• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
Immunity. Author manuscript; available in PMC Apr 23, 2011.
Published in final edited form as:
Immunity. Apr 23, 2010; 32(4): 518–530.
Published online Apr 1, 2010. doi:  10.1016/j.immuni.2010.03.014
PMCID: PMC2862476
NIHMSID: NIHMS192501

Indirect Inhibition of Toll-like Receptor and Type I Interferon Responses by ITAM-coupled Receptors and Integrins

SUMMARY

An important function of immunoreceptor tyrosine-based activation motif (ITAM)-coupled receptors is cross-regulation of heterologous receptor signaling, but mechanisms of cross-inhibition are poorly understood. We show that high avidity ligation of ITAM-coupled β2 integrins and FcγRs in macrophages inhibited type I interferon receptor and Toll-like receptor (TLR) signaling and induced expression of interleukin-10 (IL-10), signaling inhibitors SOCS3, ABIN-3 and A20, and repressors of cytokine gene transcription STAT3 and Hes1. Induction of inhibitors was dependent on a pathway comprised of signaling molecules DAP12, Syk, and Pyk2 that coupled to downstream kinases p38 and MSKs, and required integration of IL-10-dependent and independent signals. ITAM-induced inhibitors abrogated TLR responses by cooperatively targeting distinct steps in TLR signaling. Inhibitory signaling was suppressed by IFN-γ and attenuated in inflammatory arthritis synovial macrophages. These results provide an indirect mechanism of cross-inhibition of TLRs and delineate a signaling pathway important for deactivation of macrophages.

Highlights

β2 integrins and FcγRs inhibit IFNAR and TLR signaling and cytokine production ITAM-induced calcium signaling via DAP12-Syk-Pyk2-p38-MSK, mediates inhibition ITAM receptors induce IL-10 and signaling inhibitors SOCS3, ABIN-3, A20, and Hes1 Inhibitory signaling is abrogated by IFN-γ and during inflammatory arthritis

INTRODUCTION

Multiple immune cell receptors signal via an immunoreceptor tyrosine-based activation motif (ITAM) contained in the receptor cytoplasmic domain or in an associated ITAM-containing adaptor (Abram and Lowell, 2007). The major ITAM-containing adaptors in myeloid cells, DAP12 and FcRγ, associate with and transmit signals from approximately 20 receptors whose ligands are mostly not known. ITAM-associated myeloid cell receptors with known ligands include Fc receptors that are ligated by immunoglobulins and immune complexes and Mincle that senses necrotic cell and fungal products. Genetic evidence shows that β2 and β3 integrins that engage intercellular adhesion molecules (ICAMs) and extracellular matrix components signal via ITAMs, although no direct association of integrins with ITAM-containing proteins has been reported (Abram and Lowell, 2007; Yamasaki et al., 2008). In addition, several C-type lectin receptors that sense microbial pathogens or necrotic cells, such as CLEC7A (also called Dectin-1) and CLEC9A (Sancho et al., 2009), contain ITAM-like motifs and utilize similar signaling pathways. Ligation of ITAM-associated receptors results in Src family kinase-mediated phosphorylation of ITAM tyrosine residues and thereby recruitment and activation of the Syk protein tyrosine kinase. Syk plays a key role in downstream activation of NF-κB via the CARD9 adaptor and of protein kinase C (PKC) and calcium signaling via activation of phospholipase Cγ (PLCγ). Both CARD9- and PLCγ-dependent pathways contribute to downstream activation of mitogen activated protein kinases (MAPKs), and Syk also activates phosphatidylinnositol-3 kinase (PI3K) and production of reactive oxygen intermediates (reviewed in (Ivashkiv, 2009)).

Ligation of ITAM-associated receptors can have enhancing or inhibitory effects on macrophage activation. One determinant of the functional outcome of ITAM signaling is the avidity of ITAM-associated receptor ligation (Hamerman and Lanier, 2006; Ivashkiv, 2008; Turnbull and Colonna, 2007). High avidity acute ligation activates NF-κB and MAPKs that mediate inflammatory responses, thus explaining the role of ITAM-associated receptors such as FcγRs in cell activation and inflammatory disease pathogenesis. In contrast, low avidity or tonic ITAM-associated receptor ligation generates alternative inhibitory signals, such as activation of the tyrosine phosphatase SHP-1 (Pasquier et al., 2005), that deactivate macrophages. Consistent with a suppressive function, ITAM signaling has been implicated in attenuating cytokine toxicity and in ameliorating inflammatory conditions such as glomerulonephritis (Hamerman et al., 2005; Kanamaru et al., 2008; Turnbull and Colonna, 2007). Thus, negative signaling by ITAMs is important in regulating inflammation in vivo and there is substantial interest in therapeutic manipulation of this signaling pathway in inflammatory diseases. Successful therapeutic manipulation of ITAM signaling will require increased understanding of inhibitory signaling mechanisms activated by ITAM-associated receptors.

