Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
Dev Cell. Author manuscript; available in PMC Dec 1, 2010.
Published in final edited form as:
Dev Cell. Jun 15, 2010; 18(6): 973–984.
doi:  10.1016/j.devcel.2010.05.009
PMCID: PMC2908152
NIHMSID: NIHMS217790

Hand2 regulates extracellular matrix remodeling essential for gut-looping morphogenesis in zebrafish

SUMMARY

Extracellular matrix (ECM) remodeling is critical for organogenesis, yet its molecular regulation is poorly understood. In zebrafish, asymmetric migration of the epithelial lateral plate mesoderm (LPM) displaces the gut leftward, allowing correct placement of the liver and pancreas. To observe LPM migration at cellular resolution, we transgenically expressed EGFP under the control of the regulatory sequences of the bHLH transcription factor gene hand2. We found that laminin is distributed along the LPM/gut boundary during gut looping, and that it appears to become diminished by the migrating hand2-expressing cells. Laminin diminishment is necessary for LPM migration and is dependent on matrix metalloproteinase (MMP) activity. Loss of Hand2 function causes reduced MMP activity and prolonged laminin deposition at the LPM/gut boundary, leading to failed asymmetric LPM migration and gut looping. Our study reveals an unexpected role for Hand2, a key regulator of cell specification and differentiation, in modulating ECM remodeling during organogenesis.

INTRODUCTION

The extracellular matrix (ECM) not only provides a scaffold to support organ structure, but also regulates cell-cell communication, proliferation, differentiation, and migration. Within tissues, the ECM constantly undergoes degradation and reassembly (reviewed by Vu and Werb, 2000; Page-McCaw et al., 2007; Daley et al., 2008). Dysregulation of ECM remodeling can lead to tumor progression and other diseases (reviewed by Freije et al., 2003). The basement membrane is a specialized ECM that surrounds epithelial, endothelial, and nerve cells. Cleavage of the basement membrane is conducted by proteases such as matrix metalloproteinases (MMPs) (reviewed by Vu and Werb, 2000), and is important for morphogenetic events such as anchor cell invasion in C. elegans (Sherwood and Sternberg, 2003), imaginal disc eversion in Drosophila (Srivastava et al., 2007), and branching morphogenesis of multiple organs in various species (reviewed by Affolter et al., 2003). Despite the importance of ECM remodeling, only a few signaling pathways and their transcriptional effectors have been reported to regulate this process (Sherwood and Sternberg, 2003; Srivastava et al., 2007).

Visceral organs are surrounded by a basement membrane that mediates mesoderm-endoderm interactions critical for organogenesis. In amniotes and zebrafish, the epithelial lateral plate mesoderm (LPM) determines the chirality of gut looping and thus the asymmetric position of the digestive organs (Horne-Badovinac et al., 2003; Davis et al., 2008; Kurpios et al., 2008). The involvement of ECM remodeling in this process has not yet been addressed.

During zebrafish gut looping, the left LPM migrates dorsal to the gut, and the right LPM migrates ventro-lateral to the gut (Horne-Badovinac et al., 2003), and this asymmetric migration displaces the gut to the left. The asymmetric LPM migration occurs specifically within the gut-looping region, and requires functional left/right gene expression and establishment of epithelial polarity within the LPM (Horne-Badovinac et al., 2003). The cellular and molecular mechanisms that drive LPM migration are poorly understood. Altering components of signaling pathways such as Fgf (Albertson and Yelick, 2005), Bmp (Chocron et al., 2007; Shin et al., 2007), Wnt (Lin and Xu, 2009), and molecules involved in ciliogenesis (Essner et al., 2005), interrupts gut looping. These molecules act upstream of the left/right genes, and thus are more likely to affect the laterality of the asymmetric LPM migration, rather than the actual migratory behavior of the LPM cells. During gut looping, the LPM expresses several transcription factor genes, including the bHLH gene heart and neural crest derivatives expressed transcript 2/hand2 (Angelo et al., 2000; Yelon et al., 2000). Most studies to date have focused on the roles of Hand2 in cell specification and differentiation (Srivastava et al., 1995; Srivastava et al., 1997; Charite et al., 2000; Yamagishi et al., 2000; Yelon et al., 2000; Lucas et al., 2006). We have previously reported that Hand2 regulates the epithelial polarity of myocardial precursors in zebrafish (Trinh et al., 2005). Whether Hand2 also plays a role in cell migration is not known.

Here, we reveal the requirement of ECM remodeling during the asymmetric migration of the LPM in zebrafish. We characterize the LPM migration at a cellular level by examining Tg(hand2:EGFP)pd24 embryos (Kikuchi K. and Poss K.D., in preparation), and uncover the apparent diminishment of laminin deposition by the Tg(hand2:EGFP)-expressing cells at the LPM/gut boundary. We also provide a novel mechanism by which Hand2 regulates laminin assembly and thereby contributes to cell migration and organogenesis.

RESULTS

Examination of the Tg(hand2:EGFP) Line Reveals Novel Cell Rearrangements within the LPM During Gut Looping

To study the cell behaviors underlying LPM migration, we collected Tg(hand2:EGFP) embryos every hour between 24 and 30 hours post fertilization (hpf), and examined EGFP expression in the LPM between the first and third somites, where gut looping occurs (Horne-Badovinac et al., 2003; see Experimental procedures). At 24 hpf, the left and right LPM are located lateral to the gut (Figure 1A). Each side has a U-shaped structure composed of two rows of epithelial cells, with Tg(hand2:EGFP) expression surprisingly restricted to the ventral half. Tg(hand2:EGFP) expression mimics the expression of hand2 mRNA (Figures S1A-B). From 24 to 26 hpf, the left and right LPM converge to the midline by migrating on top of the gut (Figure 1B). Between 26 and 30 hpf, the LPM undergoes asymmetric migration: whereas the right LPM moves ventro-lateral to the gut, the left LPM migrates dorsal to the gut (Figures 1C-F) (Horne-Badovinac et al., 2003).

