• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
Mol Immunol. Author manuscript; available in PMC Jun 29, 2010.
Published in final edited form as:
PMCID: PMC2893544
NIHMSID: NIHMS80585

Btk regulates localization, in vivo activation, and class switching of anti-DNA B cells

Abstract

The autoimmune disease systemic lupus erythematosus (SLE) is characterized by loss of tolerance to nuclear antigens such as chromatin, DNA, and RNA. This focused autoreactivity is thought to arise from the ability of DNA or RNA specific B cells to receive dual signals from the BCR and TLR9 or TLR7, respectively. The Tec kinase Btk is necessary for the production of anti-DNA antibodies in several murine models of SLE. To assess the role of Btk in the fate of DNA reactive B cells, we generated Btk−/− mice carrying the 56R anti-DNA Ig transgene on the C57BL/6 background. dsDNA specific B cells were present in 56R.Btk−/− mice, although they were not preferentially localized to the marginal zone. These cells were able to proliferate in response to large CpG DNA containing fragments that require BCR-induced internalization to access TLR9. However, anti-DNA antibodies were not observed in the serum of 56R.Btk−/− mice. A transgene expressing a low level of Btk in B cells (Btklo) restored anti-DNA IgM in these mice. This correlated with partial rescue of proliferative response to BCR engagement and TLR9-induced IL-10 secretion in Btklo B cells. anti-DNA IgG was not observed in 56R.Btklo mice, however. This was likely due, at least in part, to a role for Btk in controlling the expression of T-bet and AID in cells stimulated with CpG DNA. Thus, Btk is required for the initial loss of tolerance to DNA and the subsequent production of pathogenic autoantibodies once tolerance is breached.

Keywords: B cells, Systemic Lupus Erythematosus, Autoantibodies, Transgenic/Knockout Mice, Protein Kinases

Introduction

The autoimmune disease systemic lupus erythematosus (SLE) is characterized by loss of tolerance to nuclear antigens such as chromatin, DNA, and RNA (Plotz, 2003). This results in autoantibody production, immune complex deposition, inflammation, and end organ damage. Current therapy for SLE involves relatively nonspecific immunosuppression with undesirable side effects. Thus, a thorough understanding of the mechanisms controlling the development and activation of nucleic acid reactive B cells may lead to the identification of novel therapeutic targets for SLE.

The focused autoreactivity towards nuclear antigens in SLE is likely explained by the recent observation that B cells specific for DNA or RNA containing antigens can be activated by signals from both the BCR and TLR9 or TLR7, respectively (Leadbetter et al., 2002; Viglianti et al., 2003; Marshak-Rothstein et al., 2004; Lau et al., 2005). In addition to directly activating anti-DNA or anti-RNA B cells, the binding of DNA or RNA containing antigen to the BCR leads to receptor internalization and delivery of antigen to intracellular compartments containing TLR9 and TLR7. TLR signaling in B cells induces proliferation, differentiation into plasma cells, and the secretion of cytokines (Peng, 2005). In addition, dual BCR/TLR9 engagement promotes events such as production of the growth factor IL-2 that do not occur when either receptor signals alone (Busconi et al., 2007).

Two related site-directed anti-DNA IgH transgenes have been widely used to generate DNA-reactive B cells in mice and study their development and regulation. The 3H9 transgene can contribute to anti-dsDNA, anti-ssDNA, and non-auto antibodies when paired with the appropriate light chains (Radic et al., 1991). A second transgene, 56R, is a mutated version of 3H9 that has a stronger affinity for DNA and produces antibodies against dsDNA more frequently than 3H9 (Chen et al., 1994). Tolerance to DNA is maintained in 3H9 transgenic mice on a Balb/c background such that no anti-DNA antibodies are produced. In contrast, Balb/c 56R mice generate low levels of anti-DNA IgM, while C57BL/6 56R (B6.56R) mice produce both IgM and IgG against ssDNA and dsDNA (Li et al., 2002; Sekiguchi et al., 2003; Fukuyama et al., 2005; Sekiguchi et al., 2006).

Anti-DNA B cells in 56R mice are localized preferentially to the marginal zone (Li et al., 2002a; Li et al., 2002b; Sekiguchi et al., 2006). This was initially proposed as a mechanism of tolerance (Li et al., 2002a; Li et al., 2002b). However, recent reports demonstrating rapid activation and differentiation of marginal zone B cells in response to TLR ligands (Fairfax et al., 2007; Genestier et al., 2007) suggest that localization of anti-DNA B cells to this compartment may actually lead to autoantibody production in B6.56R mice. Once tolerance to DNA is lost in these animals, the generation of pathogenic anti-DNA IgG is promoted by TLR9 signaling (Ehlers et al., 2006) and limited by the inhibitory receptor FcγRIIb (Fukuyama et al., 2005).

The Tec family kinase Btk is an important component of BCR signaling pathways (Khan et al., 1995; Satterthwaite and Witte, 2000). It is necessary for the production of autoantibodies, including anti-DNA antibodies, in a number of murine models of SLE (Steinberg et al., 1982; Golding et al., 1983; Scribner et al., 1987; Seldin et al., 1987; Satterthwaite et al., 1998; Takeshita et al., 1998; Whyburn et al., 2003). We have shown that at least some of the contribution of Btk to autoimmunity is independent of its role in transmitting BCR signals (Whyburn et al., 2003). While studies in humans indicate that Btk is not required for the development of anti-DNA B cells (Ng et al., 2004), the role of Btk in the determining the fate of these cells has not been studied in detail.

