• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of mendArchiveHomepageTES HomepageSubscriptionsSubmissionAbout
Mol Endocrinol. Aug 2010; 24(8): 1512–1528.
Published online Jun 23, 2010. doi:  10.1210/me.2009-0320
PMCID: PMC2940468

A Novel Isoform of Microphthalmia-Associated Transcription Factor Inhibits IL-8 Gene Expression in Human Cervical Stromal Cells

Abstract

Cervical ripening during pregnancy is a profound change in cervix structure and function characterized by increases in the proinflammatory cytokine IL-8 and dissolution of the cervical extracellular matrix. Relatively little is known about the molecular mechanisms that underlie these events. Here, we report identification of a novel isoform of micropthalmia-associated transcription factor in human cervical stromal cells (MiTF-CX) that is down-regulated 12-fold during cervical ripening and that represses expression of IL-8. Ectopic expression of MiTF-CX in human cervical stromal cells resulted in substantial suppression of endogenous IL-8 mRNA and protein expression, whereas expression of dominant negative MiTF-CX mutants with impaired DNA binding resulted in dramatic increases in IL-8 production. Gel shift, reporter gene, and chromatin immunoprecipitation assays revealed one strong binding site (E-box -397 CACATG-391) in the human IL-8 promoter that was crucial for mediating transcriptional repression by MiTF-CX. Moreover, we show that MiTF-CX expression in the cervix was itself positively autoregulated via two E-box motifs within a 2.1-kb promoter fragment. We therefore propose that maintenance of cervical competency during pregnancy is an active process maintained through suppression of IL-8 by the transcription factor MiTF-CX. During cervical ripening, loss of MiTF-CX would result in significant up-regulation of IL-8 mRNA and protein synthesis, thereby leading to recruitment and activation of leukocytes within the cervix and dissolution of the extracellular matrix.

During normal pregnancy, the cervix undergoes dramatic alterations in structure and function. Although cervical softening occurs early in pregnancy (1), the cervix remains relatively rigid during gestation (2). The cervix shortens and undergoes a significant remodeling process (termed cervical ripening) several weeks before the onset of uterine contractions of term (3,4,5) or preterm labor (6). The dilation phase of cervical ripening involves complete dissolution of the extracellular matrix (ECM) and dramatic increases in infiltrating neutrophils. The cervix returns to a rigid organ of dense ECM during the postpartum time period.

The process of cervical ripening and dilation, both preterm and term, is characterized by phenotypic alterations in fibroblast cells to activated myofibroblasts (7,8), increased production of inflammatory mediators such as IL-1 (9), TNF-α (10), IL-8 (11,12,13), and PGE2 (13,14), and increased production of matrix proteases (15). The relative importance and temporal relationship between these events and cervical ripening and dilation is not understood. It is well documented, however, that the neutrophil chemoattractant, IL-8, plays a major role during cervical ripening and dilation (11,12,13). IL-8 is produced by numerous cell types in the cervix including endocervical epithelial cells (16,17), cervical stromal fibroblasts (16,18), macrophages (19), and leukocytes (19). Of these, cervical stromal cells are believed to initiate IL-8 production (20), which is then augmented through recruitment of numerous immune cells that, in turn, synthesize IL-8 and IL-8 receptors in response to activation by IL-8 (21,22,23). The cellular mechanisms that initiate increased production of IL-8 in the cervix before delivery are not understood. Further, the cellular mechanisms that maintain a structurally competent cervix despite progressive increases in gravitational forces on the cervix during pregnancy are not well defined.

Here, we identified the transcription factor microphthalmia-associated transcription factor (MiTF) as being differentially expressed between cervical stroma from women at term with an unripe cervix and women at term with cervical dilation and effacement in labor. MiTF, a DNA-binding, basic helix-loop-helix (bHLH) zipper protein closely related to transcription factor TFE3, TFEB, and TFEC (24,25,26), is a highly specialized transcription factor that plays an essential role in the development of certain cell types such as melanocytes and retinal pigmented epithelial cells, and cells of the myeloid lineage (mast cells and osteoclasts). The genomic organization of the MiTF gene allows generation of multiple mRNA (and resulting protein) isoforms due to the presence of first exon-specific promoters that permit highly regulated and restricted expression of each isoform within particular cell types (27). Thus far, four isoforms of MiTF have been identified in humans: MiTF-M (melanocyte), MiTF-H (heart), MiTF-A, and MiTF-C. In addition, two mast cell isoforms [MiTF-E (28) and MiTF-MC (29)] and a truncated isoform MiTF-B (30) have been described in mice. All MiTF isoforms share important functional domains of the protein (the transactivation domain, basic domain, helix-loop-helix, and leucine zipper). The bHLH domain allows both the formation of protein dimers, sequence-specific DNA recognition, and binding to E-box motifs (general sequence CANNTG) (31,32).

In this investigation, we identify a novel, cervical stromal cell-specific isoform of MiTF, designated “MiTF-CX” that is created by differential promoter usage within the MiTF gene. MiTF-CX is highly expressed in the cervix during pregnancy and is down-regulated 12-fold in the ripened cervix at the end of gestation. Importantly, we show that MiTF-CX is a cell type-specific physiological repressor of IL-8 expression in cervical stromal cells that acts via a cognate binding site within the human IL-8 promoter. These results suggest that MiTF-CX plays a crucial role in regulating cervical competency and remodeling during pregnancy by regulating expression of a key proinflammatory cytokine in the cervix.

Results

Identification of a unique isoform of MiTF in the human cervix: MiTF-CX

By microarray analysis the transcription factor MiTF was identified as a transcript down-regulated in the cervix during labor. To define MiTF isoforms expressed in the human cervix, 5′-RACE (rapid amplification of cDNA ends) experiments were conducted with poly A+ RNA from cervical stroma from women with an unripe cervix (not in labor). Of 103 clones, MiTF-A represented 23%. Thirty percent were distributed between MiTF-C (12%) (33), a clone homologous to mouse isoform 1E (10%) (28), and truncated MiTF-B (i.e. containing exon 1b upstream of exon 2 but without an additional 5′-exon, 8%). Interestingly, an isoform of human MiTF that contained exon 1b and a unique 5′-terminus of 266 nucleotides was identified in 47% of clones from 5′-RACE experiments (Fig. 11).). The genomic locus for MiTF and this unique isoform is illustrated in Fig. 11.. The novel isoform, termed “MiTF-CX”, encodes a unique 13-amino acid amino terminus followed by a common amino acid sequence present in other MiTF isoforms except MiTF-M (i.e. exon 1b).

Figure 1
A novel isoform of MiTF in human cervical stroma. Panel A, Organization of the MiTF gene locus is depicted to demonstrate arrangement of isoform-specific exons on chromosome 3p. Experiments using 5′-RACE and an antisense primer located in exon ...

MiTF-CX expression is unique to the female reproductive tract

Using conventional, semiquantitative RT-PCR and isoform-specific primers, expression of MiTF isoforms was evaluated in various human tissues, MEL cells, and an osteoblast cell line (Fig. 1B1B).). MiTF-A and -H mRNAs were detected in all tissues and cells, although the amplification product for MiTF-H was more abundant in fetal heart. Amplification of an isoform homologous to the published mast cell isoform 1E (28) was relatively weak, except in vaginal muscularis, a tissue enriched in mast cells. MiTF-C was expressed only in vagina, myometrium, and cervix, and MiTF-M was limited to melanoma cells (Fig. 11).). MiTF-CX was expressed in the female reproductive tract, but absent in fetal heart and spleen, osteoblast cells, and MEL cells (Fig. 1C1C).). With the same approaches, in separate experiments MiTF-CX mRNA was not detected in tissues of the male reproductive tract (data not shown). These results indicate that a subset of known MiTF mRNA isoforms is expressed in the female reproductive tract and establish MiTF-CX as a novel MiTF mRNA isoform unique to the female reproductive tract.

Differential regulation of MiTF-CX in cervix and myometrium during pregnancy and parturition

To determine whether MiTF expression changed during cervical remodeling during pregnancy, we used isoform-specific quantitative RT-PCR and cRNA standards of each isoform to evaluate expression of MiTF-A, -C, -H, and -CX mRNAs in cervical stromal tissues obtained from pregnant women with an unripe cervix before labor and those after the onset of labor. Relative levels of MiTF-H mRNA were similar in the cervix before and after labor (0.76 ± 0.22 compared with 0.30 ± 0.08 relative units; P = 0.17). In contrast, the other three isoforms were decreased significantly in cervical stroma from women in labor (IL) relative to stroma from women before labor (NIL; Fig. 2A2A).). MiTF-A was decreased 2-fold in labor and was the most abundant isoform expressed in the pregnant cervix. MiTF-C was much less abundant than MiTF-A and decreased almost to the limit of detection in labor. In contrast, MiTF-CX expression was comparable to MiTF-A before labor and decreased dramatically (12-fold) in cervical stroma during labor (Fig. 2A2A).). Thus, MiTF-CX mRNA is decreased dramatically and disproportionately in the cervix in labor relative to MiTF-A, -C, or -H. In the myometrium, although MiTF-A and -C mRNA also decreased significantly in labor, expression of MiTF-CX was not altered (Fig. 2B2B).