Figure 1
Examination of Tg(hand2:EGFP) Embryos Reveals Novel Cell Rearrangements during LPM Migration

Interestingly, the distribution of the Tg(hand2:EGFP)-expressing cells also becomes asymmetric (Figures 1C-F): in the right LPM, the ventral half loses 4 Tg(hand2:EGFP)-expressing cells between 24 and 30 hpf, while the dorsal half gains 4 Tg(hand2:EGFP)-expressing cells at its most medial portion (10 embryos per time point were examined). Since cell proliferation or apoptosis rarely occurs within the LPM of the gut-looping region during this period (we observed on average one cell division and one instance of apoptosis out of 6 embryos examined at each time point), we propose that in the right LPM, the 4 medial most Tg(hand2:EGFP)-expressing cells “roll” from the ventral half to the dorsal half (Figure 1F). In the left LPM, however, the ventral half contains 7 Tg(hand2:EGFP)-expressing cells and 4 Tg(hand2:EGFP)-nonexpressing cells throughout the time course of the analysis, suggesting that the cell rearrangement observed in the right LPM does not occur in the left LPM.

Asymmetric LPM migration is controlled by left/right gene expression (Horne-Badovinac et al., 2003). In embryos injected with an antisense morpholino (MO) targeted against the Nodal-related gene southpaw/spaw (Long et al., 2003), the left-specific gene expression in the LPM is abolished, and the directionality of LPM migration and gut looping is randomized (Figure 1H-K; Horne-Badovinac et al., 2003). The rearrangements of the Tg(hand2:EGFP)-expressing cells were randomized in spaw-deficient embryos, suggesting that these cell behaviors are also regulated by left/right gene expression (Figures 1H-K).

By carefully examining Tg(hand2:EGFP) embryos, we discovered novel cell rearrangements within the LPM during gut looping. These behaviors are regulated by left/right gene expression and correlates with the directionality of LPM migration and gut looping.

Bmp Signaling Regulates hand2 Expression in the LPM

Prior to asymmetric LPM migration, Tg(hand2:EGFP) expression is restricted to the ventral half of the LPM within the gut-looping region (Figure 1A). Bmp signaling has been shown to regulate hand2 expression both in vitro and in vivo (Howard et al., 2000; Xiong et al., 2009). In zebrafish, bmp2b is expressed in the LPM (Figure 2A; Chung et al., 2008), and the Bmp antagonist genes chordin and noggin2 are expressed in the ventral portion of the somites directly adjacent to the LPM (Figure 2B; Furthauer et al., 1999). It was thus plausible that bmp2b induced hand2 expression in the LPM, whereas Bmp antagonists in the somites restricted its expression to the ventral half. Consistently, we found that the Tg(hand2:EGFP)-expressing LPM cells expressed higher levels of phosphorylated-Smad (Tucker et al., 2008) than the Tg(hand2:EGFP)-nonexpressing LPM cells, indicating higher levels of Bmp signaling (Figures 2C-E). To further test the relationship between Bmp signaling and hand2 expression, we utilized the Tg(hsp70l:bmp2b)f13 line where bmp2b expression can be induced ectopically by heat-shock treatment (Chocron et al., 2007). When bmp2b overexpression was induced at the 21-somite stage (19.5 hpf), the LPM within the gut-looping region still consisted of two rows of epithelial cells (Figures 2G-H). However, Tg(hand2:EGFP) expression was observed throughout the LPM rather than being restricted ventrally.

Figure 2
Bmp Signaling Regulates hand2 Expression in the LPM

We performed the reverse experiment using the Tg(hsp70l:dnBmpr-EGFP)w30 line to inhibit Bmp signaling (Pyati et al., 2005). When Bmp signaling was blocked at the 21-somite stage, hand2 expression in the LPM was reduced in 68% of the embryos, and absent in the other 32% (Figures 2J-K). Meanwhile, expression of another LPM marker, wnt2bb (Ober et al., 2006), was still present in these embryos (30/30), indicating that the reduction of hand2 expression was not due to a loss of LPM (Figures 2M-N).

It has been shown that Bmp signaling is required during early segmentation for visceral organ laterality (Chocron et al., 2007). We found that manipulation of Bmp signaling at the 5-somite stage affected hand2 expression at least by the 15-somite stage (Figures S1C-E). Consistent with the previous study, these animals rarely exhibited leftward gut looping (Figures S1F-G, L-M). In contrast, over 70% of the embryos underwent leftward gut looping when we altered Bmp signaling at the 21-somite stage (Figures 2F-H, O-Q).

Taken together, the results of these gain- and loss-of-function experiments indicate that Bmp signaling regulates hand2 expression in the LPM.

Hand2 Function Is Required for LPM Migration

Hand2 is a key regulator of cell specification and differentiation, but its role in cell migration has not been addressed. Considering its intriguing expression pattern in the LPM, we asked whether Hand2 was involved in the asymmetric migration of the LPM. We studied gut morphology in hands-off/hanc99 mutants that carry a mutation in the hand2 gene (Yelon et al., 2000). As revealed by expression of the gut marker foxa3 (Chen et al., 2001), the gut has looped to the left in wild-type and hanc99+/− embryos by 35 hpf, but stayed in the midline in 94% of the hanc99 mutants (Figure 3A, upper panel). At 48 hpf, wild-type embryos display asymmetric placement of the liver and pancreas on the left and right side of the gut, respectively. In contrast, 100% of the hanc99 mutants analyzed exhibit duplication of the liver and/or pancreas (Figure 3A, lower panel), a phenotype commonly associated with impaired gut looping (Chen et al., 2001; Horne-Badovinac et al., 2001). We found the same defects in another hand2 allele, hans40−/− (Beis et al., 2005; data not shown).