It has become increasingly apparent that an important function of ITAM-associated receptors is to regulate signaling by heterologous receptors, including TLRs, tumor necrosis factor receptors (TNFRs) and cytokine receptors (Ivashkiv, 2008; Klesney-Tait et al., 2006). Thus, one mechanism by which ITAM-associated receptors suppress macrophage activation is to inhibit cellular responses to strongly activating receptors such as TLRs. Previous reports have identified mechanisms of cross-inhibition whereby ITAM pathway signaling components directly interact with and suppress TLR signaling molecules. Mechanisms of direct cross- inhibition include ITAM-mediated recruitment of phosphatases, activation of PI3K-mediated pathways that can suppress NF-κB and MAPK activation, regulation of recruitment of MyD88 and Mal adaptors to TLRs, regulation of intracellular trafficking of TLRs, and activation of calcineurin that can dephosphorylate TLRs and downstream signaling molecules (Fukao and Koyasu, 2003; Ivashkiv, 2008; Kagan and Medzhitov, 2006; Pasquier et al., 2005; Turnbull and Colonna, 2007). Little is known about indirect mechanisms of cross-inhibition, which function by inducing de novo expression of inhibitory proteins. The previously described direct inhibitory mechanisms are active under conditions of low avidity engagement of ITAM-associated receptors and tonic ITAM-mediated signaling. For example, ongoing ligation of DAP12-associated TREM-2 by constitutively expressed (but unknown) ligands results in cross-inhibition of TLR responses by an unknown mechanism (Hamerman et al., 2005). However, high avidity and acute crosslinking of ITAM-associated receptors can also generate inhibitory effects. For example, extensive crosslinking of Fc receptors inhibits LPS-induced IL-12 production, and high avidity antibody-mediated crosslinking of the ITAM-associated receptors ILT7, BDCA-2, Siglec-H and NKp44 suppresses TLR-induced type I IFN production in pDCs (Cao et al., 2006; Grazia Cappiello et al., 2001; Swiecki and Colonna, 2007). Mechanisms and signaling pathways by which high avidity ITAM-associated receptor ligation inhibits TLR responses are mostly unknown.

We previously found that IFN-α-induced Jak-STAT signaling in macrophages is augmented under steady state adherent culture conditions characterized by ongoing low avidity β2 integrin clustering and tonic calcium signaling by ITAM-containing DAP12 (Wang et al., 2008). In the current study we investigated the effects of high avidity and acute ITAM-associated receptor crosslinking on IFN-α-induced Jak-STAT signaling and on TLR signaling. We used predominantly primary human monocytes and macrophages because of their relevance for human inflammatory disease pathogenesis; use of these cells also allowed direct comparison to human disease samples. To ligate ITAM-associated receptors, we used fibrin(ogen) (Fb) and immune complexes (ICs), ligands that are highly expressed at inflammatory sites, to strongly and acutely activate signaling by, respectively, β2 integrins and FcγRs on macrophages. Pretreatment with Fb and ICs strongly and rapidly inhibited signaling by the type I IFN receptor IFNAR and TLRs. Inhibition of TLR signaling was mediated by coordinate induction and action of inhibitors of signaling and cytokine gene transcription. This inhibitory pathway was suppressed by IFN-γ and was abrogated in joint macrophages from patients with chronic inflammatory arthritis. These results delineate an inhibitory signaling pathway important for deactivating macrophages and identify a mechanism by which high avidity ligation of ITAM-associated receptors indirectly inhibits TLR signaling. Suppression of this inhibitory pathway by IFN-γ and in autoimmune diseases may contribute to increased and chronic inflammatory responses.

