• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
Arthritis Rheum. Author manuscript; available in PMC May 1, 2011.
Published in final edited form as:
PMCID: PMC2917190
NIHMSID: NIHMS218953

Selective blockade of BAFF prevents and treats SLE nephritis in NZM2410 mice

Abstract

Objectives

To determine whether BAFF or combined BAFF/APRIL blockade is effective in a mouse model of SLE nephritis characterized by rapidly progressive glomerulosclerosis.

Methods

NZM2410 mice at early and late stages of disease were treated with a short course of BAFF-R-Ig or TACI-Ig. Mice were followed for proteinuria and serologic profile every two weeks. Immunohistochemical, flow cytometric and ELISpot analyses of spleens, kidneys and bone marrows was performed after 8 weeks and after 33 weeks.

Results

A short course of selective blockade of BAFF alone was sufficient to prevent and treat SLE nephritis in NZM2410 mice despite the formation of pathogenic autoantibodies. Decreases in spleen size and B cell depletion persisted for more than 33 weeks after treatment and resulted in secondary decreases in CD4 memory T cell formation and activation of splenic and peripheral monocytes. Immune complex deposition in the kidneys was dissociated from renal damage and from activation of renal endothelial and resident dendritic cells.

Conclusions

Selective blockade of BAFF alone resulting in B cell depletion and splenic collapse was sufficient to prevent and treat disease in this model of non-inflammatory SLE nephritis. This shows that the inflammatory microenvironment may be a determinant of the outcome of B cell modulation strategies.

Systemic lupus erythematosus (SLE) is an autoimmune disorder in which loss of tolerance to nucleic acids is associated with the development of pathogenic autoantibodies that damage target organs. Lupus nephritis develops in up to 60% of adult SLE patients and is even more common in children. Induction of remission of lupus nephritis requires the use of potent immunosuppressive treatment with significant adverse effects, and frequent relapses (1).

B cells are therapeutic targets in SLE because they produce pathogenic autoantibodies and because they have multiple effector functions including antigen presentation to T cells, cytokine production and migration to sites of inflammation (2). One way to modulate B cell function is by inhibiting the B cell survival molecule BAFF (BLyS). Therapeutic antagonism of BAFF and its homolog APRIL (a proliferation ligand) is based on the discoveries that BAFF provides a crucial homeostatic signal for B cell survival and selection (36) and that soluble BAFF and APRIL are highly expressed in the serum of SLE patients (7) and in the target organs of SLE prone mice (8, 9). BAFF binds to three receptors, BAFF-R, TACI and BCMA that are differentially expressed during B cell ontogeny (10), whereas APRIL binds only to TACI and BCMA. Selective blockade of BAFF can be achieved with a soluble BAFF-R-Ig fusion protein or an antibody to BAFF whereas blockade of both BAFF and APRIL is achieved with soluble TACI-Ig. Initial phase 2 and 3 studies of a selective antibody to soluble BAFF (belimumab) were recently completed (11) and studies of TACI-Ig (atacicept) are currently in progress. Questions remain about the mechanism of action of these reagents and about whether blocking both BAFF and APRIL will be more efficacious than blocking BAFF alone.

The NZM2410 mouse is an inbred strain derived from NZB/W. NZM2410 mice manifest antibodies to nucleosomes and dsDNA and they develop rapidly progressive glomerulosclerosis with little lymphocytic infiltrate in the kidneys. These mice express high levels of IL-4 and they secrete large amounts of IgG1 antibodies (12). NZM2410 mice have a defect in migration of plasma cells to the bone marrow and retain large numbers of plasma cells in their spleens (13). We therefore hypothesized that disease in these mice might be more responsive to TACI-Ig, that depletes splenic plasma cells (14), than to BAFF-R-Ig. Our study shows that BAFF-R-Ig and TACI-Ig are equally effective at preventing disease and that a short course of either agent induces sustained remission when used as a single therapeutic. This appears to be due to prolonged B cell depletion and a decrease in the inflammatory response to renal immune complex deposition.

METHODS

Treatment of NZM2410 mice

NZM2410 mice were purchased from Taconic (Germantown, NY). Groups of 10 mice were treated at 14 weeks of age with 1 × 109 pfu of BAFF-R-Ig adenovirus (Ad-BAFF-R-Ig), TACI-Ig adenovirus (Ad-TACI-Ig) or β-galactosidase adenovirus (Ad-LacZ). 5 mice received no treatment. These adenoviruses have previously been described in detail (14). We obtained blood and tested urine for proteinuria by dipstick (Multistick, Fisher, Pittsburg PA) biweekly. Mice were followed until 55 weeks of age. Groups of 20 mice were treated at 22 weeks of age with the same adenoviruses. 5–8 mice in each group were sacrificed for mechanistic studies at 30 weeks and the remaining mice were followed until 55–62 weeks.