Figure 3
Hand2 Is Required for Gut Looping and LPM Migration

Asymmetric LPM migration relies on the establishment of epithelial polarity and left/right gene expression (Horne-Badovinac et al., 2003). The hanc99−/− myocardial precursors exhibit polarity defects (Trinh et al., 2005). However, the LPM cells in the gut-looping region adopt a columnar shape with strong apical localization of F-actin, aPKCλ/ζ, and ZO-1 (Figures 3C-H, S2A-B; data not shown), indicating an intact epithelial polarity. To investigate whether loss of Hand2 affects left/right gene expression, we examined spaw expression in hanc99 mutants. At the 20-somite stage (19 hpf), spaw is expressed in the left LPM in wild-type and hanc99+/− embryos, but is absent from the LPM in most hanc99 mutants (Figure 3B), suggesting that Hand2 acts, at least in part, upstream of the left/right genes.

We monitored the behavior of the Tg(hand2:EGFP)-expressing cells in hanc99 mutants. Between 24 and 26 hpf, the LPM converges to the midline and lays on top of the gut, similar to wild-type at equivalent stages (Figures 3C-D). The Tg(hand2:EGFP)-expressing cells are restricted ventrally on both sides, suggesting that the dorsal-ventral patterning of the LPM still occurs in hanc99 mutants. From 27 hpf onwards, whereas the wild-type LPM undergoes asymmetric migration (Figures 1C-E), the LPM in hanc99 mutants remains on top of the gut and does not move any further (Figures 3E-G). None of the Tg(hand2:EGFP)-expressing cells in the left or right LPM “roll” dorsally as seen in wild-type (Figure 3H).

Although hanc99 mutants lack spaw expression in the LPM, their LPM migration defects are distinct from those observed in spaw-deficient embryos: in spaw-deficient embryos, the laterality of the Tg(hand2:EGFP)-expressing cell rearrangements and the asymmetric LPM migration is randomized (Figures 1H-K). However, in hanc99 mutants, the asymmetric cell rearrangements fail to occur and LPM migration is stalled (Figures 3C-H). The different phenotypes of spaw- and hand2-deficient embryos imply that loss of left/right gene expression alone cannot account for the LPM migration defects observed in hanc99 mutants.

hanc99 Embryos Exhibit Prolonged Laminin Deposition along the LPM/Gut Boundary during LPM Migration

In amniotes, left/right asymmetries in ECM molecules within the dorsal mesentery contribute to the chirality of midgut looping (Davis et al., 2008; Kurpios et al., 2008). To explore the role of the ECM in zebrafish gut looping, we analyzed the deposition of laminin, a main component of the basement membrane. In wild-type, punctate laminin expression appears along the LPM/gut boundary by 25 hpf (Figure 4A). As the LPM converges to the midline and undergoes asymmetric migration, laminin expression diminishes along the migratory path of the Tg(hand2:EGFP)-expressing cells (Figures 4B-C, arrows). In contrast, in more than 87% of the hanc99 mutants examined, laminin deposition persisted along the entire LPM/gut boundary, even at the spots immediately adjacent to the Tg(hand2:EGFP)-expressing cells (Figures 4D-F, arrows). This prolonged laminin deposition could be due to altered expression of laminin genes or genes encoding proteins important for laminin assembly, such as Integrins. We FACS-sorted the Tg(hand2:EGFP)-expressing cells from wild-type and hans40−/− embryos at 28 hpf and performed quantitative real-time PCR analysis (Figure S3A). None of the laminin or integrin genes examined showed more than a 2-fold difference in their expression levels between wild-type and hans40 mutants (Figure S3B), suggesting that the prolonged laminin deposition observed in hand2 mutants is not due to altered expression levels of these genes.

Figure 4
hanc99 Mutants Exhibit Prolonged Deposition of Laminin at the LPM/Gut Boundary

We previously reported that Fibronectin (Fn) protein deposition was disorganized and mislocalized in the heart primordium in hand2 mutants (Trinh et al., 2005). Within the gut-looping region, the expression level of the fn1a gene in the LPM seems to be comparable between wild-type and hanc99 mutants (Figures S2C-D), and Fn protein is distributed continuously along the LPM/gut boundary in both wild-type and mutants (Figures S2E-F). Thus, Hand2 appears to specifically regulate laminin diminishment at the LPM/gut boundary.

We next tested whether laminin was required for LPM migration by examining lamininβ1/lamβ1s804 mutants (see Supplemental Information). Laminin appears to be missing at the LPM/gut boundary in these mutants (Figures 4H-J), and in a majority of the animals, both the left and right LPM lay on top of the gut at 30 hpf and the gut fails to loop (Figure 4I), indicating the requirement of laminin in the asymmetric LPM migration.

Given that hanc99 mutants exhibit prolonged laminin deposition along the LPM/gut boundary, we asked whether partial removal of laminin could suppress the LPM migration defects observed in these animals. We identified hanc99 mutants from hanc99+/− or hanc99+/−;lamβ1s804+/− incrosses, and examined foxa3 gene expression at 35 hpf. From the hanc99+/− incrosses, 90% of the hanc99 mutants exhibited no gut looping (Figure 4K). From the hanc99+/−;lamβ1s804+/− incrosses, we analyzed only the hanc99 single mutants that were not also lamβ1s804−/−. 2/3 of them were expected to be lamβ1s804+/− and the rest were lamβ1s804+/+ (see Supplemental Information). Amongst these hanc99 single mutants, 55% exhibited leftward gut looping (Figure 4K), suggesting that reducing laminin protein partially suppresses the gut-looping defects in hanc99 mutants. Notably, another 12% of these hanc99 single mutants exhibited rightward looping, a phenotype that is never observed in the hanc99 mutants from the hanc99+/− incrosses. Thus, Hand2 appears to regulate two separate steps during gut looping: first, the establishment of left/right gene expression and second, the asymmetric migration of the LPM.