Figure 2
Expression of MiTF in cervical stromal and myometrial tissues from pregnant women before or after labor. Quantitative PCR with isoform-specific primers and standard curves for each isoform were used to compare expression of MiTF in cervical and myometrial ...

Localization of MiTF in myometrium and cervix

A monoclonal antibody that recognizes the basic domain common to all MiTF isoforms was used to identify cell types that express MiTF in myometrium and cervix from pregnant women by immunohistochemistry (Fig. 33).). In cervical stroma from pregnant women in early gestation (11–28 wk), cervical fibroblasts were densely arranged in a compact ECM. Nuclear staining for MiTF was abundant in both stromal and smooth muscle cells of the cervix (Fig. 33,, A and B). At term, before the onset of cervical ripening, MiTF staining remained strong and was localized to the nucleus of both stromal fibroblasts and smooth muscle cells (Fig. 3B3B).). Immunoreactive staining was absent in vascular smooth muscle cells, epithelial cells of the endocervix, and endothelial cells. In tissues obtained after the onset of labor, immunostaining was weak in cervical stromal cells, and the subcellular localization of the remaining MiTF was redistributed to the cytoplasm (Fig. 3C3C).). Immunostaining in smooth muscle cells remained in the nucleus. In myometrium, nuclear staining for MiTF was also localized to nonvascular myometrial smooth muscle cells and stromal cells dispersed between myometrial bundles (Fig. 3D3D).). MiTF immunostaining intensity was not appreciably different in myometrial tissues obtained from pregnant women in labor compared with that in myometrium from women before cervical ripening except MiTF staining in the stromal cells suspended in the matrix between myometrial bundles was reduced in intensity and redistributed to the cytoplasm (Fig. 3E3E).). Therefore, there is cell-type specific and differential expression of MiTF protein abundance within the cervix that changes with cervical ripening. The decrease of MiTF protein detected in cervical stromal cells during ripening best corresponds with the profound decrease in MiTF-CX mRNA expression and is consistent with MiTF-CX being the major protein isoform expressed in unripe cervical stromal cells.

Figure 3
Localization of MiTF in uterine tissues of pregnant women. Nuclear immunostaining of MiTF in cervical stromal cells in tissues obtained in early gestation (A) and term pregnancy before cervical ripening (B). Intensity of staining was decreased in tissues ...

Transcriptional targets of MiTF-CX in cervical stromal cells

To understand the physiological function of MiTF-CX in cervical stromal cells, we explored the hypothesis that MiTF controlled expression of genes differentially regulated in cervical stromal tissues before and after cervical ripening. Based on the idea that MiTF is best known to be a transcriptional activator (34), we first screened 43 genes up-regulated in the cervical stroma before ripening for E-box motifs (consensus DNA-binding sequences for the MiTF family) in the upstream promoter regions and found four potential MiTF targets. To determine whether MiTF-CX regulated expression of these genes, cervical stromal cells were infected with MiTF-CX-expressing or control adenovirus; viral titers were adjusted to obtain mRNA levels that were within 2- to 5-fold those found in cervical stromal tissues from pregnant women. (This strategy was taken because endogenous MiTF expression was lost in cervical stromal cells in culture.) After 48 h, expression of the candidate targets ECM protein-2 (Ecm2), matrilin-2 (Matn2), a hypothetical protein encoded on chromosome 10 (AI381790) and cathepsin K (Ctk), a known target for MiTF and TFE3 in osteoclasts (35) was determined by quantitative RT-PCR. With the exception of Ctk, transcripts for these genes were not altered by MiTF-CX. Cathepsin K mRNA was increased approximately 2-fold, and cathepsin K promoter activity was increased 2-fold by MiTF-CX (data not shown). Because cathepsin K is a potent collagenase with modestly decreased mRNA levels in the ripened cervix (rather than the expected up-regulation), it is unlikely that regulation of this transcript by MiTF represented a major physiological function of MiTF in cervical stroma cells in vivo.

The failure to demonstrate a significant relationship between MiTF-CX and other genes down-regulated in cervix during labor led us to evaluate whether MiTF-CX could be a transcriptional repressor, and whether one of the most up-regulated genes in the ripened cervix, IL-8, could be a target. Endogenous IL-8 mRNA and protein levels were decreased substantially in human cervical stromal cells expressing MiTF-CX (Fig. 4A4A).). The amino terminus of MiTF-CX was not crucial for this effect because MiTF-M also inhibited IL-8 production in a similar manner (data not shown). To further determine the specificity and mechanism of action of the inhibitory effect of MiTF-CX on IL-8 expression, a mutated form of MiTF-CX (MiTF-CXmi) that contains a deleted arginine in the basic domain was created. Prior studies suggested that this mutation in the context of the melanocyte isoform of MiTF impairs the nuclear localization and DNA-binding activities of MiTF (36). It has been proposed that the mi mutated protein leads to cellular defects by anchoring MiTF heterodimerization partners in the cytoplasm (37,38). Immunocytochemistry to localize MiTF-CX and MiTF-CXmi in cervical stromal cells confirmed that this mutation altered localization of MiTF-CX in human embryonic kidney (HEK)293 and cervical stromal cells (Fig. 5B5B).). Whereas MiTF-CX was localized in the nucleus of transfected cells, MiTF-CXmi was distributed predominantly in the cytoplasm (Fig. 4B4B).). Notably, adenoviral expression (Ad-) of MiTF-CXmi in cervical stromal cells resulted in significant up-regulation of endogenous IL-8 mRNA (Fig. 5A5A).). Coinfection with Ad-MiTF-CX abolished MiTF-CXmi-induced up-regulation of IL-8 (Fig. 4A4A).). These data are consistent with MiTF-CXmi acting as a dominant-negative inhibitor of endogenous MiTF and/or TFE3.

Figure 4
Effect of MiTF on IL-8 in human cervical stromal cells. A, IL-8 mRNA and secreted protein were quantified in cells treated with control (CTL), MiTF-CX, mutant MiTF-CX (MiTFmi), or MiTF-CX + MiTFmi adenovirus. *, P ≤ 0.01 compared ...
Figure 5
Effect of TFE3 on IL-8 gene expression. A, Cervical stromal cells were treated with control (CTL), MiTF-CX, TFE3, or MiTF-CXmi in the presence or absence of wild-type MiTF-CX or TFE3. After 48 h, cells were analyzed for IL-8 mRNA. Data represent mean ...

To investigate this phenomenon further, stromal cells were infected with increasing titers of Ad-MiTF-CXmi [from 2.5 × 107 to 108 plaque-forming units (pfu)] with or without wild-type Ad-MiTF-CX (from 107 to 108 pfu). Total viral titer was constant by balancing the multiplicity of infection with control virus. After 48 h, IL-8 mRNA levels were quantified (Fig. 4C4C).). Ad-MiTF-CXmi increased IL-8 expression in a dose-dependent manner. Coinfection with wild-type Ad-MiTF-CX, even in small amounts, abolished the stimulatory effect of exogenous MiTF-CXmi on IL-8 gene expression (Fig. 4C4C).). In contrast with cervical stromal cells, infection of HEK293 cells with virus containing the mutant MiTF-CXmi did not increase IL-8 mRNA, and wild-type MiTF-CX did not inhibit IL-8 gene expression in these cells (Fig. 4C4C).). Hence, the effect of MiTF-CX on IL-8 gene expression appears to be cell specific. Cytosolic and nuclear extracts of cells infected with control virus, MiTF-CX, MiTF-CXmi-expressing viruses, or both were analyzed by immunoblot analysis using antibodies that recognize the basic domain of MiTF. Immunoreactivity was absent in cervical stromal cells in culture treated with control virus. A 69-kDa immunoreactive protein was restricted to nuclear extracts in cells infected witih Ad-MiTF-CX cells whereas immunoreactive protein was present in both nuclear and cytosolic extracts from cells infected with Ad-MiTF-CXmi. Interestingly, coexpression of wild-type MiTF-CX relocalized MiTF-CX to the nucleus with little residual cytosolic MiTF (Fig. 4D4D).

