGCTGAACCATATAGTAGC). mGapdh On Demand Assay (Applied Biosystems) was used as an internal control for normalizing data. All qRT-PCR reactions were run using an Applied Biosytems 7500 Fast Real-Time PCR System utilizing the following conditions: 1 cycle: 2 min 50°C, 1 cycle: 10 min 95°C, 40 cycles: 15 sec 95°C, 1 min 60°C. All data was analyzed using the ΔΔCt method.

Protein isolation, western blot and densitometry

Tissues and embryos were homogenized as previously described [55]. Primary antibodies used were mouse monoclonal antibodies to Smn (BD Translabs) at 1[ratio]5,000 and β-tubulin at 1[ratio]20,000. Polyclonal rabbit actin at 1[ratio]1,000. The secondary antibody, goat anti-mouse (BioRad) or goat anti-rabbi (BioRad) were used at 1[ratio]10,000. Membranes were exposed to chemiluminescence (ECL Western Blotting Detection Reagents, Amersham Biosciences) and developed on Kodak film. Blots were imported into Adobe Photoshop using Microtek 1000XL scanner and quantified through densitometry by Openlab 5.0 software. The Li-Cor Odyssey System was used to quantify embryo extracts in Figure 3 according to the instructions of the manufacturer (Li-Cor Biosciences). Briefly, proteins were resolved on a 4–12% Bis Tris NuPage pre-cast gel system using MES running buffer and transferred to nitrocellulose using the I-Blot transfer system (Invitrogen). Bound antibodies were detected using IRDye800CW-conjugated goat anti-mouse IgG (Li-Cor). The intensity of each band was measured and normalized to that obtained from Tubulin.

Whole Mount Embryo Images

Pregnant female mice were sacrificed by CO2 asphyxiation followed with cervical dislocation. Embryos at either E9.5, E12.5 or E18.5 were captured on a Leica upright dissecting microscope and digital camera at 2.0X, 1.0X, and 0.8X magnifications respectively. Embryos at E11.5 were captured at 1.0X. Photographs were taken at a 300dpi, 8 bit/channel quality.

pgk-neo excision by TM in MEFs

Pregnant females were sacrificed with CO2 asphyxiation at 14.5 days post coitum (dpc). Embryos were individually eviscerated and rinsed in 1X PBS for MEF preparation. Yolk sac was collected for DNA to identify SmnC-T-Neo/+;CreEsr1 embryos. Embryos were finely minced with a straight edge razor and incubated in trypsin at 37°C. Debris were removed by resuspending cells in 15cc tube containing cell growing media (Earle's alpha-MEM, 10% FBS, 1% pen/strep, 1% non-essential amino acids, 1% L-glutamine) and allowing large debris to collect at the bottom. The supernatant was plated and cells were passaged 4 times before those with the genotype SmnC-T-Neo/+;CreEsr1 were used for experiments. TM (1 mM) was added to cultures for 1 hr to induce CRE activity. Control cells received no TM. After 24 hours cells were harvested for DNA and RNA as previously described for tissue samples.

pgk-neo excision by TM in adult and embryonic mice

Injection of TM to both adult and embryo used here, were carried out as previously described [37]. TM was diluted to 10 mg/ml in corn oil. Adults were injected with 9 mg TM/40 g body weight and sacrificed five days later. Tissues harvested included spinal cord, skeletal muscle (gastrocnemius and quadriceps), cortex, cerebellum, heart and kidney. Both DNA and RNA were extracted as previously described. For embryonic induction, pregnant females were injected at 7.5 dpc or 13.5 dpc with 3 mg TM/40 g of body weight. At 18.5 dpc, females were sacrificed with CO2 asphyxiation and embryos dissected individually. From each embryo the lung was harvested for DNA and the remainder flash frozen in liquid nitrogen and stored at −80°C.

Acknowledgments

We would like to thank members of the laboratory for helpful discussions of this research and critically reading this manuscript.

Footnotes

Competing Interests: The authors have declared that no competing interests exist.