To study the contribution of Btk to the development, activation, and localization of anti-DNA B cells, we generated 56R.Btk−/− mice on a C57BL/6 background. dsDNA-specific B cells were present in 56R.Btk−/− mice, although they were not preferentially localized to the marginal zone. anti-DNA antibodies were not observed in the serum of 56R.Btk−/− mice, however. A transgene expressing a low level of Btk in B cells (Satterthwaite et al., 1997) restored anti-DNA IgM, but not anti-DNA IgG, in these mice. Thus, Btk is required for both the initial loss of tolerance to DNA and the subsequent production of pathogenic autoantibodies once tolerance is breached.

Materials and Methods

Mice

Mice were on the C57BL/6 background. 56R anti-DNA IgH knock-in mice (Li et al., 2001, Sekiguchi et al., 2006), a gift of Dr. Martin Weigert via Dr. Chandra Mohan, were crossed to Btk−/− (Khan et al., 1995) and Btklo (Satterthwaite et al., 1997) mice. Mice were genotyped by PCR. Anti-DNA antibodies were measured in and hybridomas generated from 6–12 month old mice in order to ensure that a lack of autoantibodies in 56R.Btk−/− mice was not due simply to a delay in loss of tolerance. All other experiments used 3–6 month old mice to identify intrinsic differences in responses that might lead to or affect subsequent loss of tolerance and thus should precede the appearance of autoantibodies. All procedures were approved by the UT Southwestern Institutional Animal Care and Use Committee.

B cell purification

Splenocytes were depleted of red blood cells by a 5 min incubation in 0.15M NH4Cl, 1 mM KHCO3, 0.1 mM Na2EDTA. B cells were then purified using negative selection with anti-CD43 magnetic beads (Miltenyi Biotec) according to the manufacturer’s instructions.

Reagents for B cell activation

Goat-anti-mouse IgM F(ab)’2 fragments (Jackson Immunoresearch) were used to crosslink the BCR. Plasmids containing the CG50 and HIV(CG+) fragments were a gift of Dr. Greg Viglianti (Viglianti et al., 2003). They were amplified in the dam/dcm E. coli strain GM2163 (New England Biolabs) to ensure that CpG sequences were hypomethylated. DNA was prepared using Qiagen Endo-Free Maxi kit to eliminate endotoxin contamination. The CG50 and HIV(CG+) fragments were excised by digesting with BamHI and EcoRI. Phosphorothiorate-modified stimulatory oligodeoxynucleotide (ODN) 1826 5’ TCCATGACGTTCCTGACGTT 3’ (Yi et al., 1998) and inhibitory ODN 2088 5’ TCCTGGCGGGGAAGT 3’ (Lenert et al., 2001) were obtained from Oligo’s Etc.

B cell proliferation

Purified B cells were plated in 96 well plates at 106/ml in RPMI + 10% fetal calf serum. Cells were incubated with media alone, 2 or 20 ug/ml anti-IgM F(ab)’2 fragments, 0.1 or 1 ug/ml ODN 1826, 0.1 ug/ml CG50 fragment +/− 4 ug/ml ODN 2088, or 0.1 ug/ml HIV (CG+) fragment. Proliferation was measured by 3H-thymidine incorporation during the final 6–12 hours of a 36–48 hour culture.

B cell differentiation

Purified B cells were cultured at 5 × 105/ml in RPMI + 10% fetal calf serum with or without 1 ug/ml ODN 1826 for 72 or 96 hours. Cultured cells and supernatants were harvested for flow cytometry and ELISA as described below.

Real time PCR

Purified B cells were cultured at 106/ml in RPMI + 10% fetal calf serum with 15 ug/ml anti-IgM F(ab)’2 fragments, 1 ug/ml ODN 1826, or both for 6 or 24 hours. Total RNA was prepared using the RNeasy kit (Qiagen). cDNA was generated with a cDNA Archive Kit (Applied Biosystems). Real-time PCR was preformed in an Applied Biosystems 7300 Real Time PCR system using TaqMan reagents specific for mouse IL-2, Tbx21 (T-bet), Aicda (AID) and the internal control GAPDH (Applied Biosystems). Data were normalized to GAPDH using the delta comparative threshold cycle (Ct) method.

Flow cytometry

Single cell suspensions of red-blood cell depleted splenocytes or cultured cells were incubated in PBS + 2 % FCS with various combinations of antibodies against the following molecules or isotype controls: B220-PerCP, CD21-FITC, CD23-PE, IgMa-PE, Igλ-biotin + streptavidin APC, CD138-biotin + streptavidin APC, CD86-biotin + streptavidin APC. All antibodies were obtained from BD Pharmingen except streptavidin APC (Caltag). Samples were run on a Becton-Dickinson FACS Calibur and analyzed using Cellquest software. Live cells were gated based on FSC and SSC.

Hybridoma production

Total splenocytes were stimulated with 20 ug/ml LPS (Sigma) for 1 to 5 days and then fused to SP2/0 myeloma cells as described in (Fukuyama et al., 2005; Sekiguchi et al., 2006). Hybridomas were selected via growth in HAT media.

ELISA

Autoantibodies

anti-ssDNA and dsDNA ELISAs were performed as described in (Whyburn et al., 2003) using serial dilutions of serum or hybridoma culture supernatant.