Although MiTF often mediates gene transcription through homodimerization, heterodimerization of MiTF may occur with three other related family members. The finding that MiTF-CXmi induced increases in IL-8 production in cervical cells with little or no endogenous MiTF-CX suggested that other MiTF family members may also inhibit IL-8 gene expression but that this inhibition may be impaired by MiTF-CXmi. Quantitative RT-PCR for other members of the MiTF family revealed that TFE3 (but not TFEB, TFEC, or USF2) was expressed in cervical stromal cells in culture and in cervical stromal tissues from pregnant women (data not shown). To test the hypothesis that TFE3 may be involved in MiTF-CXmi-induced increases in IL-8 gene expression, cervical stromal cells were infected with control, MiTF-CX, TFE3, or MiTF-CXmi expressing adenovirus with or without Ad-MiTF-CX and Ad-TFE3 (Fig. 5A5A).). Consistent with previous results, MiTF-CX inhibited IL-8 gene expression. Notably, however, overexpression of the transcription factor TFE3 profoundly inhibited IL-8 gene expression (>40-fold) in cervical stromal cells. Because MiTF heterodimerizes with TFE3, expression of this transcription factor was quantified in cervical stroma from pregnant women before or after labor. Unexpectedly, a modest increase in total TFE3 mRNA was observed in the cervix of women in labor (Fig. 5B5B).). However, mRNA encoding the transcriptionally less active form of TFE3 [TFE3-short (39)] was disproportionately increased 2.7-fold in labor, suggesting that deletion of this important transcription activation domain by differential mRNA splicing is important for controlling TFE3 activity during cervical ripening and is consistent with a repressive function related to MiTF-CX.

MiTF-CX binds to E-box 3 (-397CACATG-392) in the IL-8 promoter

In general, MiTF transcription factors act to modulate gene expression by binding to canonical E-box motifs in promoter regions of responsive genes. Ten E-box motifs were identified in the human IL-8 promoter (Table 11 and Fig. 66).). To determine whether MiTF-CX binds to these E-boxes, EMSAs were conducted with oligonucleotides corresponding to these promoter sequences. E-boxes 3 and 4 are closely spaced, and thus binding was examined with one oligonucleotide. In vitro-translated control protein or MiTF-CX was incubated with radiolabeled oligos for each E-box motif (Fig. 66).). Protein-binding patterns for control protein or MiTF were identical for E-boxes 1 and 2 and 5–10. A protein complex interacting with E-box 3/4, however, was unique to binding reactions containing MiTF (Fig. 6B6B,, arrow). To further confirm specific binding in cervical stromal cells, nuclear extracts were isolated from cells infected with control, wild-type MiTF-CX, or MiTF-CXmi adenovirus and thereafter incubated with radiolabeled oligos containing E-box 3/4. Strong binding was detected in cells expressing MiTF-CX (Fig. 6C6C,, lane 2), but not in cells expressing the mi mutant (Fig. 6C6C,, lane 3). Formation of the DNA-MiTF-CX complex was supershifted with MiTF antibodies and was competed with cold 3/4 oligos (Fig. 6C6C).

Figure 6
MiTF-CX binds to E-box 3 (-397CACATG-392) in the IL-8 promoter. A, Schematic representation of the IL-8 promoter illustrating 10 potential E-boxes relative to the initiation site of transcription. B, Binding assays using γ-32P end-labeled oligonucelotides ...
Table 1
Sense oligonucleotides used in gel shift assays to determine E-box binding in IL-8 and MiTF-CX promoters

To determine whether E-box 3 or 4 or both bind MiTF-CX, nuclear extracts from Ad-MiTF-CX-infected cells were incubated with radiolabeled oligos containing wild-type E-box 3/4, mutated E-box 4, or mutated E-box 3 (Fig. 6D6D).). Binding with oligos with mutated E-box 4 was similar to wild type (Fig. 6D6D,, lanes 1 and 2). In contrast, mutations in E-box 3 obliterated binding (Fig. 6D6D,, lane 5). Thus, E-box 3 (-397CACATG-392) is the single E-box MiTF-binding motif in the IL-8 promoter.

The transcriptional importance of MiTF binding to this E-box was demonstrated using a reporter gene assay and chromatin immunoprecipitation. Human cervical stromal cells were transfected with luciferase expression vectors that contained a 770-bp sequence of wild-type or mutated E-box 3 IL-8 promoter. Baseline IL-8 promoter activity was increased 4-fold compared with empty vector. The mutated IL-8 promoter supported similar levels (Fig. 7A7A),), suggesting that E-box 3 is not crucial for basal IL-8 promoter activity in stromal cells. Cotransfection with MiTF-CX resulted in significant down-regulation of wild-type IL-8 promoter activity. MiTF-CX, however, did not suppress IL-8 promoter activity with mutated E-box 3 (Fig. 7A7A).). Thus, E-box 3 is crucial for MiTF-CX-mediated suppression of IL-8 promoter activity in human cervical stromal cells. Chromatin immunoprecipitation (ChIP) experiments with antibodies to MiTF also indicated that MiTF-CX associated with regions of the IL-8 promoter containing E-box 3, but not E-box 10, which was used as a negative control (Fig. 7B7B).). Interestingly, although it does not bind DNA, MiTF-CXmi associated with this E-box in vivo, suggesting that heterodimerization of mutant MiTF with other transcription factors binding to this E-box (e.g. TFE3) may impair their repressor function in vivo.

Figure 7
E-box 3 (-397CACATG-392) is required to mediate inhibition of IL-8 promoter activity in cervical stromal cells. A, IL-8 promoter sequences with E-box 3 sequences underlined. Sequence of the mutated IL-8 promoter within E-box 3 is noted. Transient transfection ...

Regulation of MiTF gene expression and transcriptional activity

Expression of MiTF is regulated by distinct isoform-specific promoters. To begin to understand regulation of MiTF-CX promoter activity, a 2.1-kb upstream DNA fragment starting at the 5′-end of exon 1 was cloned upstream of the luciferase gene. The construct was transfected in HEK293 or cervical stromal cells with or without MiTF-CX (Fig. 88).). Basal luciferase activity with this fragment was low and comparable to the promoterless control. Coexpression of MiTF-CX, however, dramatically increased luciferase activity approximately 12-fold in HEK293 cells. Parallel results in cervical stromal cells also indicated significant MiTF-CX-induced increases in MiTF-CX promoter activity (Fig. 8B8B).). Interestingly, whereas both MiTF-M and MiTF-CX inhibited IL-8 gene expression, MiTF-CX promoter activity was increased significantly by MiTF-CX and MiTF-A, but not MiTF-M, despite the common bHLH-LZ DNA-binding domains (data not shown). Hence, a cervical stromal cell- and MiTF isoform-specific positive feedback loop appears to drive MiTF-CX expression.

Figure 8
MiTF-CX increases MiTF-CX promoter activity. HEK293 (panel A) or human cervical stromal cells (panel B) were transfected with vector or a 2.1-kb MiTF-CX promoter reporter construct in the presence of expression constructs for control (CTL), MiTF-CX, or ...

Biochemical, reporter gene, and ChIP assays were then used to determine the mechanism by which MiTF-CX transactivated its own promoter (Fig. 99).). Eleven E-box motifs were identified (Fig. 9A9A),), and EMSAs were conducted with oligonucleotides corresponding to these sequences. E-boxes 2 and 3 overlapped and thus were examined with one oligo (Table 11).). Gel-shift patterns for control or MiTF-containing extracts were identical for E-boxes 1, 4–8, and 10 and 11. In contrast, protein complexes were formed between MiTF and E-boxes 2 and 3 and 9 (Fig. 9B9B).). To confirm specific binding in cervical stromal cells, nuclear extracts were isolated from cells infected with control, wild-type MiTF-CX, or MiTF-CXmi adenovirus, and thereafter incubated with radiolabeled oligos containing E-box 9 or 3/2. Strong binding was detected in cells expressing MiTF-CX, but not cells expressing mutated MiTFmi (Fig. 9C9C).). Formation of the DNA-MiTF-CX complex of each E-box was supershifted with MiTF antibodies and competed with cold wild-type oligos (Fig. 9C9C).). To further pinpoint whether E-box 3 or 2 (or both) bind MiTF-CX, nuclear extracts from MiTF-CX cells were incubated with radiolabeled oligos containing wild-type E-box 9, mutated E-box 9, wild-type E-box 3/2, or mutated E-box 3 or 2 (Fig. 9D9D).). Mutation of E-box 9 obliterated the formation of the DNA-MiTF-CX complex. Likewise, mutations in E-box 3, but not E-box 2, prevented complex formation.