Funding: The work was funded by the National Institutes of Health [1RO1NS060926 and 1R21HD058311] to CJD, the Canadian Institutes of Health Research (CIHR) to RK and the Families of Spinal Muscular Atrophy to CJD. RK is a recipient of a University Health Research Chair from the University of Ottawa. RG is supported by a NIH training grant [T32 AG000260] “Drug Discovery Training in Age-related Disorders.” The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1. Schrank B, Gotz R, Gunnersen JM, Ure JM, Toyka KV, et al. Inactivation of the survival motor neuron gene, a candidate gene for human spinal muscular atrophy, leads to massive cell death in early mouse embryos. Proc Natl Acad Sci U S A. 1997;94:9920–9925. [PMC free article] [PubMed]
2. Lefebvre S, Burglen L, Reboullet S, Clermont O, Burlet P, et al. Identification and characterization of a spinal muscular atrophy- determining gene. Cell. 1995;80:155–165. [PubMed]
3. Roberts DF, Chavez J, Court SD. The genetic component in child mortality. Arch Dis Child. 1970;45:33–38. [PMC free article] [PubMed]
4. Munsat TL, Davies KE. International SMA consortium meeting. (26–28 June 1992, Bonn, Germany). Neuromuscul Disord. 1992;2:423–428. [PubMed]
5. Wang CH, Finkel RS, Bertini ES, Schroth M, Simonds A, et al. Consensus statement for standard of care in spinal muscular atrophy. J Child Neurol. 2007;22:1027–1049. [PubMed]
6. Wirth B. An update of the mutation spectrum of the survival motor neuron gene (SMN1) in autosomal recessive spinal muscular atrophy (SMA). Hum Mutat. 2000;15:228–237. [PubMed]
7. Alias L, Bernal S, Fuentes-Prior P, Barcelo MJ, Also E, et al. Mutation update of spinal muscular atrophy in Spain: molecular characterization of 745 unrelated patients and identification of four novel mutations in the SMN1 gene. Hum Genet. 2009;125:29–39. [PubMed]
8. Gennarelli M, Lucarelli M, Capon F, Pizzuti A, Merlini L, et al. Survival motor neuron gene transcript analysis in muscles from spinal muscular atrophy patients. Biochem Biophys Res Commun. 1995;213:342–348. [PubMed]
9. Monani UR, Lorson CL, Parsons DW, Prior TW, Androphy EJ, et al. A single nucleotide difference that alters splicing patterns distinguishes the SMA gene SMN1 from the copy gene SMN2. Hum Mol Genet. 1999;8:1177–1183. [PubMed]
10. Lorson CL, Hahnen E, Androphy EJ, Wirth B. A single nucleotide in the SMN gene regulates splicing and is responsible for spinal muscular atrophy. Proc Natl Acad Sci U S A. 1999;96:6307–6311. [PMC free article] [PubMed]
11. Cartegni L, Krainer AR. Disruption of an SF2/ASF-dependent exonic splicing enhancer in SMN2 causes spinal muscular atrophy in the absence of SMN1. Nat Genet. 2002;30:377–384. [PubMed]
12. Kashima T, Manley JL. A negative element in SMN2 exon 7 inhibits splicing in spinal muscular atrophy. Nat Genet. 2003;34:460–463. [PubMed]
13. Feldkotter M, Schwarzer V, Wirth R, Wienker TF, Wirth B. Quantitative analyses of SMN1 and SMN2 based on real-time lightCycler PCR: fast and highly reliable carrier testing and prediction of severity of spinal muscular atrophy. Am J Hum Genet. 2002;70:358–368. [PMC free article] [PubMed]
14. Avila AM, Burnett BG, Taye AA, Gabanella F, Knight MA, et al. Trichostatin A increases SMN expression and survival in a mouse model of spinal muscular atrophy. J Clin Invest. 2007;117:659–671. [PMC free article] [PubMed]
15. Butchbach ME, Singh J, Thorsteinsdottir M, Saieva L, Slominski E, et al. Effects of 2,4-diaminoquinazoline derivatives on SMN expression and phenotype in a mouse model for spinal muscular atrophy. Hum Mol Genet. 2010;19:454–467. [PMC free article] [PubMed]
16. Coady TH, Shababi M, Tullis GE, Lorson CL. Restoration of SMN function: delivery of a trans-splicing RNA re-directs SMN2 pre-mRNA splicing. Mol Ther. 2007;15:1471–1478. [PubMed]
17. Foust KD, Wang X, McGovern VL, Braun L, Bevan AK, et al. Rescue of the spinal muscular atrophy phenotype in a mouse model by early postnatal delivery of SMN. Nat Biotechnol. 2010;28:271–274. [PMC free article] [PubMed]