Total Ig

Total IgM and IgG were measured as described in (Whyburn et al., 2003) using serial dilutions of culture media from stimulated B cells or hybridoma supernatants.

IL-10

Purified splenic B cells were stimulated with media alone or 1 ug/ml ODN 1826 (Oligo’s Etc.) for 24 hrs. IL-10 levels were measured in culture supernatants using a commercially available ELISA assay (Becton Dickinson).

BCR Internalization

Single cell suspensions of red-blood cell depleted splenocytes were stained on ice with FITC-labeled donkey anti-mouse Ig (H+L) F(ab)’2 fragments in PBS + 5% fetal calf serum. Stained cells were warmed to 37° to induce BCR signaling and internalization. The reaction was stopped at various time points by the addition of 20 volumes of ice cold PBS + 5% fetal calf serum + azide. The mean fluorescence intensity of FITC+ cells was determined by flow cytometry. Internalization of the BCR is accompanied by a reduction in fluorescence due to entry of the FITC label into acidic compartments (Aluvihare et al., 1997).

Statistics

Groups were compared by Student’s t-test.

Results

To study the role of Btk in the development, activation, and localization of anti-DNA B cells, we generated 56R.Btk−/− mice on a C57BL/6 background. A similar number of B220+ cells was observed in the spleens of 3–6 month old 56R and 56R.Btk−/−mice (1.47 × 107 vs. 1.09 × 107, p = 0.49), and a similar frequency of B cells expressed the 56R transgene (Figure 1a). Skewing of 56R expressing B cells to the marginal zone compartment (Li et al., 2002a; Li et al., 2002b; Sekiguchi et al., 2006) was not observed in the absence of Btk (Figure 1b,d), however. This was not due to a general requirement for Btk in the development of marginal zone B cells, as the frequency of cells in this compartment was normal in Btk−/− mice in the absence of the 56R transgene (Figure 1b,d) (Martin and Kearney, 2000; Cariappa et al., 2001). Nor is it due to a lack of anti-DNA B cells in Btk−/− spleens, as Btk is required for the preferential localization to the marginal zone of cells expressing both the 56R transgene and Igλ, a combination known to confer DNA-reactivity (Figure 1c,d) (Chen et al., 1994; Li et al., 2002a; Li et al., 2002b).

Figure 1
B cells with potential for anti-DNA reactivity are present in 56R.Btk−/− but are not preferentially localized to the marginal zone

The presence of DNA reactive cells in 56R.Btk−/− mice was directly demonstrated by generating hybridomas from LPS-stimulated splenocytes. 74 IgM secreting hybridomas were obtained from a total of two 56R mice, of which 66 (89%) were specific for dsDNA. 2 of 19 (11%) IgG secreting hybridomas produced anti-dsDNA antibodies. This is consistent with previous results from 56R mice on the B6 background (Fukuyama et al., 2005; Sekiguchi et al., 2006). Anti-DNA B cells were also present in the absence of Btk, although at a reduced frequency. 41% (27 of 65) of IgM secreting hybridomas obtained from a total of 3 56R.Btk−/− mice produced antibodies against dsDNA, while none of the 10 IgG secreting hybridomas were dsDNA-specific.

Btk is required for proliferation in response to antigen engagement (Khan et al., 1995). However, BCR-mediated shuttling of antigen to TLR9 is sufficient to induce TLR9-dependent proliferation of B cells in the absence of apparent BCR crosslinking (Viglianti et al., 2003). This suggests that DNA containing antigens might be able to stimulate the activation of Btk−/− anti-DNA B cells via TLR9 despite the lack of a mitogenic signal from the BCR. To address this issue, we first used the diffusible CpG containing ODN 1826 to assess the role of Btk in responses to TLR9 (Leadbetter et al., 2002; Viglianti et al., 2003; Marshak-Rothstein et al., 2004). Btk−/− B cells were able to proliferate, upregulate CD86, and differentiate in response to 1 ug/ml ODN 1826 (Figure 2a–d, Figure 3a). However, a six-fold reduction in the secretion of IL-10 by B cells in response to TLR9 engagement was observed in the absence of Btk (Figure 2e), consistent with recent reports published during the preparation of this manuscript (Hasan et al., 2008; Lee et al., 2008).

Figure 2
Btk−/− B cells proliferate and differentiate in response to CpG DNA but demonstrate impaired upregulation of IL-10
Figure 3
Btk is required for some, but not all, interactions between BCR and TLR9 signals

We next asked whether Btk promotes interactions between antigen and CpG DNA induced signals. Low doses of anti-IgM and ODN 1826 were unable to synergize to promote proliferation of Btk−/− B cells as they did in wild type cells (Figure 3a). In addition to promoting proliferation, however, engagement of both the BCR and TLR9 results in functional consequences distinct from the sum of those elicited by stimulation of either receptor alone (Busconi et al., 2007). Of particular interest is the upregulation of IL-2, which promotes the growth of both B and T cells and may serve to amplify the immune response to DNA containing antigens. Btk−/− cells incubated with anti-IgM plus ODN 1826 had IL-2 mRNA levels approaching those seen in wild type cells stimulated with both reagents (Figure 3b). Synergy between BCR and TLR9 signaling was also observed visually in Btk−/− B cells. Together, but not alone, anti-IgM and ODN 1826 induced homotypic adhesion of Btk−/− B cells (Figure 3c). Thus, despite the lack of a mitogenic response from the BCR, Btk−/− cells are able to transmit some BCR signals that interact with TLR9 signals.