Figure 9
MiTF-CX binds to its own promoter. A, Schematic representation of the MiTF-CX promoter. Potential E-boxes are noted. B, EMSAs using γ-32P end-labeled oligonucelotides from MiTF-CX promoter sequences including 11 potential E-boxes were performed ...

Reporter gene assays with luciferase expression vectors containing the upstream 2.1-kb MiTF-CX promoter with either wild-type or mutated MiTF-CX were then used to determine whether E-boxes 9 and 3 were important in mediating transactivation of MiTF-CX promoter by MiTF-CX. In the absence of MiTF-CX, the MiTF-CX promoter had little activity above baseline. Cotransfection with MiTF-CX increased promoter activity 12-fold (Fig. 10A10A).). MiTF-CX-induced transactivation of its promoter was decreased by mutations in either E-box 9 or 3 (Fig. 1010).). Mutations in both E-boxes abolished MiTF-CX-induced increases in promoter activity. Interestingly, the double mutation resulted in modest increases in baseline promoter activity, suggesting that other E-box-binding transcription factors may inhibit MiTF-CX promoter activity in the absence of MiTF-CX. ChIP experiments in stromal cells expressing control, MiTF-CX, or MiTF-CXmi revealed that MiTF-CX bound to both E-box motifs (Fig. 10B10B).). As with the IL-8 promoter, ChIP assays also indicated that mutant MiTF-CXmi was bound to chromatin complexes at E-boxes 9 and 2/3. Because MiTF-CXmi does not bind DNA, mutant MiTF is likely to heterodimerize with other proteins normally bound to these sites in vivo. Collectively, these results indicate that both E-box motifs in the MiTF-CX promoter are important in mediating MiTF-CX-induced increases in its own promoter activity.

Figure 10
MiTF-CX increases MiTF-CX promoter activity through E-boxes 9 and 3. A, MiTF-CX promoter sequences with E-box 9 and 3 underlined. Sequence of the mutated promoter within each E-box is indicated. Cells were transfected with vector control or full-length ...

Discussion

MiTF and cervical function

Our studies now demonstrate that a cervix-specific isoform of the transcription factor MiTF, MiTF-CX, is uniquely expressed in the unripe cervix and is a physiological repressor of IL-8 gene expression in cervical stromal cells. MiTF-CX positively regulates its own expression, and our results suggest this positive feedback loop must be broken for the cervical stroma to express IL-8. This finding has important implications not only for understanding how the regulated expression of a critical proinflammatory cytokine, IL-8, occurs during cervical remodeling, but also for better understanding the development and function of cervical stromal cells in the remodeling process.

MiTF is known to dictate development of a number of cell lineages by activation of cell type-specific gene products. In melanocytes and pigmented retinal epithelial cells, MiTF is crucial for expression of many melanocyte-specific genes including tyrosinase (40), tyrosinase related protein-1 (41), c-kit (42), and Bcl-2 (43). MiTF is crucial for expression of mast cell proteases in mast cells (29,44), for tartrate-resistant acid phosphatase in osteoclasts (24), and myosin light chain 1a in cardiomyocytes (45). Little is known regarding the cell-specific functions of cervical stromal cells and whether there is any putative “master” transcriptional regulators of their development as a discrete lineage. These cells, however, are critically important in maintaining cervical integrity during pregnancy, particularly in women in which an upright posture places unique stresses on the cervix during gestation. The cervix must counteract the gravitational forces of the growing fetus and fetal membranes on the cervix during 99% of gestation. Conversely, it must also undergo dramatic matrix remodeling during parturition, and finally, undergo reformation of a structurally intact organ within hours after birth. The molecular processes that orchestrate this unique physiological plasticity in organ function are poorly understood. Thus, MiTF-CX may provide insights regarding unique functions of cervical stromal cells during pregnancy and parturition.

Human cervical fibroblasts serve as a source of IL-8 during pregnancy, and parturition (20) mechanical stretch induces expression of IL-8 in these cells (46). Herein, we suggest that one mechanism to maintain low levels of IL-8 in the cervix during progressive increases in mechanical pressure on the cervix during pregnancy is MiTF-CX-induced inhibition of IL-8 mRNA and protein through binding to E-box 3 in the IL-8 promoter. Although MiTF is best known for activating gene expression, we show that the cervical isoform is important to suppress transcriptional programs that result in proinflammatory signals, neutrophil recruitment, cervical ripening, and dilation. This is consistent with the known repressive properties of MiTF in B cells and macrophages (47,48) in which MiTF blocks programs of activation by repressing gene expression.

Like MiTF-CX, progesterone-bound progesterone receptors also suppress cytokine production in responsive cells of the female reproductive tract. The dramatic loss of MiTF-CX in cervical stromal cells during cervical dilation may be one mechanism by which withdrawal of another progestational transcription factor leads to the onset of labor.

Spontaneous mutations in MiTF result in a parturition-defective phenotype in mice

Our results suggest that mutations in MiTF would disrupt normal pregnancy and delivery by detrimentally affecting uterine/cervical architecture. Female mice homozygous for mutations in the basic region of the microphthalmia (mi) locus (i.e. mi/mi mice) carry their pregnancies to term, delivering on gestation d 19. However, at the time of delivery, 86% of mutant dams exhibit complete uterine inversion, even when mi/mi females were mated with +/+ males (49). Studies presented herein suggest that cervical MiTF expression is important in regulating cervical competency, particularly in reformation of the cervical barrier after parturition. In the presence of uterine contractions (postpartum) or during maternal expulsive efforts, the uterus may invert if the cervix does not rapidly return to a functional barrier. Collectively, the parturition defect in MiTF mutant mice, together with the findings reported here, suggest that MiTF plays a crucial role in normal function of the female reproductive tract during pregnancy and parturition; this hypothesis is now being tested.

Heterodimerization of MiTF with binding partners in stromal cells

Although MiTF mediates gene transcription predominantly through homodimerization, heterodimerization of MiTF may occur with three related molecules: TFEB, TFEC, and TFE3, (50,51). Mutations or deletions in the DNA-binding domain of MiTF may lead to cellular defects by anchoring MiTF heterodimerization partners in the cytoplasm (37,38). Although our results showing that the mi mutation in MiTF-CX caused it to become localized to the cytoplasm partially agrees with this possibility, binding of mutant MiTF-CX to chromatin complexes suggests that it may derepress IL-8 gene expression by heterodimerization with other family members bound to DNA, thereby resulting in dramatic up-regulation of IL-8 levels. It is most likely that MiTF-CXmi inhibits endogenous TFE3, given that endogenous MiTF was not expressed in the cultured primary cervical stromal cells, and our RNA analysis indicated TFE3 was the only other family member expressed. Consistent with this idea, we demonstrated that ectopic TFE3 expression, like MiTF-CX, inhibited endogenous IL-8 expression and IL-8 promoter activity.

The finding that TFE3 has a profound effect on IL-8 gene expression in cervical stromal cells indicates that this transcription factor may contribute to the transcriptional network that regulates IL-8 gene expression in the cervix during pregnancy. TFE3 is similar in structure to MiTF with homologous basic helix-loop-helix-zipper domains. In our system, total transcript levels of TFE3 were not decreased in cervical stroma from women in labor. However, a 2.7-fold increase in a transcriptionally less active isoform of TFE3 (39) in cervical stroma during labor may suggest a potential additional mechanism that synergizes with MiTF-CX. Roman et al. (39) showed that splicing of an exon encoding a potent transcription activation domain occurs in vivo to produce this less active form of TFE3, called TFE3-short. Even small amounts of the short form of TFE3 relative to the long form resulted in marked reduction of TFE3 transactivation. It has been demonstrated, however, that MiTF and TFE3 effects are cell and gene specific (52). Studies are in progress to determine the physiological significance of the increased spliced form of TFE3-short in cervical stromal tissues from women in labor and whether the expression and subcellular localization of TFE3 proteins is altered in the ripened cervix.

Subcellular distribution of MiTF during ripening may further control MiTF activity

The cellular mechanisms that mediate cytoplasmic localization of endogenous MiTF protein in the dilated cervix in vivo are not known. Cytoplasmic localization of MiTF in cervical stromal cells during labor may be due to up-regulation of chaperone-like adaptor molecules or phosphorylation of these proteins in the cytoplasm. These mechanisms have been postulated to regulate cellular localization and bioactivity of MiTF during differentiation of osteoclasts (53,54). The ability to reversibly alter the subcellular localization of MiTF may represent a unique plasticity in the phenotype of cervical stromal cells that facilitates dramatic changes in organ function during pregnancy, parturition, and the puerperium.