18. Hastings ML, Berniac J, Liu YH, Abato P, Jodelka FM, et al. Tetracyclines that promote SMN2 exon 7 splicing as therapeutics for spinal muscular atrophy. Sci Transl Med. 2009;1:5ra12. [PMC free article] [PubMed]
19. Hua Y, Sahashi K, Hung G, Rigo F, Passini MA, et al. Antisense correction of SMN2 splicing in the CNS rescues necrosis in a type III SMA mouse model. Genes Dev. 2010;24:1634–1644. [PMC free article] [PubMed]
20. Meyer K, Marquis J, Trub J, Nlend Nlend R, Verp S, et al. Rescue of a severe mouse model for spinal muscular atrophy by U7 snRNA-mediated splicing modulation. Hum Mol Genet. 2009;18:546–555. [PubMed]
21. Passini MA, Bu J, Roskelley EM, Richards AM, Sardi SP, et al. CNS-targeted gene therapy improves survival and motor function in a mouse model of spinal muscular atrophy. J Clin Invest. 2010;120:1253–1264. [PMC free article] [PubMed]
22. Riessland M, Ackermann B, Forster A, Jakubik M, Hauke J, et al. SAHA ameliorates the SMA phenotype in two mouse models for spinal muscular atrophy. Hum Mol Genet. 2010;19:1492–1506. [PubMed]
23. Singh NK, Singh NN, Androphy EJ, Singh RN. Splicing of a critical exon of human Survival Motor Neuron is regulated by a unique silencer element located in the last intron. Mol Cell Biol. 2006;26:1333–1346. [PMC free article] [PubMed]
24. Skordis LA, Dunckley MG, Yue B, Eperon IC, Muntoni F. Bifunctional antisense oligonucleotides provide a trans-acting splicing enhancer that stimulates SMN2 gene expression in patient fibroblasts. Proc Natl Acad Sci U S A. 2003;100:4114–4119. [PMC free article] [PubMed]
25. Araujo Ade Q, Araujo M, Swoboda KJ. Vascular perfusion abnormalities in infants with spinal muscular atrophy. J Pediatr. 2009;155:292–294. [PMC free article] [PubMed]
26. Bevan AK, Hutchinson KR, Foust KD, Braun L, McGovern VL, et al. Early heart failure in the SMN{Delta}7 model of spinal muscular atrophy and correction by postnatal scAAV9-SMN delivery. Hum Mol Genet. 2010;19:3895–905. [PMC free article] [PubMed]
27. Heier CR, Satta R, Lutz C, DiDonato CJ. Arrhythmia and cardiac defects are a feature of spinal muscular atrophy model mice. Hum Mol Genet. 2010;19:3906–18. [PMC free article] [PubMed]
28. Shababi M, Habibi J, Yang HT, Vale SM, Sewell WA, et al. Cardiac defects contribute to the pathology of spinal muscular atrophy models. Hum Mol Genet. 2010;19:4059–4071. [PubMed]
29. Narver HL, Kong L, Burnett BG, Choe DW, Bosch-Marce M, et al. Sustained improvement of spinal muscular atrophy mice treated with trichostatin A plus nutrition. Ann Neurol. 2008;64:465–470. [PubMed]
30. DiDonato CJ, Chen XN, Noya D, Korenberg JR, Nadeau JH, et al. Cloning, characterization, and copy number of the murine survival motor neuron gene: homolog of the spinal muscular atrophy-determining gene. Genome Res. 1997;7:339–352. [PubMed]
31. Viollet L, Bertrandy S, Bueno Brunialti AL, Lefebvre S, Burlet P, et al. cDNA isolation, expression, and chromosomal localization of the mouse survival motor neuron gene (Smn). Genomics. 1997;40:185–188. [PubMed]
32. DiDonato CJ, Lorson CL, De Repentigny Y, Simard L, Chartrand C, et al. Regulation of murine survival motor neuron (Smn) protein levels by modifying Smn exon 7 splicing. Hum Mol Genet. 2001;10:2727–2736. [PubMed]
33. Hofmann Y, Lorson CL, Stamm S, Androphy EJ, Wirth B. Htra2-beta 1 stimulates an exonic splicing enhancer and can restore full-length SMN expression to survival motor neuron 2 (SMN2). Proc Natl Acad Sci U S A. 2000;97:9618–9623. [PMC free article] [PubMed]
34. Frugier T, Tiziano FD, Cifuentes-Diaz C, Miniou P, Roblot N, et al. Nuclear targeting defect of SMN lacking the C-terminus in a mouse model of spinal muscular atrophy. Hum Mol Genet. 2000;9:849–858. [PubMed]
35. Hsieh-Li HM, Chang JG, Jong YJ, Wu MH, Wang NM, et al. A mouse model for spinal muscular atrophy. Nat Genet. 2000;24:66–70. [PubMed]