Although ODN 1826 can access TLR9 directly, the larger fragments of DNA likely to activate anti-DNA B cells in vivo must be delivered to TLR9 by the BCR (Leadbetter et al., 2002; Viglianti et al., 2003). To determine whether Btk−/− B cells are able to internalize the BCR, FITC-labeled anti-IgM was used to both induce and measure BCR internalization. Over time, the mean fluorescence intensity of IgM+ cells from both wild type and Btk−/− B cells was reduced (Figure 4a), indicating quenching of fluorescence upon delivery of FITC to intracellular compartments with low pH (Aluvihare et al, 1997).

Figure 4
56R B cells proliferate in response to CpG-containing DNA fragments independently of Btk

A large DNA fragment containing tandem repeats of hypomethylated CpG sequences (CG50) was used to stimulate anti-DNA B cells. This fragment induces TLR9-dependent proliferation of B cells from mice expressing the 3H9 anti-DNA IgH transgene in a manner dependent on the shuttling function of the BCR (Viglianti et al., 2003; Marshak-Rothstein et al., 2004). Similarly, CG50 stimulation induced a mitogenic response in 56R B cells that required the presence of the 56R transgene (Figure 4b). CG50 induced proliferation was prevented by the inhibitory CpG ODN 2088 (Figure 4b). A DNA fragment of similar size containing non-immunostimulatory CpG sequences (HIV-CG+) (Viglianti et al., 2003) did not induce this response. CG50-induced proliferation of 56R B cells was comparable in magnitude to the response elicited by anti-IgM (Figure 4b) as was observed for 3H9 B cells (Viglianti et al., 2003). Interestingly, anti-IgM induced proliferation of 56R B cells was significantly reduced compared to non-transgenic B cells (Figure 4b). This suggests that a large proportion of 56R B cells may be anergic as a result of their autoreactivity.

B cells from 56R.Btk−/− mice proliferated in the presence of CG50, but not CG50 + ODN 2088, HIV-CG+, or anti-IgM (Figure 4c). Btk−/− B cells without the 56R transgene did not respond to CG50. The reduction in the absolute response of 56R.Btk−/−B cells to CG50 compared to 56R B cells is likely explained by the two fold reduction in frequency of DNA-reactive cells and/or the lack of a mitogenic signal from the BCR in the absence of Btk. However, the stimulation index (CG50/media) for 56R.Btk−/− cells was actually greater than that of 56R cells (Figure 4d). Thus, the ability of 56R.Btk−/− B cells to proliferate upon stimulation with the CG50 fragment confirms the presence of anti-DNA B cells in these mice and shows that they can be at least partially activated by large DNA fragments in the absence of a mitogenic signal from the BCR.

To determine whether Btk-deficient anti-DNA B cells can be fully activated and differentiate in vivo, we compared levels of anti-ssDNA and anti-dsDNA IgM and IgG in 56R and 56R.Btk−/− mice. Each of these anti-DNA antibodies was present in 56R mice on the C57BL/6 background (Figure 5), consistent with previous observations (Sekiguchi et al., 2003; Fukuyama et al., 2005; Sekiguchi et al., 2006). However, there was a dramatic reduction in autoantibody levels in 56R.Btk−/− mice, such that there was no significant difference between them and non-transgenic wild type mice (Figure 5). This is a more profound defect than can be explained by the approximately two fold reduction in the frequency of anti-dsDNA reactive B cells in 56R.Btk−/− mice compared to 56R mice. Thus, Btk is required for the production of antibodies by anti-DNA B cells in vivo.

Figure 5
Differential effects of reduced Btk signaling on anti-DNA IgM and IgG production

Responses to BCR crosslinking are particularly senstitive to subtle changes in Btk signal strength (Satterthwaite et al., 1997). This suggested that merely reducing Btk levels, rather than eliminating Btk altogether, may also impede the production of anti-DNA antibodies. To test this hypothesis we crossed a transgene that drives approximately 25% of endogenous Btk levels (Btklo) in B cells (Satterthwaite et al., 1997) to 56R.Btk−/− mice. This was sufficient to significantly rescue the production of anti-ssDNA and anti-dsDNA IgM in 56R.Btk−/− mice (Figure 5a,c). The Btklo transgene partially, although not completely, restored the ability of Btk−/− B cells to secrete IL-10 in response to TLR9 engagement (Figure 2e). Proliferation in response to BCR crosslinking was also partially rescued, both at high doses of anti-IgM alone (Satterthwaite et al., 1997) and at low doses of anti-IgM in synergy with CpG DNA (Figure 3a). This suggests that a minimal amount of mitogenic BCR signaling and/or TLR9 induced IL-10 expression is required for the activation of anti-DNA B cells in vivo.

Despite the presence of anti-DNA IgM in 56R.Btklo mice, there was no difference between 56R.Btklo and 56R.Btk−/− mice with regard to anti-ssDNA and anti-dsDNA IgG levels (Figure 5b,d). This was not due to a general inhibitory effect of the Btk transgene on class switching, as normal levels of anti-DNA IgG were present in 56R mice expressing both the endogenous Btk gene and the transgene (Figure 5b,d, Btkhi). Thus, the production of anti-DNA IgG is particularly sensitive to changes in Btk signal strength.