RESULTS

High Avidity β2 Integrin and FcγR Ligation Cross-inhibits IFN-α and TLR Signaling

We tested the hypothesis, based on current models (Hamerman and Lanier, 2006; Ivashkiv, 2008; Turnbull and Colonna, 2007), that high avidity ligation of ITAM-coupled receptors would result in a switch in function, and thus in inhibition of IFN-α-induced Jak-STAT signaling. We induced acute high avidity ligation of ITAM-associated β2 integrins in primary human monocyte-derived macrophages by plating cells on culture dishes coated with fibrinogen (Fb); this represents a standard experimental approach for effectively engaging β2 integrins (Abram and Lowell, 2009; Adams et al., 2007). High avidity ligation of β2 integrins by pre-plating macrophages on Fb for 1-16 hr inhibited IFN-α-induced STAT1 tyrosine phosphorylation (Figure 1A, compare lanes 4, 6, 8, 10 to lane 2); IFN-α-induced STAT3 tyrosine phosphorylation was also suppressed (Figure 1A, lane 4). Inhibition of IFN-α signaling was functionally important, as Fb suppressed IFN-α-induced gene activation (Figure 1B). Notably, inhibition of IFN-α responses was induced within 1 hr of integrin engagement and was sustained for at least 16 hours; this inhibitory effect on signaling or gene expression has been reproducibly observed in >20 independent blood donors (data not shown). No inhibitory effect was observed when macrophages adhered to plates that had been blocked with FBS, which was used as a negative control in many experiments (data not shown). Several approaches including using MyD88- and Trif-deficient macrophages and blocking LPS showed that Fb-mediated effects were not secondary to contaminating microbial products (data not shown). These results show that high avidity β2 integrin ligation by fibrinogen inhibits signaling by a heterologous receptor, in this case the IFNAR. High avidity ligation of ITAM-coupled FcγRs using immune complexes also effectively inhibited IFN-α signaling but IFN-γ signaling was not affected, showing specificity of inhibition (data not shown). Thus, at least two different ITAM-associated receptors inhibit IFN-α signaling after high avidity ligation that generates an acute and strong ITAM-mediated signal in an experimental system that models acute engagement of integrins and Fc receptors that occurs when migrating monocytes/macrophages encounter fibrin(ogen) and immune complexes at inflammatory sites.

Figure 1
β2 Integrin Ligation by Fb Inhibits IFN-α and TLR Signaling

Another notable result was that Fb alone (in the absence of IFN-α) induced strong phosphorylation of STAT3 that became readily apparent 3 hours after Fb stimulation and was sustained for at least 16 hours (Figure 1A, lanes 5,7,9). In contrast, Fb-induced STAT1 phosphorylation was transient and only detected at the 3 hr time point. STAT3 is a key negative regulator of myeloid cells and inflammation (Murray, 2007), and thus the observed pattern of STAT activation is suggestive of sustained induction of an inhibitory pathway. One key function of STAT3 is inhibition of cytokine production in myeloid lineage cells, although STAT3 can also contribute to inflammation by its actions in other cell types, for example promoting B cell survival and differentiation and the differentiation of Th17 cells. Because of the inhibitory effects of STAT3 on cytokine production in macrophages, we tested the effects of Fb on TLR-induced cytokine expression. Pre-plating of human macrophages on Fb rapidly (within one hour) and strongly inhibited TLR2- and TLR4-induced IL-6, TNF, IL-1β and IL-8 expression (Figure 1C and data not shown). Strikingly, high avidity FcγR ligation also suppressed TLR4-induced cytokine gene expression, although to a lesser extent than the essentially complete inhibition observed with Fb (Figure S1A). Suppression of TLR4-induced cytokine expression was not observed when cells were added to plates coated with fetal bovine serum (FBS) (Figure S1A). Collectively, the results show that high avidity ligation of two different ITAM-associated receptors, β2 integrins and FcγRs, in primary human macrophages induces a potent inhibitory pathway that cross-inhibits responses to heterologous receptors, including IFNAR and TLRs.