Serum IgM, IgG and Anti-dsDNA antibodies

Serum IgM and IgG and were measured as previously described (15). To measure anti-dsDNA antibodies (16) Immulon 2 HB plates (Thermo Scientific, Milford MA) pre-coated with 1 mg/ml methylated BSA (Sigma, St Louis, MO) in PBS, were coated with 50μg/ml of ssDNA/dsDNA for 30mins at 37°C, washed with PBS and blocked overnight in 0.1% gelatin containing 3% BSA/3mM EDTA. Serum was diluted in 0.1% gelatin containing 2% BSA, 3mM EDTA and 0.05% Tween20. HRP-conjugated goat anti-mouse IgM or IgG (Southern Biotechnology, Birmingham, AL) was diluted in PBS containing 1% BSA and 0.05% Tween 20 and plates were developed with ABTS. ELISA data for each antigen was normalized to a high titer mouse given an arbitrary level of 100 Units and run in serial dilution on each plate.

Anti-dsDNA ELISpot assay

Spleens were harvested from 4–5 mice per group at 30 and 55 weeks of age. ELISpot assays for total Ig secreting cells and for anti-dsDNA secreting B cells were performed using plates coated as above and our previously described ELISpot protocol (15).

Serum VCAM-1 levels

Frozen sera from 30w-old mice, diluted to 1:2000, were analyzed for serum VCAM-1 using an ELISA kit (R and D Systems, Minneapolis, MN) according to manufacturers’ instructions.

Flow cytometric analysis of spleens and kidneys

Spleen cells from 5–10 mice per group were analyzed for lymphocyte markers as previously described (17). Cells isolated from PBS perfused kidneys were analyzed for MHCII, Gr1 (eBiosciences, San Diego, CA) CD11b, F4/80 and CD11c (BD Pharmingen, San Diego, CA) expression as previously described (9).

BrdU labeling of renal CD11b+ cells

6–8 week old NZM2410 mice were loaded i.p. with 10mg of bromodeoxyuridine (Sigma-Aldrich, St. Louis, MA) followed by feeding with water containing 1 mg/ml BrdU for up to 30 days. The water was protected from light and changed daily. Groups of 3–5 mice were sacrificed at days 0, 7, 15 and 30. Kidney cells were prepared and stained with anti-CD11b, anti-CD11c and anti-F4/80 as above. BrdU was detected in CD11b/F4/80hi and CD11b/CD11chi cell populations using a BrdU flow kit (BD Pharmingen, San Diego, CA) according to the manufacturers’ protocol.

Immunohistochemistry and immunofluorescence staining

Renal H and E sections were scored for glomerular and interstitial (inflammation and tubular atrophy) damage as previously described (18). 5 μm cryosections of spleen and/or PBS perfused kidneys were stained with PE anti-B220, FITC anti-mouse IgM, PE anti-mouse IgD, PE anti-mouse CD11b (BD Pharmingen), FITC anti-mouse IgG1 or FITC anti-mouse IgG2a (Southern Biotechnology) in 10% NGS/PBS for 1 hour at room temperature. Images were captured using a digital CCD-camera (Diagnostic Instruments Inc., Sterling Heights, Michigan, USA), connected to a Nikon Inc. microscope (Melville, New York, USA).

Real-time PCR

Whole kidney mRNA was prepared from perfused kidneys of 5–10 mice per group and qRT-PCR was performed with 61 primers for inflammatory markers as previously described (9), with the addition of havcr1 (forward 5′-3′ CCAACATCAATCAGAGTCTCTACC; reverse 5′-3′ TGTCTCATGGGGACAAAATG), and nephrin (forward 5′-3′ AACATCCAGCTCGTCAGCAT; reverse 5′-3′ AGGGCTCACGCTCACAAC). Data were analyzed as previously described (9) and normalized to the mean of 5 young NZM2410 controls.

Statistical analyses

Proteinuria and survival data shown in Figure 1 were analyzed using Kaplan Meier curves and Log Rank test. Comparisons shown in Figures 2, ,33 and and55 and in Table 1 were performed using Wilcoxon Rank Sum Test.

Figure 1
Prevention of proteinuria and mortality in NZM2410 mice after BAFF blockade. A and B: In prevention studies 90% of Ad-BAFF-R-Ig treated mice remained proteinuria free and 100% survived for > 1 year whereas 90% of controls had died by 34 weeks ...
Figure 2
Serum immunoglobulin levels and anti-dsDNA titers. A: NZM2410 mice treated at 22 weeks with Ad-TACI-Ig had a sustained decrease in serum IgM. Ad-BAFF-R-Ig did not have this effect. B and C: Both Ad-BAFF-R-Ig and Ad-TACI-Ig treatment significantly decreased ...
Figure 3
Treatment effects on antibody secreting cells. Spleens and bone marrows of NZM2410 mice treated at 22 weeks with Ad-BAFF-R-Ig and Ad-TACI-Ig were analyzed at 30 (A and B) or 55 (C and D) weeks of age. A and B: 8 weeks after treatment only Ad-TACI-Ig treated ...
Figure 5
BAFF blockade protects against renal damage. A: Glomerular (G) and interstitial (I) damage scores in 55wk treated and 25–35wk control mice. The numbers above each set indicate the percentage of mice that died in each group. Bars represent the ...
Table 1
Flow cytometric analysis of spleens

Ethical approval for animal experimentation

Experiments using animals were performed under approved protocols from the Animal Institutes of Columbia University and the Feinstein Institute.