TLR9 signaling has been shown to contribute to class switching of anti-DNA B cells in the B6.56R model, likely via the upregulation of T-bet expression in B cells (Ehlers et al., 2006; Liu et al., 2003). CpG DNA also induces expression of AID, which is required for class switching (Muramatsu et al, 2000; He et al., 2004). We therefore asked whether these processes depend on Btk (Figure 5e). Expression levels of both T-bet and AID were 4 to 5 fold lower than normal in CpG stimulated Btk−/− B cells. TLR9 engaged Btklo B cells expressed twice the amount of mRNA for T-bet and AID as Btk−/−cells, but only half as much as wild type cells. Thus, Btk may regulate class switching of DNA-reactive cells at least in part by mediating TLR9-induced expression of T-bet and AID.

Discussion

Anti-DNA B cells can be activated via both BCR and TLR9 signals (Leadbetter et al., 2002; Viglianti et al., 2003; Marshak-Rothstein et al., 2004). The BCR both directly activates B cells and delivers DNA to intracellular compartments containing TLR9. We now demonstrate that in the absence of Btk, which mediates mitogenic signaling from the BCR, anti-DNA B cells can develop and proliferate in response to CpG containing DNA fragments. However, 56R.Btk−/− mice do not produce significant levels of anti-DNA antibodies in vivo.

One possible explanation for these results is that altered negative selection of immature B cells results in a decreased number of anti-DNA B cells in 56R.Btk−/− mice. This is in part true, as a lower frequency of hybridomas recovered from the spleens of 56R.Btk−/− mice were specific for anti-dsDNA compared to 56R mice. Preliminary repertoire analysis of hybridoma panels did not reveal a consistent explanation for this difference (data not shown). Nonetheless, the reduction in anti-DNA antibodies in 56R.Btk−/− mice is much greater than two fold, indicating that the anti-DNA B cells that are present in these mice are not being activated in vivo.

The restoration of anti-DNA IgM in 56R.Btk−/− mice by the Btklo transgene correlates with the partial rescue of a) CpG DNA-induced IL-10 secretion and b) proliferative response to BCR crosslinking, both alone and in synergy with TLR9 engagment. IL-10 secretion by B cells in response to TLR9 ligands is significantly enhanced in B cells from several murine lupus models and human lupus patients (Lenert et al., 2005; Nakano et al., 2008). IL-10 promotes autoantibody production by B cells from SLE patients (Llorente et al., 1995), and antibodies against IL-10 have been shown to be protective in the NZB x NZW murine model of lupus (Ishida et al., 1994; Balabanian et al., 2003). Thus, Btk-dependent secretion of IL-10 in response to DNA-containing antigens may promote the activation and differentiation of anti-DNA B cells.

These studies also support a model in which full activation and differentiation of DNA-reactive cells requires the BCR to signal actively through Btk, not just deliver DNA to TLR9. Btk was required for the ability of low doses of anti-IgM and CpG DNA to synergize for the proliferation of B cells. Thus, a Btk-dependent BCR signal may act to sensitize B cells to respond to the limiting amounts of DNA-containing antigen that these cells are likely to encounter in vivo. Alternatively, it has recently been shown that while cyclosporin-inhibitable, Ca++ dependent signals from the BCR synergize with CpG DNA to activate B cells, chronic BCR stimulated ERK activation can prevent CpG induced differentiation of B cells (Rui et al., 2003). In primary murine B cells, Btk is required for BCR-stimulated Ca++ signaling but not ERK activation (Forssell et al., 2000). In fact, we have shown that Btk−/− B cells undergo enhanced ERK phosphorylation relative to wild type cells in response to anti-IgM (Halcomb et al., 2007). Thus, it is possible that in addition to not receiving a Ca++-dependent activating signal from the BCR, Btk-deficient anti-DNA B cells are actively inhibited from differentiating in response to TLR9 engagement via BCR-induced ERK activation. In this way, they resemble anergic B cells (Rui et al., 2003).

Failure to localize to the marginal zone may also contribute to reduced activation of anti-DNA B cells in vivo in the absence of Btk. Recent studies have indicated that marginal zone B cells are significantly more sensitive to TLR-induced differentiation than follicular B cells (Fairfax et al., 2007; Genestier et al., 2007). Reduced skewing of 56R.Btk−/− B cells to the marginal zone population is consistent with previous observations demonstrating that Btk-mediated BCR signals are required for the enrichment of certain B cell clones into this compartment (Martin and Kearney, 2000). Interestingly, however, Btk is not required for the development of marginal zone cells (Martin and Kearney, 2000), and in some cases Btk signaling even decreases the frequency of this population (Cariappa et al., 2001). This suggests that either 1) not all marginal zone B cells are positively selected by BCR signaling or 2) Btk is required only for the entry or maintenance of particular B cell clones within the marginal zone.

The Btklo transgene significantly increased IgM anti-DNA levels in 56R.Btk−/− mice, suggesting that a minimal amount of BCR signaling and/or TLR9-induced IL-10 expression is required for the activation and differentiation of anti-DNA B cells. However, there was no difference between 56R.Btklo and 56R.Btk−/− mice with respect to anti-DNA IgG levels. 56R.Btklo mice thus resemble 56R.Balb/c mice in the production of intermediate levels of anti-DNA IgM and no anti-DNA IgG (Fukuyama et al., 2005). The Btklo transgene did not impair anti-DNA IgG production in the presence of a normal endogenous Btk gene, however, ruling out linkage of the Btklo transgene to a Balb/c-like allele of a gene controlling anti-DNA IgG levels. We did not observe significant impairment of class switching in Btklo mice in response to T-independent or T-dependent viral antigens (Pinschewer et al, 1999), suggesting that the current observation may be specific for anti-DNA B cells.