How would these multiple mechanisms that result in loss of MiTF activity in cervical stromal cells be orchestrated during cervical ripening and dilation? We propose that first, via as yet unknown mechanisms, MiTF-CX mRNA is decreased significantly. Second, given that the predominant positive regulator of MiTF-CX gene expression is MiTF-CX itself in an autoregulatory feed-forward loop, the resultant loss of MiTF protein would then lead to decreased activation of the MiTF-CX promoter and further loss of MiTF-CX mRNA. Third, MiTF becomes redistributed to the cytoplasm by other unknown mechanisms. Recent studies in osteoclasts may provide clues regarding potential mechanisms in cervical stromal cells. Hyaluronan interactions with toll-like receptor 4 receptors led to loss of MiTF (55). It is well established that hyaluronan synthesis is up-regulated during cervical ripening and labor (56,57,58). It is possible, therefore, that this ECM component may suppress MiTF in cervical stromal cells at term through a similar mechanism. Overall, our results indicate that loss of MiTF in cervical and myometrial stromal fibroblasts results in up-regulation of IL-8 gene expression even in the absence of inflammatory stimuli at term.

In conclusion, we suggest that binding of MiTF-CX to the IL-8 promoter is analogous to a braking system in which MiTF blocks IL-8 production in cervical stromal cells and helps maintain cervical competency during gestation. MiTF-CX is down-regulated during cervical ripening in vivo. Loss of MiTF-CX in cervical stromal cells results in release of IL-8 inhibition and increased IL-8 production. IL-8-induced recruitment of neutrophils and proinflammatory monocytes that release matrix-degrading proteases and other cytokines (including IL-8) results in a vicious cycle, ultimately leading to degranulation of neutrophils, matrix degradation, and dissolution of the ECM. We propose, therefore, that MiTF-CX is a progestational transcription factor in cervical stromal cells that serves to maintain cervical competency until term. Future work will identify upstream factors that break the cycle of MiTF inhibition to allow ripening to occur.

Materials and Methods

Source of human cervical tissues

Human cervical tissues were obtained from pregnant women undergoing cesarean hysterectomy using a protocol approved by the Institutional Review Board at the University of Texas Southwestern Medical Center. Full-thickness cervical tissues were obtained at the level of the internal cervical os. Cervical epithelium was removed. Although each cesarean hysterectomy specimen involved major pathology (particularly at the placental/myometrial interface in specimens complicated by placenta previa), cervical specimens were obtained only from specimens in which the cervix appeared normal, both grossly and histologically. Cervical tissues from women with clinical or histological chorioamnionitis, rupture of the membranes more than 12 h, abnormal vaginal discharge, or positive cervical cultures for β-streptococcus, gonorrhea, trichomonas, or syphilis were not included.

Human cervical stromal cell in culture

Cervical stroma was obtained from nonpregnant women undergoing hysterectomy for benign gynecological conditions unrelated to cervical disease under a protocol approved by the Institutional Review Board at the University of Texas Southwestern Medical Center. To disperse the stromal cells, fresh tissues were minced and incubated for 16 h at 34 C in solution that contained collagenase B (1 mg/ml) and deoxyribonuclease (0.15 mg/ml). Stromal cells were collected, diluted with DMEM buffered with HEPES (25 mm) and sodium bicarbonate (0.1875%), pH 7.4. The medium was supplemented with fetal bovine serum (FBS, 10% by volume), penicillin (200 U/ml), streptomycin (200 μg/ml), and sodium pyruvate (1 mm). Cells were plated at 5 × 105 cells/cm2 with the culture medium changed every other day until confluency (2–4 d). Preconfluent cells in passages 3–5 were used for experiments.

Plasmid constructs

The 2.1-kb MiTF-CX and 770-bp human IL-8 promoters were cloned into pCR2.1 vector using PCR-based TA cloning. Thereafter, promoters were subcloned into pGL3 basic luciferase reporter vectors. PCR and site-directed mutagenesis were used to create the mutant promoters. MiTF-CX or MiTF-CXmi was cloned into pCDNA3.1 expression vectors. All plasmids were sequenced by the dideoxychain termination method.

5′-RACE

Rapid amplification of cDNA ends was performed using the SMART RACE cDNA amplification Kit (CLONTECH Laboratories, Inc., Palo Alto, CA) and polyA+ mRNA from pooled cervical stroma obtained from five women before cervical ripening. A 36-bp primer used for amplification was complementary to exon 2 of human MiTF-M.

Transfection and luciferase assays

For analysis of IL-8 promoter activity, 1.1 million preconfluent cervical stromal cells were transfected by electroporation with 1.78 μg DNA [1.75 μg promoter-pGL3 + 0.03 μg β-galactosidase using a nucleofector transfection kit (Amaxa Biosystems, Gaithersburg, MD)]. After 24 h, cells were infected with control or MiTF-CX adenovirus (108 pfu). Cells were harvested after 24 h, and luciferase activity was determined using the luciferase assay system (Promega Corp., Madison, WI). To normalize for transfection efficiency, β-galactosidase activity was determined in the same cell extracts using the Galacto-Light Plus Systems (Applied Biosystems, Bedford, MA). For analysis of MiTF-CX promoter activity, HEK293 cells (1.6 × 106 cells per well) were transfected with the MiTF-CX promoter constructs together with empty vector, MiTF-CX, and β-galactosidase expression vector (0.2 μg PGL3-promoter, 0.975 μg PCMV5, and 0.075 μg β-galactosidase) using Fugene 6 (6 μl per well; Roche Applied Science, Indianapolis, IN).

Adenovirus

Full-length clones of human MiTF-CX, MiTF-M, TFE3, and MiTF-CXmi were subcloned into the shuttle vector, pAdTrack-CMV. The resultant plasmid was linearized by digestion with restriction endonuclease PmeI, and thereafter cotransformed into Escherichia coli BJ5183 cells with an adenoviral backbone plasmid (e.g., pAdEasy-1). Finally, the PacI-linearized recombinant plasmid was transfected into HEK293 cells for adenovirus packaging. Recombinant virus was collected and subjected to three rounds of amplification in HEK293 cells. Purified viruses were titrated using the standard plaque assay. The titer of adenovirus used to infect cells was adjusted to obtain MiTF-CX mRNA levels 2- to 5-fold those in cervical stromal tissues from pregnant women.

EMSA

Double-stranded oligonucleotide probes were created by T4 polynucleotide kinase end labeled with [γ-32P]ATP followed by purification over a Quick Spin G-25 Sephadex Column (Roche Applied Science). The nucleotide sequences of the human IL-8 and MiTF-CX gene promoters were based on sequencing data available at GenBank accession no. M28130 and the 2.1-kb upstream region of the start site of MiTF-CX on chromosome 3p. Sense strands for the oligonucleotides containing the 3′- and 5′-regions of the 10 potential E-boxes in the IL-8 promoter and 11 E-boxes in the MiTF-CX promoter are listed in Table 11.. Cells were lysed in buffer containing 10 mm HEPES, 10 mm KCl, and 0.1% Nonidet P-40 (NP40) (pH 7.9) supplemented with protease inhibitors (Complete protease inhibitor cocktail, Roche). After centrifugation, pellets were washed and resuspended in buffer without NP40 and sonicated. After centrifugation, supernatants containing nuclear proteins were quantified by BCA assay (Pierce Biotechnology, Inc., Rockford, IL). Where indicated, 1 μl of MiTF antibody (C5+D5; Lab Vision, Fremont, CA) was added to protein samples 20 min before addition of labeled probe. Protein-DNA complexes were resolved on 5% nondenaturing polyacrylamide gels in 0.5× Tris-borate-EDTA buffer and subjected to autoradiography. For competitive EMSA, recombinant protein (or nuclear extract) and competitor were preincubated at 4 C for 5 min before addition of the radiolabeled probe. In vitro translated human MiTF-CX was generated using the TNT Coupled Reticulocyte Lysate System (Promega Corp., Madison, WI).