RESULTS

Both TACI-Ig and BAFF-R-Ig prevent disease onset and induce remission

Administration of Ad-TACI-Ig and Ad-BAFF-R-Ig results in detectable serum levels of the fusion proteins in normal and autoimmune mice for approximately 6 weeks (14, 17). Strikingly, administration of either TACI-Ig or BAFF-R-Ig at the age of 14 weeks resulted in almost complete prevention of disease in NZM2410 mice (Figure 1). After a single dose of Ad-BAFF-R-Ig 90% of the mice remained proteinuria free and none had died more than 40 weeks later (Figure 1A, B). We therefore determined whether we could treat mice at later disease stages. Mice were treated 22 weeks of age when the first mice were becoming proteinuric. Late treatment induced prolonged survival (Figure 1C, D) with approximately 60% of the mice proteinuria free at 55–62 weeks of age. Notably, of the 7 Ad-TACI-Ig treated and 7 Ad-BAFF-RIg treated mice that had >300mg/dl of proteinuria at the time of treatment or became proteinuric within the first 8 weeks after treatment, 4/7 and 5/7 manifested complete remissions with disappearance of proteinuria and prolonged survival (p < 0.001 compared with controls). In contrast all 10 control mice that developed proteinuria in the same time period died within one month. Thus both TACI-Ig and BAFF-R-Ig prevent disease onset and induce remission of nephritis in NZM2410 mice.

Serum immunoglobulins and anti-dsDNA antibody production

Mice treated with TACI-Ig had a profound decrease in serum IgM levels within 4 weeks that was maintained until the mice were sacrificed. Serum levels of IgM were unaffected by BAFF-R-Ig (Figure 2A). In contrast, both TACI-Ig and BAFF-R-Ig induced a decrease in total IgG (not shown) and serum levels of IgG1 and IgG2a (Figure 2B, C). 8 weeks after treatment serum levels of anti-dsDNA antibodies were significantly lower in treated mice than in controls, but they were no longer significantly different from control mice by 12 weeks after treatment (Figure 2D). Similar results were observed in the mice treated at 14 weeks of age (not shown).

These data were confirmed by ELISpot analyses (Figure 3). 8 weeks after treatment, treated mice had a significantly lower frequency and total number of IgG and IgG anti-DNA secreting cells in the spleen than did controls. Only TACI-Ig treated mice had lower numbers of total IgM secreting cells (Figure 3A, B). When the mice that remained in remission were sacrificed at 55 weeks of age and compared with old controls the differences were no longer significant (Figure 3C, D). Mice treated with TACI-Ig had a significantly lower frequency of IgG secreting cells in the bone marrows 8 weeks after treatment than did either BAFF-R-Ig treated mice or controls; anti-dsDNA secreting B cells were not detected in either of the treated groups. By 55 weeks of age there was no longer any difference between the three groups although there was still a trend towards lower numbers in the TACI-Ig treated mice (Figure 3E).

To further confirm the effects of treatment on antibody producing cells we performed immunohistochemical analysis of the spleens of 30 week old mice. Consistent with the ELISpot data, spleens of treated mice had fewer plasma cells in the red pulp than did controls (Figure 4A–C). To determine whether germinal centers were present we stained the spleens with PNA. Despite the marked B cell depletion and thin follicles in the spleens, germinal centers were still present in the treated mice (Figure 4D–F).

Figure 4
Immunohistochemistry of spleens and kidneys. A–C: IgD (red)/IgG (green) staining of spleens at 30 weeks, showed large numbers of plasma cells in the spleens of controls (A), fewer in BAFF-R-Ig treated mice (B) and none in the Ad-TACI-Ig treated ...

Analysis of spleen cell phenotype by flow cytometry

We further examined the effect of BAFF/APRIL blockade on lymphocytes using flow cytometry (Table 1). Both TACI-Ig and BAFF-R-Ig depleted spleen B cells by 50–75%; this depletion persisted for many months. B cell subset analysis showed a preferential depletion of T2, MZ and mature B2 cells with sparing of the T1 subset. NZM2410 mice have large numbers of B1a cells in the spleen (19). Interestingly, TACI-Ig but not BAFF-R-Ig depleted B1a cells early in the treatment course suggesting that APRIL +/−BAFF supports B1a cell survival, a result similar to that observed in TACI-Ig transgenic mice (20). Untreated mice manifested 2–3 fold expansion of B cells of all subsets with age but this was prevented by BAFF blockade. Even at 55 weeks treated mice had significantly fewer T2, MZ and follicular B cells than 8 week old controls.