ECM Remodeling by MMPs Is Essential for Asymmetric LPM Migration

The fact that hanc99 mutant cells fail to diminish laminin deposition along the LPM/gut boundary prompted us to ask whether ECM remodeling contributes to LPM migration and gut looping. MMPs are proteolytic enzymes that cleave the ECM during various biological processes (reviewed by Vu and Werb, 2000). To investigate whether MMPs are involved in LPM migration, we blocked MMP activity using the pan-MMP inhibitor GM6001 (Bai et al., 2005). To avoid any potential impact on left/right gene expression, we started the treatment at 24 hpf, long after the establishment of left/right gene expression (Long et al., 2003). Treatment with GM6001 from 24 to 30 hpf did not cause any obvious defects in the overall morphology of the embryo (data not shown). However, in 50% of the embryos, both the left and right LPM remained on top of the gut (Figure 5B). We also detected prolonged deposition of laminin along the LPM/gut boundary in these animals (Figure 5C’), whereas the deposition of Fn did not seem to be altered (Figures S2G-H). Therefore, diminishment of laminin deposition by MMPs is necessary for asymmetric migration of the LPM.

Figure 5
Asymmetric LPM Migration Requires the Diminishment of Laminin by MMPs

Hand2 Regulates MMP Activity during LPM Migration

The prolonged laminin deposition and failure of asymmetric LPM migration observed in the MMP inhibitor-treated embryos are strikingly similar to the phenotypes seen in hanc99 mutants (Figures (Figures4F4F and 5C’). It was thus plausible that hanc99 mutants had reduced MMP activity, causing the defects in laminin diminishment and LPM migration. When treated with a low dose of MMP inhibitor, a significantly higher proportion of hanc99 heterozygotes than wild-types showed gut-looping defects (Figure 5D). This observation that hanc99 heterozygotes are more sensitive to MMP inhibition than wild-types supports the hypothesis that Hand2 regulates MMP activity during LPM migration.

To directly assess MMP activity in wild-type and hanc99−/− embryos, we used an in vivo assay based on the injection and in situ degradation of a quenched FITC-conjugated derivative of Type IV collagen (DQ-collagen IV) (Crawford and Pilgrim, 2005), a basement membrane protein. DQ-collagen is heavily fluoresceinated so that it is only weakly fluorescent until proteolytically cleaved. The increase in fluorescence upon digestion is proportional to the proteolytic activity, thus matrix proteolysis can be visualized as an increment in the fluorescence signal.

We injected DQ-collagen into the axial tissue at the level of the 4th somite, one-somite posterior to the gut-looping region (Figure 6A), and examined the fluorescence one hour later. Strong fluorescein signal was observed around tissues that undergo active ECM remodeling (Figure 6B; Crawford and Pilgrim, 2005). We also detected fluorescence along the LPM/gut boundary, indicating the presence of MMP activity (Figures 6B, D, and E). When the MMP inhibitor GM6001 was injected into the embryo prior to DQ-collagen IV injection, the fluorescence signal became almost undetectable, confirming that the conversion to fluorescence is MMP-dependent (Figure 6C).

Figure 6
Loss of Hand2 Function Reduces MMP Activity along the LPM/Gut Boundary

We co-injected DQ-collagen and Alexa549-conjugated collagen into wild-type and hanc99 mutants every hour during the course of gut looping and fixed the animals one hour later. We then measured the fluorescence intensity of the fluorescein at a spot next to the most medial tip of the leading Tg(hand2:EGFP)-expressing cell in the left and right LPM (Figures 6D-E, orange and pink bars). The fluorescence intensity of Alexa549 at the same spot was used as a reference to normalize the fluorescein intensity, allowing a correction for local collagen accumulation (Crawford and Pilgrim, 2005). Throughout the gut-looping process, hanc99 mutants showed a clear reduction in the normalized fluorescence intensity compared to wild-type, indicating decreased MMP activity (Figure 6F).

Expression Levels of mmps and Their Inhibitors Are Altered in hand2 Mutants

Given that hand2 mutants show reduced MMP activity, we decided to examine the expression of the genes encoding MMPs and their inhibitors in these animals by quantitative real-time PCR. Among the mmp genes that are expressed in the Tg(hand2:EGFP)-expressing cells, the expression levels of the genes encoding the gelatinases Mmp2 and Mmp9, collagenase Mmp13, and membrane-bound Mmp14b did not appear to be significantly different between wild-type and mutants (p>0.07, data not shown). However, the expression of the gene encoding membrane-bound Mmp14a was decreased in hand2 mutants (−2.2±0.2 fold, p<0.04), whereas the expression of two tissue inhibitor of metalloproteinase genes, timp2 and timp2b, was increased in the mutants (timp2, 2.3±0.2 fold, p<0.01; timp2b, 2.4±0.3 fold, p<0.03; Figure 7A). We examined the expression of mmp14a, timp2, and timp2b by in situ hybridization, but only observed subtle differences between wild-type and hanc99 mutants (Figure S4), probably due to the low sensitivity of the assay. Tg(hand2:EGFP) is strongly expressed in the fin bud (Figure S3A), yet we detected very low expression levels of these three genes in the fin bud in wild-type or hanc99 mutants (Figures S4). Therefore, the different gene expression levels observed by quantitative real-time PCR are likely caused by differences in the LPM and not in the fin bud.

Figure 7
Expression of mmp Genes and Their Inhibitors Is Altered in hand2 Mutants

To test whether misregulation of MMPs is related to the LPM migration defects in hanc99 mutants, we knocked-down Mmp14a function by injecting MO into wild-type and hanc99+/− embryos (Coyle et al., 2008). Injecting 2.5 ng of a mmp14a MO blocked gut looping in all the wild-type and hanc99+/− embryos examined (data not shown). When 0.5 ng of the MO was injected, a significantly higher proportion of hanc99+/− than wild-type embryos showed gut-looping defects (Figure 7B), suggesting that downregulation of mmp14a contributes to the gut-looping defects observed in hanc99 mutants.

In summary, loss of Hand2 function alters the expression levels of mmps and their inhibitors, likely leading to the observed reduction of MMP activity at the LPM/gut boundary in hand2 mutants.