Semiquantitative PCR and quantitative real-time PCR

Conventional semiquantitative RT-PCR and isoform-specific primers (Table 22)) were used to detect expression of various MiTF isoforms. Reverse transcription reactions were conducted with 2 μg total RNA in a reaction volume of 20 μl. Each reaction contained 10 mm dithiothreitol, 0.5 mm deoxynucleotide triphosphates, 0.015 μg/μl random primers, 40 U ribonuclease inhibitor (Invitrogen, Carlsbad, CA; catalog no. 10777-019) and 200 U reverse transcriptase (Invitrogen; catalog no. 18064-014). Reaction conditions were: 10 min at 23 C, 60 min at 42 C, followed by 70 C for 15 min. One microliter of each cDNA reaction was then amplified using an Invitrogen Platinum PCR Supermix kit and appropriate isoform-specific primer sets (1.5 μm each, Table 22)) with optimized annealing temperatures between 53 and 57 C for 30 cycles. Amplification products were analyzed by 2% agarose gel electrophoresis and ethidium bromide staining. For real-time PCR, primer sequences to amplify IL-8 were 131GGCAGCCTTCCTGATTTCTG150 (sense) and 210TGCACTGACATCTAAGTTCTTTAGCA185 (antisense). Primer sets for TFE3 were 1510GCTCCGAATTCAGGAACTAGAACT1533 and 1597AGTCGTGGCCAAGGAAAGC1579. To amplify TFE3-short, primers and probe-specific sequences were used: 994CATCGGGTCCAGCTCAGA1011 and 1169CGCCTTGACTACTGTACACATCA1147 with 1144CAGATTCCCTGACACAGGCAGCTCCTT1124 used as the FAM-TAMRA-labeled probe. Primers were chosen so that the resulting amplicons would cross an exon junction, thereby eliminating false-positive signals from genomic DNA contamination. Gene expression was normalized to expression of 18S rRNA (Applied Biosystems, Foster City, CA; catalog no. 4310893E). Primer sets were tested to ensure that efficiency of amplification over a wide range of template concentrations was equivalent to that of 18S. PCRs were carried out in the ABI Prism 7000 sequence detection system (Applied Biosystems). The reverse transcription product from 50 ng RNA was used as template for IL-8, and 5 ng RNA was used for 18S amplification. Reaction volumes were 30 μl, containing 1× Master Mix (Applied Biosystems; catalog no. 4304437 for Taqman and catalog no. 4309155 for SYBR Green). Primer concentrations were 900 nm. Cycling conditions were: 2 min at 50 C, followed by 10 min at 95 C; then 40 cycles of 15 sec at 95 C and 1 min at 60 C. When SYBR Green was used, a preprogrammed dissociation protocol was used after amplification to ensure that all samples exhibited a single amplicon. Levels of mRNA were determined using the ddCt method (Applied Biosystems).

Table 2
Primer sequences to amplify MiTF isoforms using conventional PCR

Immunolocalization

Immunohistochemistry was used to determine the cell type-specific expression of MiTF in the human cervix. Formalin-fixed, paraffin-embedded tissues were sectioned at 5 μm and mounted on slides. Tissue sections from positive and negative control sections were mounted on the same slide. Sections were immunostained with antibodies to MiTF (C5+D5, Lab Vision). Tissue sections incubated with McCoy’s medium in place of the primary antibody served as negative controls. After drying in a microwave oven, the slides were deparaffinized in xylene and rehydrated by progressive decreases in alcohol. Using Tris-based epitope-retrieval buffer, epitope retrieval was performed in a pressure cooker (9 min). Endogenous biotin activity was then blocked by placing the slides in dilute egg white solution for 15 min at room temperature, followed by a distilled water rinse and then incubation in fresh skim milk at room temperature for 15 min. Thereafter, slides were incubated in primary antibody for 30 min at 25 C using constant gentle orbital rotation. After a 30-min incubation with biotinylated secondary antibody (Scytek, Logan, UT) for 15 min, slides were placed in 0.3% H2O2 in PBS for 10–13 min to quench endogenous peroxidase activity and then incubated with horseradish peroxidase-conjugated streptavidin (Scytek) for 15 min at 25 C. Reaction product was developed by immersing the slides in prepared diaminobenzidine solution (Research Genetics, Huntsville, AL) at 32 C for 4 min, rinsed in tap water, and placed in 0.5% copper sulfate in normal saline for 5 min at 25 C to enhance the appearance of chromogen. Finally, slides were rinsed in water, counterstained in hematoxylin, dehydrated in graded alcohols and xylene, and protected with a coverslip. As a negative control, specimens of the same tissue were stained as described above except the primary antibody was replaced with McCoy’s tissue culture medium.

To immunostain cells in culture, cells were cultured in glass nine-well chamber slides, fixed in methanol, and thawed in cold (−20 C) fixative. After washing with PBS, cells were exposed sequentially to the MiTF antibodies (1:300 each; C5 + D5; Lab Vision) for 30 min and a fluorescent secondary antibody for 30 min at room temperature after PBS washes. Fluorescein (FITC) was used as the secondary antibody for HEK293 and MEL cells, whereas indocarbocyanine (Cy3) was used for cervical stromal cells due to endogenous fluorescence. After a 30 min incubation with FITC- or Cy3-labeled secondary antibody for 15 min, slides were washed extensively, coverslipped in glycerol (90%, vol/vol) that contains diazobicyclooctane (2.5%) for routine fluorescence microscopy and viewed with a Zeiss Photomicroscope II with epifluorescent illumination (Carl Zeiss, Thornwood, NY) and equipped with an Optronics charge-coupled device camera and Magnafire software for image capture. The use of F(ab′)2 fragments of affinity-purified secondary antibodies [preabsorbed to remove cross-reactivity to human proteins (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA)] obviated the need for pretreatment of sections with serum to prevent background immunoreactivity. Negative controls were incubated with an irrelevant monoclonal antibody (L1CAM, Lab Vision).

IL-8 ELISA

Serum-free media (1.5 ml per well) were collected from human cervical stromal cells in culture 48 h after infection with control, MiTF-CX, or MiTF-CXmi adenovirus. IL-8 was quantified by ELISA and a standard curve of recombinant human IL-8 (BD OptEIA ELISA kit; BD Biosciences, San Diego, CA).

Chromatin Immunoprecipitation Assays

Primary cervical stromal cells were used after three to four passages, seeded overnight to 85% confluency in 150-mm dishes, and maintained in DMEM with 10% FBS followed by infection with either vehicle, control virus, or virus expressing wild-type or mutant MiTF-CX. After 24 h, media were replaced by serum-free medium for 48 h. Thereafter, cells were treated with 1% formaldehyde by gentle shaking at room temperature for 15 min. Cross-linking was stopped by addition of glycine (125 mm) for 5 min. Cells were washed three times with cold PBS containing protease inhibitors, collected by scraping, and incubated in 400 μl lysis buffer [1% sodium dodecyl sulfate (SDS), 10 mm EDTA, 50 mm Tris-Cl (pH 8.1) and protease inhibitors] on ice for 10 min. Lysates were sonicated (output of 3, for a pulse of 12 sec in continuous mode 10 times for each lysate at 1-min intervals) and centrifuged at 13,000 rpm for 10 min at 4 C. Aliquots (100 μl) were diluted with 900 μl ChIP dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mm EDTA, 16.7 mm Tris-Cl (pH 8.1), 167 mm NaCl, and protease inhibitors) and precleared by incubating with 20 μl Protein A/G Sepharose beads (Santa Cruz Biotechnology, Inc., Santa Cruz, CA; catalog no. Sc-2003) and 2 μg of salmon sperm DNA (Ambion, Inc., Austin, TX; catalog no. AM9680) for 2 h at 4 C. Samples were centrifuged, and the precleared supernatant was incubated 1) without antibody, 2) with 6 μg of IgG (Santa Cruz Biotechnology; catalog no. Sc-2025), or 3) 6 μg of a mixture of antibodies against MiTF [C5 (NeoMarkers catalog no. MS-771-P), D5 (Lab Vision; catalog no. MS-772-P), and C-17 (Santa Cruz Biotechnology; catalog no. sc-11002 X)] overnight at 4 C. Samples were further incubated with Protein A/G Sepharose beads for 1 h. Beads were washed sequentially once with low-salt buffer [0.1% SDS, 1% Triton X-100, 2 mm EDTA, 20 mm Tris-Cl (pH 8.1), 150 mm NaCl, and protease inhibitors], high-salt buffer [0.1% SDS, 1% Triton X-100, 2 mm EDTA, 20 mm Tris-Cl (pH 8.1), 500 mm NaCl and protease inhibitors], lithium chloride wash buffer (250 mm LiCl; 1% NP40; 1% sodium deoxycholate; 1 mm EDTA; 10 mm Tris-Cl, pH 8.1) and twice with TE buffer (10 mm Tris-Cl, pH 8.1; 1 mm EDTA). Antibody-chromatin complexes were eluted from the beads with 500 μl elution buffer (1% SDS, 100 mm NaHCO3), and cross-links were reversed by incubating the eluted samples with 300 mm NaCl at 65 C overnight followed by proteinase K digestion. DNA from each sample was purified using PCR purification kit (QIAGEN, Chatsworth, CA; catalog no. 28106) and eluted using 40 μl H2O. Samples (5 μl) were amplified by PCR with primers shown in Table 33.