Consistent with this idea, we demonstrate that Btk mediates CpG DNA induced expression of AID and T-bet in B cells. AID is required for class switching (Muramatsu et al., 2000), and T-bet deficient MRL.lpr mice have dramatic reductions in pathogenic autoantibody levels (Peng et al., 2002). While AID and T-bet levels were partially restored in Btklo B cells, they remained lower than normal and may be insufficient to promote class switching of anti-DNA B cells. Additionally, the balance between Btk-dependent activating signals and FcγRIIb-mediated inhibitory signals may regulate the terminal differentiation of switched anti-DNA B cells. A major function of FcγRIIb is to inhibit BCR-induced membrane association and activation of Btk (Bolland et al., 1998; Scharenberg et al., 1998). 56R.FcγRIIb−/− mice have similar levels of anti-DNA IgM to 56R mice but significantly increased levels of anti-DNA IgG due to an increase in the frequency of IgG secreting plasma cells (Fukuyama et al., 2005). Taken together, these observations suggest that Btk signal strength is a critical determinant of whether pathogenic IgG autoantibodies will be produced.

In summary, Btk plays an important role at multiple checkpoints during the development, localization, activation, and class switching of DNA-reactive B cells. The particular sensitivity of anti-DNA IgG to subtle changes in Btk signal strength suggests that Btk, its activators or effectors may be points of potential therapeutic intervention to prevent pathogenic autoimmunity in SLE.

Acknowledgements

We thank Cristina Contreras and Rochelle Hinman for excellent technical assistance. We are grateful to Drs. Martin Weigert and Chandra Mohan for providing 56R mice and Drs. Greg Viglianti and Ann Marshak-Rothstein for the CG50 and HIV(CG+) plasmids. We also thank Rochelle Hinman and Dr. Chandra Mohan for critical review of the manuscript. This work was supported by the UTSW Endowment for Scholars in Biomedical Research, a Chapter Grant from the North Texas Chapter of the Arthritis Foundation, and NIH grants AI039824 and GM076982.

Abbreviations

AID
activation induced cytidine deaminase
BCR
B cell antigen receptor
Btk
Bruton’s tyrosine kinase
ODN
oligodeoxynucleotide
SLE
Systemic lupus erythematosus
TLR
Toll-like receptor