DISCUSSION

Our study provides new insights into the molecular regulation of ECM remodeling and its role in vertebrate organ morphogenesis. We show that localized diminishment of laminin deposition by MMPs is required for the asymmetric migration of the LPM during zebrafish gut looping. We also identify the bHLH transcription factor Hand2 as a novel regulator of MMP activity in this process.

During tumor invasion and developmental processes such as angiogenesis and bone remodeling, MMP-dependent ECM remodeling releases cells and allows them to migrate (Fisher et al., 1994; Ray and Stetler-Stevenson, 1994; Blavier and Delaisse, 1995). During zebrafish gut looping, ECM remodeling is required for the asymmetric cell rearrangements within the LPM. It is unlikely to be the direct underlying mechanism for the asymmetry since MMP activity is detected in both the left and right LPM. A recent study in Drosophila showed that MMP2 inhibits Fgf signaling during air sac development (Wang et al., 2010). Similarly, MMPs may modulate the activity of growth factors or their receptors by cleaving them or releasing them from the ECM. Such molecules may send signals to guide the asymmetric migration of the LPM. Notably, the “rolling” behavior observed in the right LPM is similar to the cell behaviors underlying the internalization movements during fish and amphibian gastrulation (reviewed by Solnica-Krezel, 2005), and also shows similarities with the collective migration of myoepithelial cells during mammary branching morphogenesis (Ewald et al., 2008). The signaling molecules involved in cell internalization during gastrulation or mammary branching morphogenesis could be candidates for those that are modulated by MMPs during the asymmetric migration of the LPM.

We found that Hand2 regulates two separate aspects of the asymmetric LPM migration (Figure 7C). First, Hand2 plays a unique role in regulating left/right gene expression. Whereas most zebrafish mutants defective in left/right asymmetry show bilateral or randomized expression of left-specific genes (Bisgrove et al., 2000), left-sided gene expression is absent in hand2 mutants. Mutations perturbing two components of Nodal signaling, one-eyed pinhead (oep) (Yan et al., 1999) and schmalspur (sur)/foxh1 (Pogoda et al., 2000), also abolish left-sided gene expression in the LPM (Bisgrove et al., 2000). However, gut looping is randomized in oep and sur mutants, but fails to occur in hand2 mutants. It is not clear how bilaterally expressed hand2 controls left-sided gene expression. Given that oep and sur are both expressed bilaterally in the LPM prior to the onset of left-sided spaw expression (Bisgrove et al., 2000), it will be interesting to investigate whether Hand2 facilitates Nodal signaling by modulating oep and/or sur expression or function.

Subsequently, Hand2 regulates MMP activity essential for the asymmetric migration of the LPM. Expression levels of mmps and timps are altered in hand2 mutants, providing a possible mechanism by which Hand2 mediates MMP activity. While zebrafish appears to contain only a single hand gene (Angelo et al., 2000; Yelon et al., 2000), amniotes contain two partially redundant Hand genes, Hand1 and Hand2 (Cross et al., 1995; Cserjesi et al., 1995; Srivastava et al., 1995). Several lines of evidence have indirectly implicated Hand1 in cell migration and ECM remodeling. In Hand1-null mice, vascular smooth muscle cells fail to be recruited to the yolk sac vasculature (Morikawa and Cserjesi, 2004). Hand1−/− trophoblast stem cells exhibit decreased invasion rates through basement membranes in vitro (Hemberger et al., 2004). And in a screen for putative targets of Hand1 during cardiac morphogenesis in mouse, several genes involved in actin cytoskeleton and ECM remodeling were found to be differentially expressed between wild-type and Hand1 mutants (Smart et al., 2002). It will be interesting to test whether the expression of these genes is also altered in zebrafish hand2 mutants, and whether they also play a role during the asymmetric migration of the LPM.

Hand2 is expressed in a number of cell types that undergo active migration during development (Angelo et al., 2000; Yelon et al., 2000). Upregulation of Hand2 expression has also been reported in pancreatic neoplasm (Cavard et al., 2009). It will be important to investigate whether the regulation of ECM remodeling by Hand2 during zebrafish LPM migration is also employed in other cell migration processes, including metastasis. Similarly, it appears to be important to revisit the described cell fate specification and differentiation defects in Hand mutants (reviewed by Firulli, 2003), and to determine whether they may at least partly be explained by defects in ECM remodeling. These studies should further advance our understanding of ECM remodeling in development and disease.

EXPERIMENTAL PROCEDURES

In situ Hybridization and Immunohistochemistry

Whole-mount in situ hybridization was performed as described (Thisse et al., 1993) using the following probes: fn1a (Trinh and Stainier, 2004), spaw, foxa3, hand2, bmp2b, chordin (Miller-Bertoglio et al., 1997), mmp14a (Coyle et al., 2008), timp2 (Zhang et al., 2003), and timp2b (Coyle et al., 2008). 15 μm cryostat sections were obtained by using a cryostat microtome (Leica). Embryos and sections were photographed with a Zeiss Axioplan using an Axiocam digital camera.

Immunohistochemistry was performed on 150 μm vibratome sections as described (Trinh and Stainier, 2004). To ensure that equivalent tissues were examined, we determined the anterior-posterior position of the transverse sections based on a series of landmarks, including neural tube closure, the presence of lateral line neuromasts and fin buds, and the cellular structure of the pronephric ducts. We used the following antibodies: chick anti-GFP (Aves Labs, Inc.) at 1:1000, rabbit anti-Fibronectin (Sigma) at 1:100, rabbit anti-phosphoSmad1/5/8 (Cell Signaling Technology) at 1:100, mouse anti-ZO-1 (Invitrogen) at 1:200, rabbit anti-laminin (Sigma) at 1:100, and phalloidin (Molecular probes) at 1:100. Sections were imaged on a Zeiss Pascal confocal. To measure the fluorescence intensity of phospho-Smad staining, we encircled individual nuclei labeled by phospho-Smad antibody in ImageJ and measured the mean fluorescence intensity of the area.