Fb- and Immune Complex-induced Expression of Cytokines and Signaling Inhibitors

We postulated that β2 integrin ligation may induce expression of cytokines that activate STAT3 and of signaling inhibitors that crossregulate IFN-α and TLR pathways; such inhibitors could also establish a feedback inhibition loop that attenuates integrin-induced activating functions. We explored this idea by analyzing Fb-induced expression of cytokines and signaling inhibitors. We found that high avidity ligation of β2 integrins using fibrinogen induced rapid but transient expression of inflammatory cytokine TNF and IL-6 mRNA (Figure 2A). TNF and IL-6 mRNA amounts peaked approximately 2 hr after integrin ligation and subsequently were strongly downregulated to return to close to baseline 4 hr after integrin ligation (Figure 2A). We observed a slower induction of IL-10, a potent suppressor of cytokine production that activates STAT3 (Figure 2A). We also observed delayed kinetics of induction (relative to TNF and IL-6) of known STAT3 target genes that inhibit signal transduction: SOCS3 (inhibits Jak-STAT signaling and possibly TLR signaling) (Yoshimura et al., 2007) and ABIN-3 (interacts with A20 and inhibits NF-κB activation downstream of TNFRs and TLRs in human cells) (Weaver et al., 2007) (Figure 2A). Interestingly, Fb also induced expression of inhibitors that are not known to be STAT3-dependent: Hes1, a transcriptional repressor that inhibits IL-6 expression (Hu et al., 2008) (Figure 2A), and A20 that inhibits signaling by several receptors, including TNFRs and TLRs (Coornaert et al., 2009) (Figure 2B). Induction of IL-10, SOCS3, Hes1 and A20 proteins was confirmed by immunoblotting and ELISA (Fig. 2B, 2C and S2). Signaling inhibitors were induced by Fb in MyD88- and Trif-deficient macrophages and when LPS was blocked using polymyxin B, indicating that induction was not secondary to microbial contaminants (data not shown). Stimulation of human macrophages with immune complexes also induced expression of SOCS3, ABIN-3, Hes1 and A20, albeit to a lesser extent than did Fb (Figure S1B); this lesser induction correlated with lesser inhibition of TLR4-induced gene expression (Figure S1A). In contrast, fibronectin, a ligand for β1 integrins that does not engage DAP12-mediated signaling pathways, did not induce expression of inhibitory proteins (Figure S1B), which correlated with lack of inhibition of TLR-induced IL-6 expression (Figure S1A). These results suggest that β2 integrin ligation by Fb, and to a lesser extent FcγR ligation by immune complexes, induces a potent counter-regulatory loop that feeds back and inhibits integrin- and FcγR-mediated inflammatory cytokine production, and can also cross-inhibit signaling by heterologous receptors.

Figure 2
Fb-induced Expression of Cytokines and Signaling Inhibitors

IL-10 Contributes to Fb-mediated Inhibition of TLR Responses

We then investigated the role of autocrine Fb-induced IL-10 in STAT3 activation, feedback inhibition of cytokine production, induction of signaling inhibitors SOCS3, ABIN-3, Hes1 and A20, and crossregulation of TLR responses. Neutralization of IL-10 and blockade of the IL-10R strongly attenuated Fb-induced STAT3 tyrosine phosphorylation (Figure 3A), indicating a role for IL-10 in mediating Fb-induced STAT3 activation. Consistent with this result, IL-10 blockade resulted in superinduction of Fb-induced TNF expression (Figure 3B) and attenuated Fb-induced inhibition of TLR4 and TLR2 responses (Figures 3C, S3A and data not shown). These results demonstrate that IL-10 plays a role in Fb-induced STAT3 activation, and identify induction of IL-10 as one mechanism by which β2 integrins cross-inhibit TLR responses.

Figure 3
Role of IL-10 in Fb-induced STAT3 Phosphorylation and Inhibition of TLR Responses

Fb Activates IL-10-independent Inhibitory Pathways and A20 Contributes to Fb-mediated Inhibition of TLRs