BAFF blockade did not prevent the activation of CD4 T cells that occurs as disease progresses but the reduction in spleen size caused a significant decrease in the number of total and memory CD4 T cells in treated mice compared with nephritic controls; the decrease in memory CD4 T cells persisted up to 55 weeks of age. BAFF blockade also attenuated the expansion of the CD11b macrophage/DC population in the spleen and this persisted up to 55 weeks. Peripheral blood monocytes expanded from 4.1 +/− 0.5% to 22.8 +/− 10.8% of peripheral blood lymphocytes by 30 weeks; this was not prevented by either BAFF-R-Ig or TACI-Ig (not shown). However peripheral blood monocytes from treated mice expressed lower levels of CD11c at 30 weeks (MFI 479.5 vs. 650.77) in untreated controls; p < 0.01) and this effect persisted at 55 weeks (not shown).

Assessment of renal damage

To determine whether the autoantibodies produced in the treated mice were pathogenic we performed immunofluorescence staining of kidneys from four 40 week old Ad-BAFF-R-Ig treated mice without proteinuria and 25–30 week old proteinuric controls. All four treated mice had extensive immune complex deposition in the glomeruli, no different from untreated controls (Figure 4G, H). Nevertheless, the treated mice had significantly less renal damage than controls (Figure 4H, I and Figure 5A).

Kidneys of nephritic NZM2410 mice had significantly less expression of a set inflammatory markers previously detected in the kidneys of NZB/W F1 mice with proliferative SLE nephritis (9) (Figure 5D). Immunohistochemical analysis confirmed the lack of inflammatory infiltrates previously reported (12) with no difference in the number of renal parenchymal B cell, T cell or CD11c+ cells between young mice and controls with new onset proteinuria (not shown).

To confirm the lack of renal damage in treated mice we performed real-time PCR of 2 informative biomarkers of renal damage, lipocalin2 and havcr1, a biomarker of endothelial activation, VCAM-1 and a biomarker for podocyte loss, nephrin. Control mice had elevated lipocalin2, havcr1 and VCAM-1 expression in the kidneys and decreased expression of nephrin. Treated mice had normal values of these markers even at 55 weeks of age (Figure 5C). Treated mice also had lower serum levels of VCAM-1 at 30 weeks than did controls (1.8 +/−0.2 ug/ml in 8w-old NZM2410; 4.1 +/− 0.4 ug/ml in 30w-old NZM2410; 2.7 +/− 0.2ug/ml in 30w-old Ad-TACI-Ig treated mice; 2.6 +/− 0.6ug/ml in Ad-BAFF-R-Ig treated mice; p< 0.005 treated mice vs. age matched controls).

Resident populations of CD11b+ mononuclear phagocytes in normal murine kidneys are heterogeneous. The major population is F4/80hi/MHChi/CD11cint/Gr1int/CX3CR1hi; these cells are currently referred to as resident renal dendritic cells (rDCs). A second common population is F4/80lo/CX3CR1lo/Gr1hi/Ly6Chi; this is the resident macrophage population (21, 22). One feature of renal damage in NZB/W SLE mice is activation of rDCs, with upregulation of CD11b expression. In addition, a small population of F4/80lo/CD11chi myeloid dendritic cells becomes markedly expanded in nephritic NZB/W kidneys (9). Analysis of kidneys of young NZM2410 mice revealed that their major CD11b+ population manifested the rDC phenotype (Figure 5F). Control NZM2410 mice with proteinuria had marked upregulation of CD11b on rDCs as evidenced both by immunohistochemistry (Figure 4K, L) and flow cytometry. However rDCs from treated 55 week old non-proteinuric mice did not have increased expression of CD11b (Figure 4M and Figure 5). Even kidneys from mice that had proteinuria at the time of treatment and then entered prolonged remission after BAFF blockade had normal CD11b expression on rDCs, comparable to that of young controls. This was confirmed by flow cytometry of isolated renal cells (CD11b MFI 23560 +/− 4234 in treated mice vs. 37713 +/− 10248 in controls; p < 0.001, Figure 5E). Using BrdU feeding we determined that the half-life of renal CD11b+/F4/80lo/CD11chi cells in young NZM2410 mice was 10 days whereas that of the major CD11b+/F4/80hi/CD11cint rDC population was 13 days. Since the number of these cells in the kidney remained constant during the course of this experiment, the rate of BrdU incorporation reflects cell turnover. (Figure 5C). In contrast to nephritic NZB/W mice, the CD11b+/F4/80lo/CD11chi myeloid DC population did not expand in nephritic NZM2410 kidneys.

DISCUSSION

Animal models of lupus nephritis are very useful in elucidating the pathogenesis of renal inflammation and for testing new therapies. Disease in humans is heterogeneous however and it is increasingly recognized that multiple animal models are needed to elucidate disease mechanisms and to evaluate new therapeutic strategies. The promise of BAFF blockade as an effective therapy for SLE warrants an analysis of its mechanism of action in diverse SLE models.