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • Aluvihare VR, Khamlichi AA, Williams GT, Adorini L, Neuberger MS. Acceleration of intracellular targeting of antigen by the B-cell antigen receptor: importance depends on the nature of the antigen-antibody interaction. EMBO J. 1997;16 3553–3562S. [PMC free article] [PubMed]
  • Balabanian K, Couderc J, Bouchet-Delbos L, Amara A, Berrebi D, Foussat A, Baleux F, Portier A, Durand-Gasselin I, Coffman RL, Galanaud P, Peuchmaur M, Emilie D. Role of the chemokine stromal cell-derived factor 1 in autoantibody production and nephritis in murine lupus. J. Immunol. 2003;170:3392–3400. [PubMed]
  • Bolland S, Pearse RN, Kurosaki T, Ravetch JV. SHIP modulates immune receptor responses by regulating membrane association of Btk. Immunity. 1998;8:509–516. [PubMed]
  • Busconi L, Bauer JW, Tumang JR, Laws A, Perkins-Mesires K, Tabor AS, Lau C, Corley RB, Rothstein TL, Lund FE, Behrens TW, Marshak-Rothstein A. Functional outcome of B cell activation by chromatin immune complex engagement of the B cell receptor and TLR9. J. Immunol. 2007;179:7397–7405. [PubMed]
  • Cariappa A, Tang M, Parng C, Nebelitskiy E, Carroll M, Georgopoulos K, Pillai S. The follicular versus marginal zone B lymphocyte cell fate decision is regulated by Aiolos, Btk, and CD21. Immunity. 2001;14:603–615. [PubMed]
  • Chen C, Radic MZ, Erikson J, Camper SA, Litwin S, Hardy RR, Weigert M. Deletion and editing of B cells that express antibodies to DNA. J. Immunol. 1994;152:1970–1982. [PubMed]
  • Ehlers M, Fukuyama H, McGaha TL, Aderem A, Ravetch JV. TLR9/MyD88 signaling is required for class switching to pathogenic IgG2a and 2b autoantibodies in SLE. J. Exp. Med. 2006;203:553–561. [PMC free article] [PubMed]
  • Fairfax KA, Corcoran LM, Pridans C, Huntington ND, Kallies A, Nutt SL, Tarlinton DM. Different kinetics of blimp-1 induction in B cell subsets revealed by reporter gene. J. Immunol. 2007;178:4104–4111. [PubMed]
  • Forssell J, Nilsson A, Sideras P. Reduced formation of phosphatidic acid upon B-cell receptor triggering of mouse B-lymphocytes lacking Bruton's tyrosine kinase. Scand. J. Immunol. 2000;52:30–38. [PubMed]
  • Fukuyama H, Nimmerjahn F, Ravetch JV. The inhibitory Fcgamma receptor modulates autoimmunity by limiting the accumulation of immunoglobulin G+ anti-DNA plasma cells. Nat. Immunol. 2005;6:99–106. [PubMed]
  • Genestier L, Taillardet M, Mondiere P, Gheit H, Bella C, Defrance T. TLR agonists selectively promote terminal plasma cell differentiation of B cell subsets specialized in thymus-independent responses. J. Immunol. 2007;178:7779–7786. [PubMed]
  • Golding B, Golding H, Foiles PG, Morton JI. CBA/N X-linked defect delays expression of the Y-linked accelerated autoimmune disease in BXSB mice. J. Immunol. 1983;130:1043–1046. [PubMed]
  • Halcomb KE, Contreras CM, Hinman RM, Coursey TG, Wright HL, Satterthwaite AB. Btk and phospholipase C gamma 2 can function independently during B cell development. Eur. J. Immunol. 2007;37:1033–1042. [PubMed]
  • Hasan M, Lopez-Herrera G, Blomberg KE, Lindvall JM, Berglöf A, Smith CI, Vargas L. Defective Toll-like receptor 9-mediated cytokine production in B cells from Bruton's tyrosine kinase-deficient mice. Immunology. 2008;123:239–249. [PMC free article] [PubMed]
  • He B, Qiao X, Cerutti A. CpG DNA induces IgG class switch DNA recombination by activating human B cells through an innate pathway that requires TLR9 and cooperates with IL-10. J Immunol. 2004;173:4479–4491. [PubMed]
  • Ishida H, Muchamuel T, Sakaguchi S, Andrade S, Menon S, Howard M. Continuous administration of anti-interleukin 10 antibodies delays onset of autoimmunity in NZB/W F1 mice. J. Exp. Med. 1994;179:305–310. [PMC free article] [PubMed]
  • Khan WN, Alt FW, Gerstein RM, Malynn BA, Larsson I, Rathbun G, Davidson L, Muller S, Kantor AB, Herzenberg LA, Rosen FS, Sideras P. Defective B cell development and function in Btk-deficient mice. Immunity. 1995;3:283–299. [PubMed]
  • Lau CM, Broughton C, Tabor AS, Akira S, Flavell RA, Mamula MJ, Christensen SR, Shlomchik MJ, Viglianti GA, Rifkin IR, Marshak-Rothstein A. RNA-associated autoantigens activate B cells by combined B cell antigen receptor/Toll-like receptor 7 engagement. J. Exp. Med. 2005;202:1171–1177. [PMC free article] [PubMed]
  • Leadbetter EA, Rifkin IR, Hohlbaum AM, Beaudette BC, Shlomchik MJ, Marshak-Rothstein A. Chromatin-IgG complexes activate B cells by dual engagement of IgM and Toll-like receptors. Nature. 2002;416:603–607. [PubMed]
  • Lee KG, Xu S, Wong ET, Tergaonkar V, Lam KP. Bruton's tyrosine kinase separately regulates NFkappaB p65RelA activation and cytokine interleukin (IL)-10/IL-12 production in TLR9-stimulated B Cells. J. Biol. Chem. 2008;283:11189–11198. [PubMed]
  • Lenert P, Stunz L, Yi AK, Krieg AM, Ashman RF. CpG stimulation of primary mouse B cells is blocked by inhibitory oligodeoxyribonucleotides at a site proximal to NF-κB activation. Antisense Nucleic Acid Drug Dev. 2001;4:247–256. [PubMed]
  • Lenert P, Brummel R, Field EH, Ashman RF. TLR-9 activation of marginal zone B cells in lupus mice regulates immunity through increased IL-10 production. J Clin Immunol. 2005;25:29–40. [PubMed]
  • Li H, Jiang Y, Prak EL, Radic M, Weigert M. Editors and editing of anti-DNA receptors. Immunity. 2001;15:947–957. [PubMed]
  • Li Y, Li H, Weigert M. Autoreactive B cells in the marginal zone that express dual receptors. J. Exp. Med. 2002a;195:181–188. [PMC free article] [PubMed]