Table 3
Oligonucleotides used to amplify promoter regions in IL-8 and MiTF-CX promoters after ChIP

Statistical analysis

Student’s independent t test was used for analysis of two groups with normal distribution, and a one-way ANOVA was used for multiple groups. Differences considered significant were P < 0.05.

Acknowledgments

We thank Ms. Sheila Brandon and Ms. Valencia Hoffman and the Human Tissue and Biological Core Laboratory (UTSW) for tissue acquisition; Dr. Judith Head (UTSW) for assistance in immunocytochemistry; Dr. Rodney Miller (ProPath Laboratories, Dallas, TX) for immunohistochemistry; Mr. Jesús Acevedo (UTSW) and Mr. Patrick Keller (UTSW) for expert technical assistance; and Dr. Annika Lindqvist (UTSW) and Dr. Stefan Andersson (UTSW) for careful review of the manuscript.

This work was supported by National Institutes of Health Grants HD11149 (to R.A.W.), and DK065011 (to C.R.) and March of Dimes Grant 6FY06337 (to R.A.W.).

Footnotes

Disclosure Summary: The authors have nothing to disclose.

First Published Online June 23, 2010

Abbreviations: Ad-, Adenoviral expression; bHLH, basic helix-loop-helix; ChIP, chromatin immunoprecipitation; Cy3, indocarbocyanine; ECM, extracellular matrix; FITC, fluorescein; HEK, human embryonic kidney; MiTF, microphthalmia-associated transcription factor; MiTF-CX, MiTF-cervix; MiTF-H, MiTF-heart; MiTF-M, MiTF-melanocyte; NP40, Nonidet P-40; pfu, plaque-forming units; RACE, rapid amplification of cDNA ends; SDS, sodium dodecyl sulfate.