We have performed extensive studies of the mechanism of action of BAFF blockade in two different models of murine lupus [reviewed (23)]. In NZB/W F1 mice that develop proliferative glomerulonephritis similar to human Class IV nephritis, BAFF blockade prevents disease onset but only induces remission when administered together with the T cell costimulatory antagonist CTLA4Ig (14, 17). In male NZW/BXSB mice that overexpress TLR7 and have severe proliferative glomerulonephritis, BAFF blockade attenuates disease but there is no added benefit of CTLA4Ig (24). In both mouse models, consistent with studies in normal mice (25, 26), BAFF blockade depletes transitional type 2, follicular and marginal zone B cells with sparing of germinal center responses, allowing the generation of high affinity pathogenic autoantibodies by somatic mutation. In both models prolonged B cell depletion has significant effects on spleen size. This results in decreased numbers of activated DCs and T cells in treated mice vs. untreated controls, less overall inflammatory burden and therefore less tissue damage. In both models BAFF-R-Ig and TACI-Ig are equally effective. However plasma cells, that express BCMA and TACI but not BAFF-R, are depleted only by TACI-Ig. Short-lived IgM producing plasma cells are more susceptible to depletion by TACI-Ig than are IgG producing plasma cells and TACI-Ig does not deplete long-lived bone marrow plasma cells in either of the lupus models we have studied. This is different to what has been reported in non-autoimmune mice (27) and may reflect the presence of other cytokines that support plasma cell survival in an inflammatory environment. TACI-Ig has also been reported to deplete short-lived IgM and IgG secreting plasma cells from the spleens of lupus prone MRL/lpr mice resulting in disappearance of autoantibodies from the serum (28).

NZM2410 mice are different from other SLE models for several reasons. First, they produce high levels of serum IL-4 and IgG1 autoantibodies (12). Second, they have a defect that delays migration of long-lived plasma cells to the bone marrow and accumulate large numbers of these cells in the spleen (13, 14). Third, these mice have abnormalities in their B cell subsets with loss of marginal zone B cells and an expansion of the B1a subset (19). Fourth, NZM2410 mice develop a non-inflammatory glomerulosclerosis with few inflammatory mediators and infiltrating cells in the kidneys (12). Serum levels of BAFF, as in other SLE strains, increase in NZM2410 mice with age (data not shown).

We show here that a short course of a selective BAFF inhibitor completely prevents disease onset and is also highly effective at inducing complete and long-lasting remission after proteinuria onset in NZM2410 mice. The immediate effects of BAFF blockade were depletion of T2, MZ and follicular B cells and a delay in the generation of the class switched anti-dsDNA response. Because plasma cells are located in the spleens of NZM2410 mice, the contraction of spleen size induced by BAFF blockade resulted in loss of plasma cells and a decrease in total serum IgG. The loss of plasma cell niches appeared to be the major reason for this decrease since there was no difference between serum IgG levels in BAFF-R-Ig and TACI-Ig treated mice despite the more profound plasma cell depletion induced by blockade of both BAFF and APRIL. Homeostatic mechanisms that prolong IgG half-life when serum levels of IgG are low (29) could help explain why the effects on serum levels of total IgG and autoantibodies were not as profound as would be predicted by the decrease in the actual number of antibody forming cells. Even after the inhibitors were no longer present, immune effects persisted for many months including a contraction of the spleen size, attenuation of the expansion of splenic CD11b+ cells and CD4 memory T cells and prolonged B2 cell depletion. Nevertheless, germinal centers continued to generate autoreactive plasma cells that competed effectively for new plasma cell niches in the recovering spleens and produced autoantibodies capable of depositing in renal glomeruli.

It has been postulated that the expanded B1a cell population in NZM2410 mice may be pathogenic because of enhanced antigen presentation function (19); B1a cells were the major splenic B cell subset in the treated mice but were clearly not sufficient to mediate disease. Conversely splenic B1a cells also secrete IL-10 (30), a feature associated with regulatory B cell function (31). The phenotype of regulatory B cells is not fully defined but there was no change in the percentage of CD5+/CD1dhi B cells (32) in the spleens of treated mice (data not shown). It remains to be determined whether the increased ratio of B1a cells (or a regulatory subset of these cells) to B2 cells exerted protective effects in the treated NZM2410 mice.

BAFF blockade also prevented the expansion of splenic CD11b+ cells and prevented the upregulation of CD11b on resident renal CD11b+ cells. Although there was no alteration in the expansion of peripheral blood monocytes that occurs in NZM2410 mice with age, cells from treated mice expressed lower levels of CD11c. Since monocytes and dendritic cells turn over rapidly in the peripheral blood and the spleen (33) and most rDCs turn over in < 30 days in NZM2410 mice, these effects are most likely due to an alteration of the inflammatory environment rather than a direct effect of BAFF inhibition on dendritic cells themselves (34). Although it has been reported that activated monocytes express BAFF receptors (35) we were not able to detect differences in either TACI or BAFF-R expression on isolated renal mononuclear cells from treated and nephritic mice using flow cytometry (not shown).