Microinjection and DQ-collagen IV Injections

MO microinjections were performed as described (Horne-Badovinac et al., 2001). spaw MO: 5′ - GCACGCTATGACTGGCTGCATTGCG - 3′ (Long et al., 2003); mmp14a MO: 5′-GACGGTACTCAAGTCGGGACACAAA-3′ (Coyle et al., 2008).

Human collagen (Chemicon) was conjugated with an Alexa549 tag using the Dylight fluor antibody labeling kit (Pierce). 1 ng of DQ-collagen substrate and 1 ng of Alexa549-conjugated collagen were co-injected into the embryos as described (Crawford and Pilgrim, 2005). Injection of DQ-collagen IV did not seem to interfere with LPM migration or gut looping. To confirm the MMP-dependence of the observed fluorescence signal, embryos were pre-injected with the MMP inhibitor GM6001, allowed to recover for 30 minutes, and injected again with the DQ-collagen substrate. The fluorescence intensity measurement was conducted in ImageJ. We drew a sharp line at the most medial tip of the leading Tg(hand2:EGFP)-expressing cells (Figures 6D and E, orange and pink bars), and obtained the fluorescence intensity of the fluorescein and Alex549 along this line by using the “Measure” function. The maximum values were used for quantification.

Heat-shock Experiment and Chemical Inhibitor Treatment

Heat-shock treatments of Tg(hsp70l:bmp2b)f13 and Tg(hsp70l:dnBmpr-GFP)w30 embryos were performed as described (Chung et al., 2008).

To inhibit MMP activity, embryos were treated with 10 μM GM6001 (Chemicon) in egg water (Bai et al., 2005). Control embryos from the same batch were treated with 0.4% DMSO in egg water. Statistical analyses were performed using the Student’s two-tailed t-test.

FACS Sorting and Quantitative Real-time PCR

100 Tg(hand2:EGFP) wild-type and 100 hans40 mutants were collected at 28 hpf, with the heads and tails removed. The samples were dissociated in 1 ml 5% FBS/HBSS with Liberase 3 (Roche) at 37°C for 1 hour. The cells were filtered with a 40 μm nylon strainer and the Tg(hand2:EGFP)-expressing cells were sorted using a Becton Dickinson FACS ARIA 2.

Total RNA was extracted and purified using a Qiagen Rneasy micro kit. RNA amplification and cDNA preparation were conducted using WT-Ovation Pico System (NuGen). Optimized primers targeting each gene were designed using the Plexor Primer Design System (Promega; Table S1). 5 ng of each cDNA sample and the appropriate primers were added to Power SYBR Green master mix (Applied Biosystems). The 7900HT Real-Time PCR System (Applied Biosystems) was used to obtain Ct values. The relative expression of each sample was determined after normalization to β-actin using the relative standard curve method (Larionov et al., 2005).

Supplementary Material

01

ACKNOWLEDGEMENTS

We would like to thank Zena Werb, Sally Horne-Badovinac, and Donghun Shin for critical comments, and Stainier lab members for technical advice and discussions. We also thank Deborah Yelon, Joshua Gamse and Jason Jessen for generous gifts of morpholinos, and Bryan Crawford for suggestions on MMP activity assays. We acknowledge Sarah Elmes for assistance with the FACS sorting, the UCSF Genomics Core Facility for conducting quantitative real-time PCR, and Ana Ayala, Koro Brand, and Milagritos Alva for fish care. C.Y. is supported by a JDRF Postdoctoral Fellowship. K.K. is supported by an AHA Postdoctoral Fellowship. This work was supported in part by grants from the NHLBI to K.D.P., and the NIH (DK058181 and DK060322) and the Packard Foundation to D.Y.R.S..