  • Li Y, Li H, Ni D, Weigert M. Anti-DNA B cells in MRL/lpr mice show altered differentiation and editing pattern. J. Exp. Med. 2002b;196:1543–1552. [PMC free article] [PubMed]
  • Liu N, Ohnishi N, Ni L, Akira S, Bacon KB. CpG directly induces T-bet expression and inhibits IgG1 and IgE switching in B cells. Nat Immunol. 2003;4:687–693. [PubMed]
  • Llorente L, Zou W, Levy Y, Richaud-Patin Y, Wijdenes J, Alcocer-Varela J, Morel-Fourrier B, Brouet JC, Alarcon-Segovia D, Galanaud P, Emilie D. Role of interleukin 10 in the B lymphocyte hyperactivity and autoantibody production of human systemic lupus erythematosus. J. Exp. Med. 1995;181:839–844. [PMC free article] [PubMed]
  • Marshak-Rothstein A, Busconi L, Lau CM, Tabor AS, Leadbetter EA, Akira S, Krieg AM, Lipford GB, Viglianti GA, Rifkin IR. Comparison of CpG s-ODNs, chromatin immune complexes, and dsDNA fragment immune complexes in the TLR9-dependent activation of rheumatoid factor B cells. J. Endotoxin. Res. 2004;10:247–251. [PubMed]
  • Martin F, Kearney JF. Positive selection from newly formed to marginal zone B cells depends on the rate of clonal production, CD19, and btk. Immunity. 2000;12:39–49. [PubMed]
  • Muramatsu M, Kinoshita K, Fagarasan S, Yamada S, Shinkai Y, Honjo T. Class switch recombination and hypermutation require activation-induced cytidine deaminase (AID), a potential RNA editing enzyme. Cell. 2000;102:553–563. [PubMed]
  • Nakano S, Morimoto S, Suzuki J, Nozawa K, Amano H, Tokano Y, Takasaki Y. Role of pathogenic auto-antibody production by Toll-like receptor 9 of B cells in active systemic lupus erythematosus. Rheumatology. 2008;47:145–149. [PubMed]
  • Ng YS, Wardemann H, Chelnis J, Cunningham-Rundles C, Meffre E. Bruton's tyrosine kinase is essential for human B cell tolerance. J. Exp. Med. 2004;200:927–934. [PMC free article] [PubMed]
  • Peng SL, Szabo SJ, Glimcher LH. T-bet regulates IgG class switching and pathogenic autoantibody production. Proc. Natl. Acad. Sci. U S A. 2002;99:5545–5550. [PMC free article] [PubMed]
  • Peng SL. Signaling in B cells via Toll-like receptors. Curr. Opin. Immunol. 2005;17:230–236. [PubMed]
  • Pinschewer DD, Ochsenbein AF, Satterthwaite AB, Witte ON, Hengartner H, Zinkernagel RM. A Btk transgene restores the antiviral TI-2 antibody responses of xid mice in a dose-dependent fashion. Eur. J. Immunol. 1999;29:2981–2987. [PubMed]
  • Plotz PH. The autoantibody repertoire: searching for order. Nat. Rev. Immunol. 2003;3:73–78. [PubMed]
  • Radic MZ, Mascelli MA, Erikson J, Shan H, Weigert M. Ig H and L chain contributions to autoimmune specificities. J. Immunol. 1991;146:176–182. [PubMed]
  • Rui L, Vinuesa CG, Blasioli J, Goodnow CC. Resistance to CpG DNA-induced autoimmunity through tolerogenic B cell antigen receptor ERK signaling. Nat. Immunol. 2003;4:594–600. [PubMed]
  • Satterthwaite AB, Cheroutre H, Khan WN, Sideras P, Witte ON. Btk dosage determines sensitivity to B cell antigen receptor cross-linking. Proc. Natl. Acad. Sci. U.S.A. 1997;94:13152–13157. [PMC free article] [PubMed]
  • Satterthwaite AB, Lowell CA, Khan WN, Sideras P, Alt FW, Witte ON. Independent and opposing roles for Btk and lyn in B and myeloid signaling pathways. J. Exp. Med. 1998;188:833–844. [PMC free article] [PubMed]
  • Satterthwaite AB, White ON. The role of Bruton's tyrosine kinase in B cell development and function; a genetic perspective. Immunol. Rev. 2000;175:120–127. [PubMed]
  • Scharenberg AM, El-Hillal O, Fruman DA, Beitz LO, Li Z, Lin S, Gout I, Cantley LC, Rawlings DJ, Kinet JP. Phosphatidylinositol-3,4,5-trisphosphate (PtdIns-3,4,5-P3)/Tec kinase-dependent calcium signaling pathway: a target for SHIP-mediated inhibitory signals. EMBO J. 1998;17:1961–1972. [PMC free article] [PubMed]
  • Scribner CL, Hansen CT, Klinman DM, Steinberg AD. The interaction of the xid and me genes. J Immunol. 1987;138:3611–3617. [PubMed]
  • Sekiguchi DR, Eisenberg RA, Weigert M. Secondary heavy chain rearrangement: a mechanism for generating anti-double-stranded DNA B cells. J. Exp. Med. 2003;197:27–39. [PMC free article] [PubMed]
  • Sekiguchi DR, Yunk L, Gary D, Charan D, Srivastava B, Allman D, Weigert MG, Prak ET. Development and selection of edited B cells in B6.56R mice. J. Immunol. 2006;176:6879–6887. [PubMed]
  • Seldin MF, Reeves JP, Scribner CL, Roths JB, Davidson WF, Morse HC, 3rd, Steinberg AD. Effect of xid on autoimmune C3H-gld/gld mice. Cell. Immunol. 1987;107:249–255. [PubMed]
  • Steinberg BJ, Smathers PA, Frederiksen K, Steinberg AD. Ability of the xid gene to prevent autoimmunity in (NZB x NZW)F1 mice during the course of their natural history, after polyclonal stimulation, or following immunization with DNA. J Clin Invest. 1982;70:587–597. [PMC free article] [PubMed]
  • Takeshita H, Taniuchi I, Kato J, Watanabe T. Abrogation of autoimmune disease in Lyn-deficient mice by the mutation of the Btk gene. Int. Immunol. 1998;10:435–444. [PubMed]
  • Viglianti GA, Lau CM, Hanley TM, Miko BA, Shlomchik MJ, Marshak-Rothstein A. Activation of autoreactive B cells by CpG dsDNA. Immunity. 2003;19:837–847. [PubMed]
  • Whyburn LR, Halcomb KE, Contreras CM, Lowell CA, Witte ON, Satterthwaite AB. Reduced dosage of Bruton's tyrosine kinase uncouples B cell hyperresponsiveness from autoimmunity in lyn−/− mice. J. Immunol. 2003;171:1850–1858. [PubMed]
  • Yi AK, Tuetken R, Redford T, Waldschmidt M, Kirsch J, Krieg AM. CpG motifs in bacterial DNA activate leukocytes through the pH-dependent generation of reactive oxygen species. J. Immunol. 1998;160:4755–4761. [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...