Despite autoantibody formation and renal immune complex deposition, renal damage was prevented or reversed by a short course of BAFF blockade in NZM2410 mice. We have previously shown in NZB/W mice that the major molecular renal biomarkers of proteinuria onset and of renal remission reflect activation of renal mononuclear phagocytes and endothelial cells (9). These were both attenuated in the treated NZM2410 mice. These findings show that deposition of immune complexes in the kidneys does not inevitably result in tissue damage but that activation of renal effector mechanisms is also required. For example absence of activating Fc receptors on circulating monocytes or caspase inhibition can both completely prevent renal inflammation in SLE mice despite immune complex deposition (36, 37). We have shown that remission of nephritis in NZB/W mice can be induced by a combination of cyclophosphamide and costimulatory blockade despite continued renal immune complex deposition (38).

The data presented here similarly demonstrate that immune complex deposition is not sufficient to cause glomerulosclerosis and proteinuria in NZM2410 mice. Podocyte loss, as assessed by expression of the surrogate marker nephrin, was prevented in treated mice. Thus the glomerular filtration barrier, consisting of podocytes, glomerular endothelial cells and the basement membrane in between (39), was preserved in mice treated with BAFF inhibition. This tripartite structure has a set of highly integrated functions. Podocytes synthesize the glomerular basement membrane and podocyte derived VEGF protects against thrombotic microangiopathy. During inflammation, endothelin released from damaged endothelium injures podocytes and this is further compounded by local hypoxia. Podocyte loss then amplifies the endothelial damage (40). While immune complexes contribute to this process, additional inflammatory signals are likely required. The decrease in the numbers of B cells, that themselves have pro-inflammatory functions, and of activated T cells and dendritic cells may all contribute to the sustained remission in NZM2410 mice treated with BAFF blockade. Our data in sum suggests that strategies for the prevention and treatment of SLE nephritis do not necessarily require autoantibody depletion but should be directed at decreasing systemic inflammation and protecting the local renal cells whose activation is associated with proteinuria onset.

It is clear that BAFF blockade consistently demonstrates the same effects on spleen cell populations and autoantibodies in different murine SLE models, the only exception being the MRL/lpr model in which all the plasma cells derive from an extrafollicular source and are depleted by TACI-Ig (28, 41). We have recently demonstrated similar effects of selective BAFF blockade in humans with depletion of naïve B cells, sparing of memory cells and plasma cells, and only a modest effect on circulating autoantibodies (Jacobi, in press). Despite these similarities, the clinical effect of BAFF blockade on SLE nephritis varies in the different murine models. While prevention of SLE nephritis is achieved by selective blockade of BAFF in all models, treatment of active disease is not always effective. For example, in NZB/W mice with spontaneous disease onset, remission of nephritis is only achieved if BAFF blockade is combined with administration of CTLA4Ig (14). In the same model, when disease is accelerated by Type I IFN, BAFF blockade is beneficial only during the short initiation phase and does not prevent disease onset once autoantibodies are present, even when given before the onset of proteinuria (Liu and Davidson, unpublished).

One reason for the differences observed in different models is that proteinuric NZB/W mice have much higher expression of multiple inflammatory mediators in the kidneys than do proteinuric NZM2410 mice. Thus the clinical outcome of BAFF blockade in nephritis may depend on the presence of other mediators that collaborate with autoantibodies in the effector phase of renal inflammation or with BAFF in the reactivation of memory B cells or in supporting plasma cell survival. This observation has two implications of relevance to the treatment of human SLE. First, BAFF blockade may be most effective as a preventive therapy in patients with quiescent disease after remission induction. Second the presence of inflammatory mediators, for example circulating inflammatory mediators (42) or the interferon signature, may need to be taken into account when examining the outcomes of clinical trials of BAFF inhibition.

Acknowledgments

This work was supported by funds from the New York SLE Foundation (MR and RB) and from NIAMS and NIAID (AD).