References

  • Read CP, Word RA, Ruscheinsky MA, Timmons BC, Mahendroo MS 2007 Cervical remodeling during pregnancy and parturition: molecular characterization of the softening phase in mice. Reproduction 134:327–340 [PubMed]
  • Word RA, Li XH, Hnat M, Carrick K 2007 Dynamics of cervical remodeling during pregnancy and parturition: mechanisms and current concepts. Semin Reprod Med 25:69–79 [PubMed]
  • Owen J 2003 Evaluation of the cervix by ultrasound for the prediction of preterm birth. Clin Perinatol 30:735–755 [PubMed]
  • Yost NP, Cox SM 2000 Infection and preterm labor. Clin Obstet Gynecol 43:759–767 [PubMed]
  • Owen J, Iams JD, Hauth JC 2003 Vaginal sonography and cervical incompetence. Am J Obstet Gynecol 188:586–596 [PubMed]
  • Iams JD 2003 Prediction and early detection of preterm labor. Obstet Gynecol 101:402–412 [PubMed]
  • Montes GS, Zugaib M, Joazeiro PP, Varayoud J, Ramos JG, Muñoz-de-Toro M, Luque EH 2002 Phenotypic modulation of fibroblastic cells in the mucous layer of the human uterine cervix at term. Reproduction 124:783–790 [PubMed]
  • Varayoud J, Ramos JG, Joazeiro PP, Montes GS, Muñoz De Toro MM, Luque EH 2001 Characterization of fibroblastic cell plasticity in the lamina propria of the rat uterine cervix at term. Biol Reprod 65:375–383 [PubMed]
  • el Maradny E, Kanayama N, Halim A, Maehara K, Sumimoto K, Terao T 1995 The effect of interleukin-1 in rabbit cervical ripening. Eur J Obstet Gynecol Reprod Biol 60:75–80 [PubMed]
  • Fujimoto T, Savani RC, Watari M, Day AJ, Strauss III JF 2002 Induction of the hyaluronic acid-binding protein, tumor necrosis factor-stimulated gene-6, in cervical smooth muscle cells by tumor necrosis factor-α and prostaglandin E2. Am J Pathol 160:1495–1502 [PMC free article] [PubMed]
  • el Maradny E, Kanayama N, Halim A, Maehara K, Sumimoto K, Terao T 1994 Interleukin-8 induces cervical ripening in rabbits. Am J Obstet Gynecol 171:77–83 [PubMed]
  • Sennström MK, Brauner A, Lu Y, Granström LM, Malmström AL, Ekman GE 1997 Interleukin-8 is a mediator of the final cervical ripening in humans. Eur J Obstet Gynecol Reprod Biol 74:89–92 [PubMed]
  • Kelly RW 2002 Inflammatory mediators and cervical ripening. J Reprod Immunol 57:217–224 [PubMed]
  • Denison FC, Calder AA, Kelly RW 1999 The action of prostaglandin E2 on the human cervix: stimulation of interleukin 8 and inhibition of secretory leukocyte protease inhibitor. Am J Obstet Gynecol 180:614–620 [PubMed]
  • Winkler M, Rath W 1999 Changes in the cervical extracellular matrix during pregnancy and parturition. J Perinatal Med 27:45–60 [PubMed]
  • Mitchell SE, Robinson JJ, King ME, McKelvey WA, Williams LM 2002 Interleukin 8 in the cervix of non-pregnant ewes. Reproduction 124:409–416 [PubMed]
  • Sennström MB, Ekman G, Westergren-Thorsson G, Malmström A, Byström B, Endrésen U, Mlambo N, Norman M, Ståbi B, Brauner A 2000 Human cervical ripening, an inflammatory process mediated by cytokines. Mol Hum Reprod 6:375–381 [PubMed]
  • Ito A, Imada K, Sato T, Kubo T, Matsushima K, Mori Y 1994 Suppression of interleukin 8 production by progesterone in rabbit uterine cervix. Biochem J 301: 183–186. [PMC free article] [PubMed]
  • Osman I, Young A, Jordan F, Greer IA, Norman JE 2006 Leukocyte density and proinflammatory mediator expression in regional human fetal membranes and decidua before and during labor at term. J Soc Gynecol Investig 13:97–103 [PubMed]
  • Malmström E, Sennström M, Holmberg A, Frielingsdorf H, Eklund E, Malmström L, Tufvesson E, Gomez MF, Westergren-Thorsson G, Ekman-Ordeberg G, Malmström A 2007 The importance of fibroblasts in remodelling of the human uterine cervix during pregnancy and parturition. Mol Hum Reprod 13:333–341 [PubMed]
  • Samanta AK, Oppenheim JJ, Matsushima K 1990 Interleukin 8 (monocyte-derived neutrophil chemotactic factor) dynamically regulates its own receptor expression on human neutrophils. J Biol Chem 265:183–189 [PubMed]
  • Krieger M, Brunner T, Bischoff SC, von Tscharner V, Walz A, Moser B, Baggiolini M, Dahinden CA 1992 Activation of human basophils through the IL-8 receptor. J Immunol 149:2662–2667 [PubMed]
  • Zeilhofer HU, Schorr W 2000 Role of interleukin-8 in neutrophil signaling. Curr Opin Hematol 7:178–182 [PubMed]
  • Mansky KC, Sulzbacher S, Purdom G, Nelsen L, Hume DA, Rehli M, Ostrowski MC 2002 The microphthalmia transcription factor and the related helix-loop-helix zipper factors TFE-3 and TFE-C collaborate to activate the tartrate-resistant acid phosphatase promoter. J Leukoc Biol 71:304–310 [PubMed]
  • Verastegui C, Bertolotto C, Bille K, Abbe P, Ortonne JP, Ballotti R 2000 TFE3, a transcription factor homologous to microphthalmia, is a potential transcriptional activator of tyrosinase and TyrpI genes. Mol Endocrinol 14:449–456 [PubMed]
  • Hemesath TJ, Steingrímsson E, McGill G, Hansen MJ, Vaught J, Hodgkinson CA, Arnheiter H, Copeland NG, Jenkins NA, Fisher DE 1994 microphthalmia, a critical factor in melanocyte development, defines a discrete transcription factor family. Genes Dev 8:2770–2780 [PubMed]
  • Yasumoto K, Amae S, Udono T, Fuse N, Takeda K, Shibahara S 1998 A big gene linked to small eyes encodes multiple Mitf isoforms: many promoters make light work. Pigment Cell Res 11:329–336 [PubMed]
  • Oboki K, Morii E, Kataoka TR, Jippo T, Kitamura Y 2002 Isoforms of mi transcription factor preferentially expressed in cultured mast cells of mice. Biochem Biophys Res Commun 290:1250–1254 [PubMed]
  • Takemoto CM, Yoon YJ, Fisher DE 2002 The identification and functional characterization of a novel mast cell isoform of the microphthalmia-associated transcription factor. J Biol Chem 277: 30244–30252 [PubMed]
  • Shibahara S, Takeda K, Yasumoto K, Udono T, Watanabe K, Saito H, Takahashi K 2001 Microphthalmia-associated transcription factor (MITF): multiplicity in structure, function, and regulation. J Invest Dermatol Symp Proc 6:99–104 [PubMed]
  • Aksan I, Goding CR 1998 Targeting the microphthalmia basic helix-loop-helix-leucine zipper transcription factor to a subset of E-box elements in vitro and in vivo. Mol Cell Biol 18:6930–6938 [PMC free article] [PubMed]
  • Semov A, Marcotte R, Semova N, Ye X, Wang E 2002 Microarray analysis of E-box binding-related gene expression in young and replicatively senescent human fibroblasts. Anal Biochem 302:38–51 [PubMed]
  • Fuse N, Yasumoto K, Takeda K, Amae S, Yoshizawa M, Udono T, Takahashi K, Tamai M, Tomita Y, Tachibana M, Shibahara S 1999 Molecular cloning of cDNA encoding a novel microphthalmia-associated transcription factor isoform with a distinct amino-terminus. J Biochem 126:1043–1051 [PubMed]
  • Goding CR 2000 Mitf from neural crest to melanoma: signal transduction and transcription in the melanocyte lineage. Genes Dev 14:1712–1728 [PubMed]
  • Motyckova G, Weilbaecher KN, Horstmann M, Rieman DJ, Fisher DZ, Fisher DE 2001 Linking osteopetrosis and pycnodysostosis: regulation of cathepsin K expression by the microphthalmia transcription factor family. Proc Natl Acad Sci USA 98:5798–5803 [PMC free article] [PubMed]
  • Takebayashi K, Chida K, Tsukamoto I, Morii E, Munakata H, Arnheiter H, Kuroki T, Kitamura Y, Nomura S 1996 The recessive phenotype displayed by a dominant negative microphthalmia-associated transcription factor mutant is a result of impaired nucleation potential. Mol Cell Biol 16:1203–1211 [PMC free article] [PubMed]
  • Weilbaecher KN, Hershey CL, Takemoto CM, Horstmann MA, Hemesath TJ, Tashjian AH, Fisher DE 1998 Age-resolving osteopetrosis: a rat model implicating microphthalmia and the related transcription factor TFE3. J Exp Med 187:775–785 [PMC free article] [PubMed]
  • Sato M, Morii E, Takebayashi-Suzuki K, Yasui N, Ochi T, Kitamura Y, Nomura S 1999 Microphthalmia-associated transcription factor interacts with PU. 1 and c-Fos: determination of their subcellular localization. Biochem Biophys Res Commun 254:384–387 [PubMed]
  • Roman C, Cohn L, Calame K 1991 A dominant negative form of transcription activator mTFE3 created by differential splicing. Science 254:94–97 [PubMed]
  • Bentley NJ, Eisen T, Goding CR 1994 Melanocyte-specific expression of the human tyrosinase promoter: activation by the microphthalmia gene product and role of the initiator. Mol Cell Biol 14:7996–8006 [PMC free article] [PubMed]
  • Yasumoto K, Mahalingam H, Suzuki H, Yoshizawa M, Yokoyama K 1995 Transcriptional activation of the melanocyte-specific genes by the human homolog of the mouse Microphthalmia protein. J Biochem 118:874–881 [PubMed]
  • Isozaki K, Tsujimura T, Nomura S, Morii E, Koshimizu U, Nishimune Y, Kitamura Y 1994 Cell type-specific deficiency of c-kit gene expression in mutant mice of mi/mi genotype. Am J Pathol 145:827–836 [PMC free article] [PubMed]
  • McGill GG, Horstmann M, Widlund HR, Du J, Motyckova G, Nishimura EK, Lin YL, Ramaswamy S, Avery W, Ding HF, Jordan SA, Jackson IJ, Korsmeyer SJ, Golub TR, Fisher DE 2002 Bcl2 regulation by the melanocyte master regulator Mitf modulates lineage survival and melanoma cell viability. Cell 109:707–718 [PubMed]
  • Ito A, Morii E, Kim DK, Kataoka TR, Jippo T, Maeyama K, Nojima H, Kitamura Y 1999 Inhibitory effect of the transcription factor encoded by the mi mutant allele in cultured mast cells of mice. Blood 93:1189–1196 [PubMed]
  • Tshori S, Sonnenblick A, Yannay-Cohen N, Kay G, Nechushtan H, Razin E 2007 Microphthalmia transcription factor isoforms in mast cells and the heart. Mol Cell Biol 27:3911–3919 [PMC free article] [PubMed]
  • Takemura M, Itoh H, Sagawa N, Yura S, Korita D, Kakui K, Hirota N, Fujii S 2004 Cyclic mechanical stretch augments both interleukin-8 and monocyte chemotactic protein-3 production in the cultured human uterine cervical fibroblast cells. Mol Hum Reprod 10:573–580 [PubMed]
  • Lin L, Gerth AJ, Peng SL 2004 Active inhibition of plasma cell development in resting B cells by microphthalmia-associated transcription factor. J Exp Med 200:115–122 [PMC free article] [PubMed]
  • Hu R, Sharma SM, Bronisz A, Srinivasan R, Sankar U, Ostrowski MC 2007 Eos, MITF, and PU. 1 recruit corepressors to osteoclast-specific genes in committed myeloid progenitors. Mol Cell Biol 27:4018–4027 [PMC free article] [PubMed]
  • Yokoi H, Nakayama H, Horie K, Fukumoto M, Fujita K, Kaneko Y, Iwai M, Natsuyama S, Kanzaki H, Mori KJ, Fujita J 1994 High incidence of uterine inversion in mast cell-deficient osteopetrotic mutant mice of mi/mi genotype. Biol Reprod 50:1034–1039 [PubMed]
  • Tachibana M 2000 MITF: a stream flowing for pigment cells. Pigment Cell Res 13:230–240 [PubMed]
  • Rehli M, Den Elzen N, Cassady AI, Ostrowski MC, Hume DA 1999 Cloning and characterization of the murine genes for bHLH-ZIP transcription factors TFEC and TFEB reveal a common gene organization for all MiT subfamily members. Genomics 56:111–120 [PubMed]
  • Huan C, Sashital D, Hailemariam T, Kelly ML, Roman CA 2005 Renal carcinoma-associated transcription factors TFE3 and TFEB are leukemia inhibitory factor-responsive transcription activators of E-cadherin. J Biol Chem 280:30225–30235 [PubMed]
  • Mansky KC, Marfatia K, Purdom GH, Luchin A, Hume DA, Ostrowski MC 2002 The microphthalmia transcription factor (MITF) contains two N-terminal domains required for transactivation of osteoclast target promoters and rescue of mi mutant osteoclasts. J Leukoc Biol 71:295–303 [PubMed]
  • Bronisz A, Sharma SM, Hu R, Godlewski J, Tzivion G, Mansky KC, Ostrowski MC 2006 Microphthalmia-associated transcription factor interactions with 14–3-3 modulate differentiation of committed myeloid precursors. Mol Biol Cell 17:3897–3906 [PMC free article] [PubMed]
  • Chang EJ, Kim HJ, Ha J, Kim HJ, Ryu J, Park KH, Kim UH, Lee ZH, Kim HM, Fisher DE, Kim HH 2007 Hyaluronan inhibits osteoclast differentiation via Toll-like receptor 4. J Cell Sci 120:166–176 [PubMed]
  • Uldbjerg N, Ekman G, Malmström A, Olsson K, Ulmsten U 1983 Ripening of the human uterine cervix related to changes in collagen, glycosaminoglycans, and collagenolytic activity. Am J Obstet Gynecol 147:662–666 [PubMed]
  • Granström L, Ekman G, Ulmsten U, Malmström A 1989 Changes in the connective tissue of corpus and cervix uteri during ripening and labour in term pregnancy. Br J Obstet Gynaecol 96:1198–1202 [PubMed]
  • El Maradny E, Kanayama N, Kobayashi H, Hossain B, Khatun S, Liping S, Kobayashi T, Terao T 1997 The role of hyaluronic acid as a mediator and regulator of cervical ripening. Hum Reprod 12:1080–1088 [PubMed]

Articles from Molecular Endocrinology are provided here courtesy of The Endocrine Society
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...