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

REFERENCES

  • Affolter M, Bellusci S, Itoh N, Shilo B, Thiery JP, Werb Z. Tube or not tube: remodeling epithelial tissues by branching morphogenesis. Dev Cell. 2003;4:11–18. [PubMed]
  • Albertson RC, Yelick PC. Roles for fgf8 signaling in left-right patterning of the visceral organs and craniofacial skeleton. Dev Biol. 2005;283:310–321. [PubMed]
  • Angelo S, Lohr J, Lee KH, Ticho BS, Breitbart RE, Hill S, Yost HJ, Srivastava D. Conservation of sequence and expression of Xenopus and zebrafish dHAND during cardiac, branchial arch and lateral mesoderm development. Mech Dev. 2000;95:231–237. [PubMed]
  • Bai S, Thummel R, Godwin AR, Nagase H, Itoh Y, Li L, Evans R, McDermott J, Seiki M, Sarras MP., Jr. Matrix metalloproteinase expression and function during fin regeneration in zebrafish: analysis of MT1-MMP, MMP2 and TIMP2. Matrix Biol. 2005;24:247–260. [PubMed]
  • Beis D, Bartman T, Jin SW, Scott IC, D’Amico LA, Ober EA, Verkade H, Frantsve J, Field HA, Wehman A, et al. Genetic and cellular analyses of zebrafish atrioventricular cushion and valve development. Development. 2005;132:4193–4204. [PubMed]
  • Bisgrove BW, Essner JJ, Yost HJ. Multiple pathways in the midline regulate concordant brain, heart and gut left-right asymmetry. Development. 2000;127:3567–3579. [PubMed]
  • Blavier L, Delaisse JM. Matrix metalloproteinases are obligatory for the migration of preosteoclasts to the developing marrow cavity of primitive long bones. J Cell Sci. 1995;108(Pt 12):3649–3659. [PubMed]
  • Cavard C, Audebourg A, Letourneur F, Audard V, Beuvon F, Cagnard N, Radenen B, Varlet P, Vacher-Lavenu MC, Perret C, et al. Gene expression profiling provides insights into the pathways involved in solid pseudopapillary neoplasm of the pancreas. J Pathol. 2009;218:201–209. [PubMed]
  • Charite J, McFadden DG, Olson EN. The bHLH transcription factor dHAND controls Sonic hedgehog expression and establishment of the zone of polarizing activity during limb development. Development. 2000;127:2461–2470. [PubMed]
  • Chen JN, van Bebber F, Goldstein AM, Serluca FC, Jackson D, Childs S, Serbedzija G, Warren KS, Mably JD, Lindahl P, et al. Genetic steps to organ laterality in zebrafish. Comp Funct Genomics. 2001;2:60–68. [PMC free article] [PubMed]
  • Chocron S, Verhoeven MC, Rentzsch F, Hammerschmidt M, Bakkers J. Zebrafish Bmp4 regulates left-right asymmetry at two distinct developmental time points. Dev Biol. 2007;305:577–588. [PubMed]
  • Chung WS, Shin CH, Stainier DY. Bmp2 signaling regulates the hepatic versus pancreatic fate decision. Dev Cell. 2008;15:738–748. [PMC free article] [PubMed]
  • Coyle RC, Latimer A, Jessen JR. Membrane-type 1 matrix metalloproteinase regulates cell migration during zebrafish gastrulation: evidence for an interaction with non-canonical Wnt signaling. Exp Cell Res. 2008;314:2150–2162. [PubMed]
  • Crawford BD, Pilgrim DB. Ontogeny and regulation of matrix metalloproteinase activity in the zebrafish embryo by in vitro and in vivo zymography. Dev Biol. 2005;286:405–414. [PubMed]
  • Cross JC, Flannery ML, Blanar MA, Steingrimsson E, Jenkins NA, Copeland NG, Rutter WJ, Werb Z. Hxt encodes a basic helix-loop-helix transcription factor that regulates trophoblast cell development. Development. 1995;121:2513–2523. [PubMed]
  • Cserjesi P, Brown D, Lyons GE, Olson EN. Expression of the novel basic helix-loop-helix gene eHAND in neural crest derivatives and extraembryonic membranes during mouse development. Dev Biol. 1995;170:664–678. [PubMed]
  • Daley WP, Peters SB, Larsen M. Extracellular matrix dynamics in development and regenerative medicine. J Cell Sci. 2008;121:255–264. [PubMed]
  • Davis NM, Kurpios NA, Sun X, Gros J, Martin JF, Tabin CJ. The chirality of gut rotation derives from left-right asymmetric changes in the architecture of the dorsal mesentery. Dev Cell. 2008;15:134–145. [PMC free article] [PubMed]
  • Essner JJ, Amack JD, Nyholm MK, Harris EB, Yost HJ. Kupffer’s vesicle is a ciliated organ of asymmetry in the zebrafish embryo that initiates left-right development of the brain, heart and gut. Development. 2005;132:1247–1260. [PubMed]
  • Ewald AJ, Brenot A, Duong M, Chan BS, Werb Z. Collective epithelial migration and cell rearrangements drive mammary branching morphogenesis. Dev Cell. 2008;14:570–581. [PMC free article] [PubMed]
  • Fisher C, Gilbertson-Beadling S, Powers EA, Petzold G, Poorman R, Mitchell MA. Interstitial collagenase is required for angiogenesis in vitro. Dev Biol. 1994;162:499–510. [PubMed]
  • Freije JM, Balbin M, Pendas AM, Sanchez LM, Puente XS, Lopez-Otin C. Matrix metalloproteinases and tumor progression. Adv Exp Med Biol. 2003;532:91–107. [PubMed]
  • Furthauer M, Thisse B, Thisse C. Three different noggin genes antagonize the activity of bone morphogenetic proteins in the zebrafish embryo. Dev Biol. 1999;214:181–196. [PubMed]
  • Hemberger M, Hughes M, Cross JC. Trophoblast stem cells differentiate in vitro into invasive trophoblast giant cells. Dev Biol. 2004;271:362–371. [PubMed]
  • Horne-Badovinac S, Lin D, Waldron S, Schwarz M, Mbamalu G, Pawson T, Jan Y, Stainier DY, Abdelilah-Seyfried S. Positional cloning of heart and soul reveals multiple roles for PKC lambda in zebrafish organogenesis. Curr Biol. 2001;11:1492–1502. [PubMed]
  • Horne-Badovinac S, Rebagliati M, Stainier DY. A cellular framework for gut-looping morphogenesis in zebrafish. Science. 2003;302:662–665. [PubMed]
  • Howard MJ, Stanke M, Schneider C, Wu X, Rohrer H. The transcription factor dHAND is a downstream effector of BMPs in sympathetic neuron specification. Development. 2000;127:4073–4081. [PubMed]
  • Kurpios NA, Ibanes M, Davis NM, Lui W, Katz T, Martin JF, Belmonte JC, Tabin CJ. The direction of gut looping is established by changes in the extracellular matrix and in cell:cell adhesion. Proc Natl Acad Sci U S A. 2008;105:8499–8506. [PMC free article] [PubMed]