References

1. Dooley MA. Clinical and laboratory features of SLE nephritis. In: Wallace DJ, Hahn BH, editors. Dubois Systemic Lupus Erythematosus. 7. Lippincott, Williams and Wilkins; 2007.
2. Lipsky PE. Systemic lupus erythematosus: an autoimmune disease of B cell hyperactivity. Nat Immunol. 2001;2(9):764–6. [PubMed]
3. Cancro MP. The BLyS/BAFF family of ligands and receptors: key targets in the therapy and understanding of autoimmunity. Ann Rheum Dis. 2006;65(Suppl 3):iii34–6. [PMC free article] [PubMed]
4. Thien M, Phan TG, Gardam S, Amesbury M, Basten A, Mackay F, et al. Excess BAFF rescues self-reactive B cells from peripheral deletion and allows them to enter forbidden follicular and marginal zone niches. Immunity. 2004;20(6):785–98. [PubMed]
5. Lesley R, Xu Y, Kalled SL, Hess DM, Schwab SR, Shu HB, et al. Reduced competitiveness of autoantigen-engaged B cells due to increased dependence on BAFF. Immunity. 2004;20(4):441–53. [PubMed]
6. Baccala R, Hoebe K, Kono DH, Beutler B, Theofilopoulos AN. TLR-dependent and TLR-independent pathways of type I interferon induction in systemic autoimmunity. Nat Med. 2007;13(5):543–51. [PubMed]
7. Pers JO, Daridon C, Devauchelle V, Jousse S, Saraux A, Jamin C, et al. BAFF overexpression is associated with autoantibody production in autoimmune diseases. Ann N Y Acad Sci. 2005;1050:34–9. [PubMed]
8. Seyler TM, Park YW, Takemura S, Bram RJ, Kurtin PJ, Goronzy JJ, et al. BLyS and APRIL in rheumatoid arthritis. J Clin Invest. 2005;115(11):3083–92. [PMC free article] [PubMed]
9. Schiffer L, Bethunaickan R, Ramanujam M, Huang W, Schiffer M, Tao H, et al. Activated renal macrophages are markers of disease onset and disease remission in lupus nephritis. J Immunol. 2008;180(3):1938–47. [PMC free article] [PubMed]
10. Bossen C, Schneider P. BAFF, APRIL and their receptors: structure, function and signaling. Semin Immunol. 2006;18(5):263–75. [PubMed]
11. Wallace DJ, Stohl W, Furie RA, Lisse JR, McKay JD, Merrill JT, et al. A phase II, randomized, double-blind, placebo-controlled, dose-ranging study of belimumab in patients with active systemic lupus erythematosus. Arthritis Rheum. 2009;61(9):1168–78. [PMC free article] [PubMed]
12. Singh RR, Saxena V, Zang S, Li L, Finkelman FD, Witte DP, et al. Differential contribution of IL-4 and STAT6 vs STAT4 to the development of lupus nephritis. J Immunol. 2003;170(9):4818–25. [PMC free article] [PubMed]
13. Erickson LD, Lin LL, Duan B, Morel L, Noelle RJ. A genetic lesion that arrests plasma cell homing to the bone marrow. Proc Natl Acad Sci U S A. 2003;100(22):12905–10. Epub 2003 Oct 10. [PMC free article] [PubMed]
14. Ramanujam M, Wang X, Huang W, Liu Z, Schiffer L, Tao H, et al. Similarities and differences between selective and nonselective BAFF blockade in murine SLE. J Clin Invest. 2006;116(3):724–34. [PMC free article] [PubMed]
15. Mihara M, Tan I, Chuzhin Y, Reddy B, Budhai L, Holzer A, et al. CTLA4Ig inhibits T cell-dependent B-cell maturation in murine systemic lupus erythematosus. J Clin Invest. 2000;106(1):91–101. [PMC free article] [PubMed]
16. Shi X, Xie C, Kreska D, Richardson JA, Mohan C. Genetic dissection of SLE: SLE1 and FAS impact alternate pathways leading to lymphoproliferative autoimmunity. J Exp Med. 2002;196(3):281–92. [PMC free article] [PubMed]
17. Ramanujam M, Wang X, Huang W, Schiffer L, Grimaldi C, Akkerman A, et al. Mechanism of action of transmembrane activator and calcium modulator ligand interactor-Ig in murine systemic lupus erythematosus. J Immunol. 2004;173(5):3524–34. [PubMed]
18. Chan O, Madaio MP, Shlomchik MJ. The roles of B cells in MRL/lpr murine lupus. Ann N Y Acad Sci. 1997;815:75–87. [PubMed]
19. Mohan C, Morel L, Yang P, Wakeland EK. Accumulation of splenic B1a cells with potent antigen-presenting capability in NZM2410 lupus-prone mice. Arthritis Rheum. 1998;41(9):1652–62. [PubMed]
20. Gross JA, Dillon SR, Mudri S, Johnston J, Littau A, Roque R, et al. TACI-Ig neutralizes molecules critical for B cell development and autoimmune disease. impaired B cell maturation in mice lacking BLyS. Immunity. 2001;15(2):289–302. [PubMed]
21. Li L, Huang L, Sung SS, Vergis AL, Rosin DL, Rose CE, Jr, et al. The chemokine receptors CCR2 and CX3CR1 mediate monocyte/macrophage trafficking in kidney ischemia-reperfusion injury. Kidney Int. 2008;74(12):1526–37. [PMC free article] [PubMed]
22. Soos TJ, Sims TN, Barisoni L, Lin K, Littman DR, Dustin ML, et al. CX3CR1+ interstitial dendritic cells form a contiguous network throughout the entire kidney. Kidney Int. 2006;70(3):591–6. [PubMed]