36. Lakso M, Pichel JG, Gorman JR, Sauer B, Okamoto Y, et al. Efficient in vivo manipulation of mouse genomic sequences at the zygote stage. Proc Natl Acad Sci U S A. 1996;93:5860–5865. [PMC free article] [PubMed]
37. Hayashi S, McMahon AP. Efficient recombination in diverse tissues by a tamoxifen-inducible form of Cre: a tool for temporally regulated gene activation/inactivation in the mouse. Dev Biol. 2002;244:305–318. [PubMed]
38. Voronina VA, Kozlov S, Mathers PH, Lewandoski M. Conditional alleles for activation and inactivation of the mouse Rx homeobox gene. Genesis. 2005;41:160–164. [PubMed]
39. Lewandoski M. Conditional control of gene expression in the mouse. Nat Rev Genet. 2001;2:743–755. [PubMed]
40. Garcia P, Berlanga O, Watson R, Frampton J. Generation of a conditional allele of the B-myb gene. Genesis. 2005;43:189–195. [PubMed]
41. Levin SI, Meisler MH. Floxed allele for conditional inactivation of the voltage-gated sodium channel Scn8a (NaV1.6). Genesis. 2004;39:234–239. [PubMed]
42. Raffai RL, Weisgraber KH. Hypomorphic apolipoprotein E mice: a new model of conditional gene repair to examine apolipoprotein E-mediated metabolism. J Biol Chem. 2002;277:11064–11068. [PubMed]
43. Cifuentes-Diaz C, Frugier T, Tiziano FD, Lacene E, Roblot N, et al. Deletion of murine SMN exon 7 directed to skeletal muscle leads to severe muscular dystrophy. J Cell Biol. 2001;152:1107–1114. [PMC free article] [PubMed]
44. Vitte JM, Davoult B, Roblot N, Mayer M, Joshi V, et al. Deletion of murine Smn exon 7 directed to liver leads to severe defect of liver development associated with iron overload. Am J Pathol. 2004;165:1731–1741. [PMC free article] [PubMed]
45. Papaioannou VE, Behringer R. x, 235. N.Y.: Cold Spring Harbor Laboratory Press; 2005. Mouse phenotypes: a handbook of mutation analysis. Cold Spring Harbor,
46. Meister G, Buhler D, Pillai R, Lottspeich F, Fischer U. A multiprotein complex mediates the ATP-dependent assembly of spliceosomal U snRNPs. Nat Cell Biol. 2001;3:945–949. [PubMed]
47. Pellizzoni L, Yong J, Dreyfuss G. Essential role for the SMN complex in the specificity of snRNP assembly. Science. 2002;298:1775–1779. [PubMed]
48. Baumer D, Lee S, Nicholson G, Davies JL, Parkinson NJ, et al. Alternative splicing events are a late feature of pathology in a mouse model of spinal muscular atrophy. PLoS Genet. 2009;5:e1000773. [PMC free article] [PubMed]
49. Gabanella F, Butchbach ME, Saieva L, Carissimi C, Burghes AH, et al. Ribonucleoprotein assembly defects correlate with spinal muscular atrophy severity and preferentially affect a subset of spliceosomal snRNPs. PLoS One. 2007;2:e921. [PMC free article] [PubMed]
50. Zhang Z, Lotti F, Dittmar K, Younis I, Wan L, et al. SMN deficiency causes tissue-specific perturbations in the repertoire of snRNAs and widespread defects in splicing. Cell. 2008;133:585–600. [PMC free article] [PubMed]
51. Jodelka FM, Ebert AD, Duelli DM, Hastings ML. A feedback loop regulates splicing of the spinal muscular atrophy-modifying gene, SMN2. Hum Mol Genet. 2010;19:4906–17. [PMC free article] [PubMed]
52. Schmid A, DiDonato CJ. Animal models of spinal muscular atrophy. J Child Neurol. 2007;22:1004–1012. [PubMed]
53. Burghes AH, Beattie CE. Spinal muscular atrophy: why do low levels of survival motor neuron protein make motor neurons sick? Nat Rev Neurosci. 2009;10:597–609. [PMC free article] [PubMed]
54. Monani UR, Sendtner M, Coovert DD, Parsons DW, Andreassi C, et al. The human centromeric survival motor neuron gene (SMN2) rescues embryonic lethality in Smn(-/-) mice and results in a mouse with spinal muscular atrophy. Hum Mol Genet. 2000;9:333–339. [PubMed]
55. Heier CR, DiDonato CJ. Translational readthrough by the aminoglycoside genetecin (G418) modulates SMN stability in vitro and improves motor function in SMA mice in vivo. Hum Mol Genet. 2009 [PMC free article] [PubMed]

Articles from PLoS ONE are provided here courtesy of Public Library of Science
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links