  • Larionov A, Krause A, Miller W. A standard curve based method for relative real time PCR data processing. BMC Bioinformatics. 2005;6:62. [PMC free article] [PubMed]
  • Lin X, Xu X. Distinct functions of Wnt/beta-catenin signaling in KV development and cardiac asymmetry. Development. 2009;136:207–217. [PubMed]
  • Long S, Ahmad N, Rebagliati M. The zebrafish nodal-related gene southpaw is required for visceral and diencephalic left-right asymmetry. Development. 2003;130:2303–2316. [PubMed]
  • Lucas ME, Muller F, Rudiger R, Henion PD, Rohrer H. The bHLH transcription factor hand2 is essential for noradrenergic differentiation of sympathetic neurons. Development. 2006;133:4015–4024. [PubMed]
  • Miller-Bertoglio VE, Fisher S, Sanchez A, Mullins MC, Halpern ME. Differential regulation of chordin expression domains in mutant zebrafish. Dev Biol. 1997;192:537–550. [PubMed]
  • Morikawa Y, Cserjesi P. Extra-embryonic vasculature development is regulated by the transcription factor HAND1. Development. 2004;131:2195–2204. [PubMed]
  • Ober EA, Verkade H, Field HA, Stainier DY. Mesodermal Wnt2b signalling positively regulates liver specification. Nature. 2006;442:688–691. [PubMed]
  • Page-McCaw A, Ewald AJ, Werb Z. Matrix metalloproteinases and the regulation of tissue remodelling. Nat Rev Mol Cell Biol. 2007;8:221–233. [PMC free article] [PubMed]
  • Pogoda HM, Solnica-Krezel L, Driever W, Meyer D. The zebrafish forkhead transcription factor FoxH1/Fast1 is a modulator of nodal signaling required for organizer formation. Curr Biol. 2000;10:1041–1049. [PubMed]
  • Pyati UJ, Webb AE, Kimelman D. Transgenic zebrafish reveal stage-specific roles for Bmp signaling in ventral and posterior mesoderm development. Development. 2005;132:2333–2343. [PubMed]
  • Ray JM, Stetler-Stevenson WG. The role of matrix metalloproteases and their inhibitors in tumour invasion, metastasis and angiogenesis. Eur Respir J. 1994;7:2062–2072. [PubMed]
  • Sherwood DR, Sternberg PW. Anchor cell invasion into the vulval epithelium in C. elegans. Dev Cell. 2003;5:21–31. [PubMed]
  • Shin D, Shin CH, Tucker J, Ober EA, Rentzsch F, Poss KD, Hammerschmidt M, Mullins MC, Stainier DY. Bmp and Fgf signaling are essential for liver specification in zebrafish. Development. 2007;134:2041–2050. [PubMed]
  • Smart N, Hill AA, Cross JC, Riley PR. A differential screen for putative targets of the bHLH transcription factor Hand1 in cardiac morphogenesis. Gene Expr Patterns. 2002;2:61–67. [PubMed]
  • Solnica-Krezel L. Conserved patterns of cell movements during vertebrate gastrulation. Curr Biol. 2005;15:R213–228. [PubMed]
  • Srivastava A, Pastor-Pareja JC, Igaki T, Pagliarini R, Xu T. Basement membrane remodeling is essential for Drosophila disc eversion and tumor invasion. Proc Natl Acad Sci U S A. 2007;104:2721–2726. [PMC free article] [PubMed]
  • Srivastava D, Cserjesi P, Olson EN. A subclass of bHLH proteins required for cardiac morphogenesis. Science. 1995;270:1995–1999. [PubMed]
  • Srivastava D, Thomas T, Lin Q, Kirby ML, Brown D, Olson EN. Regulation of cardiac mesodermal and neural crest development by the bHLH transcription factor, dHAND. Nat Genet. 1997;16:154–160. [PubMed]
  • Thisse C, Thisse B, Schilling TF, Postlethwait JH. Structure of the zebrafish snail1 gene and its expression in wild-type, spadetail and no tail mutant embryos. Development. 1993;119:1203–1215. [PubMed]
  • Trinh LA, Stainier DY. Fibronectin regulates epithelial organization during myocardial migration in zebrafish. Dev Cell. 2004;6:371–382. [PubMed]
  • Trinh LA, Yelon D, Stainier DY. Hand2 regulates epithelial formation during myocardial diferentiation. Curr Biol. 2005;15:441–446. [PubMed]
  • Tucker JA, Mintzer KA, Mullins MC. The BMP signaling gradient patterns dorsoventral tissues in a temporally progressive manner along the anteroposterior axis. Dev Cell. 2008;14:108–119. [PMC free article] [PubMed]
  • Vu TH, Werb Z. Matrix metalloproteinases: effectors of development and normal physiology. Genes Dev. 2000;14:2123–2133. [PubMed]
  • Wang Q, Uhlirova M, Bohmann D. Spatial restriction of FGF signaling by a matrix metalloprotease controls branching morphogenesis. Dev Cell. 2010;18:157–164. [PubMed]
  • Xiong W, He F, Morikawa Y, Yu X, Zhang Z, Lan Y, Jiang R, Cserjesi P, Chen Y. Hand2 is required in the epithelium for palatogenesis in mice. Dev Biol. 2009;330:131–141. [PMC free article] [PubMed]
  • Yamagishi H, Olson EN, Srivastava D. The basic helix-loop-helix transcription factor, dHAND, is required for vascular development. J Clin Invest. 2000;105:261–270. [PMC free article] [PubMed]
  • Yan YT, Gritsman K, Ding J, Burdine RD, Corrales JD, Price SM, Talbot WS, Schier AF, Shen MM. Conserved requirement for EGF-CFC genes in vertebrate left-right axis formation. Genes Dev. 1999;13:2527–2537. [PMC free article] [PubMed]
  • Yelon D, Ticho B, Halpern ME, Ruvinsky I, Ho RK, Silver LM, Stainier DY. The bHLH transcription factor hand2 plays parallel roles in zebrafish heart and pectoral fin development. Development. 2000;127:2573–2582. [PubMed]
  • Zhang J, Bai S, Tanase C, Nagase H, Sarras MP., Jr. The expression of tissue inhibitor of metalloproteinase 2 (TIMP-2) is required for normal development of zebrafish embryos. Dev Genes Evol. 2003;213:382–389. [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

  • Gene
    Gene
    Gene links
  • Gene (nucleotide)
    Gene (nucleotide)
    Records in Gene identified from shared sequence links
  • GEO Profiles
    GEO Profiles
    Related GEO records
  • HomoloGene
    HomoloGene
    HomoloGene links
  • Pathways + GO
    Pathways + GO
    Pathways, annotations and biological systems (BioSystems) that cite the current article.
  • PubMed
    PubMed
    PubMed citations for these articles
  • Substance
    Substance
    PubChem Substance links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...