23. Ramanujam M, Davidson A. BAFF blockade for Systemic Lupus Erythematosus - will the promise be fulfilled? Immunol Rev. 2008;223:156–174. [PubMed]
24. Kahn P, Ramanujam M, Bethunaickan R, Huang W, Tao H, Madaio MP, et al. Prevention of murine antiphospholipid syndrome by BAFF blockade. Arthritis Rheum. 2008;58(9):2824–34. [PMC free article] [PubMed]
25. Cancro MP. The BLyS family of ligands and receptors: an archetype for niche-specific homeostatic regulation. Immunol Rev. 2004;202:237–49. [PubMed]
26. Rahman ZS, Rao SP, Kalled SL, Manser T. Normal Induction but Attenuated Progression of Germinal Center Responses in BAFF and BAFF-R Signaling-Deficient Mice. J Exp Med. 2003;198(8):1157–1169. [PMC free article] [PubMed]
27. O’Connor BP, Raman VS, Erickson LD, Cook WJ, Weaver LK, Ahonen C, et al. BCMA Is Essential for the Survival of Long-lived Bone Marrow Plasma Cells. J Exp Med. 2004;199(1):91–8. [PMC free article] [PubMed]
28. Liu W, Szalai A, Zhao L, Liu D, Martin F, Kimberly RP, et al. Control of spontaneous B lymphocyte autoimmunity with adenovirus-encoded soluble TACI. Arthritis Rheum. 2004;50(6):1884–96. [PubMed]
29. Ghetie V, Ward ES. Multiple roles for the major histocompatibility complex class I-related receptor FcRn. Annu Rev Immunol. 2000;18:739–66. [PubMed]
30. Blenman KR, Duan B, Xu Z, Wan S, Atkinson MA, Flotte TR, et al. IL-10 regulation of lupus in the NZM2410 murine model. Lab Invest. 2006;86(11):1136–48. [PubMed]
31. Bouaziz JD, Yanaba K, Tedder TF. Regulatory B cells as inhibitors of immune responses and inflammation. Immunol Rev. 2008;224:201–14. [PubMed]
32. Yanaba K, Bouaziz JD, Haas KM, Poe JC, Fujimoto M, Tedder TF. A regulatory B cell subset with a unique CD1dhiCD5+ phenotype controls T cell-dependent inflammatory responses. Immunity. 2008;28(5):639–50. [PubMed]
33. Liu K, Victora GD, Schwickert TA, Guermonprez P, Meredith MM, Yao K, et al. In vivo analysis of dendritic cell development and homeostasis. Science. 2009;324(5925):392–7. [PMC free article] [PubMed]
34. Lai Kwan Lam Q, King Hung Ko O, Zheng BJ, Lu L. Local BAFF gene silencing suppresses Th17-cell generation and ameliorates autoimmune arthritis. Proc Natl Acad Sci U S A. 2008;105(39):14993–8. [PMC free article] [PubMed]
35. Chang SK, Mihalcik SA, Jelinek DF. B lymphocyte stimulator regulates adaptive immune responses by directly promoting dendritic cell maturation. J Immunol. 2008;180(11):7394–403. [PMC free article] [PubMed]
36. Bergtold A, Gavhane A, D’Agati V, Madaio M, Clynes R. FcR-bearing myeloid cells are responsible for triggering murine lupus nephritis. J Immunol. 2006;177(10):7287–95. [PubMed]
37. Seery JP, Cattell V, Watt FM. Cutting edge: amelioration of kidney disease in a transgenic mouse model of lupus nephritis by administration of the caspase inhibitor carbobenzoxy-valyl-alanyl-aspartyl-(beta-o-methyl)-fluoromethylketone. J Immunol. 2001;167(5):2452–5. [PubMed]
38. Schiffer L, Sinha J, Wang X, Huang W, von Gersdorff G, Schiffer M, et al. Short term administration of costimulatory blockade and cyclophosphamide induces remission of systemic lupus erythematosus nephritis in NZB/W F1 mice by a mechanism downstream of renal immune complex deposition. J Immunol. 2003;171(1):489–97. [PubMed]
39. Salmon AH, Neal CR, Harper SJ. New aspects of glomerular filtration barrier structure and function: five layers (at least) not three. Curr Opin Nephrol Hypertens. 2009;18(3):197–205. [PubMed]
40. Shankland SJ. The podocyte’s response to injury: role in proteinuria and glomerulosclerosis. Kidney Int. 2006;69(12):2131–47. [PubMed]
41. Herlands RA, William J, Hershberg U, Shlomchik MJ. Anti-chromatin antibodies drive in vivo antigen-specific activation and somatic hypermutation of rheumatoid factor B cells at extrafollicular sites. Eur J Immunol. 2007;37(12):3339–51. [PMC free article] [PubMed]
42. Bauer JW, Petri M, Batliwalla FM, Koeuth T, Wilson J, Slattery C, et al. Interferon-regulated chemokines as biomarkers of systemic lupus erythematosus disease activity: A validation study. Arthritis Rheum. 2009;60(10):3098–107. [PMC free article] [PubMed]

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

  • Compound
    Compound
    PubChem Compound links
  • MedGen
    MedGen
    Related information in MedGen
  • PubMed
    PubMed
    PubMed citations for these articles
  • Substance
    Substance
    PubChem Substance links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...