To test whether Fb-induced IL-10 was sufficient to induce expression of signaling inhibitors and mediate Fb-induced suppression of TLR responses, we performed reconstitution experiments adding exogenous IL-10. First, we found that exogenous IL-10, added at concentrations up to 10-20 times higher than the endogenous IL-10 concentrations induced by Fb, only weakly induced expression of SOCS3 and ABIN-3 relative to Fb, and did not detectably induce expression of Hes1 or A20 (Figure 4A). These results are consistent with a previous report showing that IL-10 is not sufficient to strongly induce ABIN-3 expression (Weaver et al., 2007). The greatly diminished induction of signaling inhibitors by IL-10 relative to Fb is consistent with the preponderance of reported evidence indicating that IL-10 is a weak inhibitor of proximal TLR signaling, and instead inhibits gene transcription ((Murray, 2005; Murray, 2007) and refs. therein). Consistent with the previous reports, exogenous IL-10 did not detectably suppress TLR4 signaling in our system (Figure 4B). In contrast, pre-plating macrophages on Fb effectively inhibited LPS-induced phosphorylation of I-κBα, JNK and ERK (Figure 4B). In addition, exogenous IL-10 at concentrations comparable to those induced by Fb did not effectively inhibit LPS-induced cytokine production (data not shown). Taken together, these results indicate that IL-10 is not sufficient to mediate the full inhibitory effects induced by Fb, and suggest that Fb can induce inhibitory pathways independently of IL-10.

Figure 4
Fb Induces Inhibitory Signals Independently of IL-10 and Fb-induced A20 Contributes to Inhibition of TLRs

To corroborate the idea that Fb induces inhibitory signaling at least in part independently of IL-10, we tested whether Fb could induce expression of signaling inhibitors when IL-10 activity was blocked. IL-10 blockade was effective as it resulted in increased IL-6 production (Figure 4C), but only partially attenuated ABIN-3 and Hes1 expression (Figure 4C); surprisingly, Fb-mediated induction of SOCS3, a classic IL-10-inducible STAT3 target gene was only weakly affected by IL-10 blockade (Figure S3B). Because IL-10 blockade using antibodies may not be complete, we used IL-10-deficient murine macrophages. The Fb-induced effects in human macrophages described above were for the most part reproduced in mouse bone marrow-derived macrophages, although the integrin-mediated signal was quantitatively weaker and more transient (data not shown). Deficiency of IL-10 resulted in a dramatic superinduction of Fb-induced IL-6 expression, but, surprisingly, minimal decrease in SOCS3 expression (Figure 4D). Finally, Fb-induced A20 expression was actually increased when IL-10 was deficient (Figure 4D). Together with data that IL-10 blockade did not reverse Fb-mediated inhibition of IFN-α signaling (Figure S3C), the results show that the inhibitory pathway induced by Fb is mediated in part by IL-10, but that IL-10-independent inhibitory signals are also generated. Consistent with these results, stimulation of FcγRs by immune complexes induced expression of SOCS3, ABIN-3, Hes1 and A20, despite minimal induction of IL-10 expression (Figure S1B). IL-10- independent signals were functionally important for cross-inhibition of signaling, as RNAi-mediated knockdown of A20 expression attenuated Fb-mediated suppression of TLR4-induced IL-6 and TNF expression (Figure 4E). These results support a model whereby TLR4 signaling is inhibited by coordinated action of Fb-induced signaling inhibitors.

DAP12 and Syk Mediate Inhibitory Signaling

We took advantage of the murine system and available gene-targeted mice to genetically define the receptors and upstream signaling components that transmit the Fb-induced inhibitory signal to induction of signaling inhibitor genes. We analyzed bone marrow-derived macrophages derived from mice with a hypomorphic allele of Itgb2 that express 10-15% of wild type amounts of β2 integrin (CD18) (termed Itgb2hypo) and from DAP12-deficient mice, and fetal liver-derived macrophages derived from Syk-deficient fetal livers. Phenotypic analysis of mutant macrophages revealed homogeneous and intact expression of macrophage markers including CD11b, CD68 and F4/80 (data not shown). Fb-induced expression of IL-10 was attenuated in macrophages from Itgb2hypo mice (Figure 5A), thus confirming that cells are being activated via β2 integrins. Investigation of downstream signaling pathways revealed that deficiency of DAP12 and Syk, key signaling mediators downstream of β2 integrins, resulted in decreased Fb-induced IL-10 expression (Figure 5B and 5C). DAP12 and Syk deficiency also resulted in decreased Fb- induced expression of SOCS3 (Figure 5B and 5C), which is independent of IL-10 (Figure 4D). Fb-induced expression of IL-6 was minimally affected (Figure 5B and 5C); thus DAP12 and Syk deficiency did not globally affect macrophage responses to Fb. Fb-induced expression of A20 was also diminished in DAP12-deficient macrophages (Figure 5D). Experiments using Itgb2hypo and DAP12-deficient mice confirmed that expression of IL-10, SOCS3 and A20 was partially dependent on β2 integrins and DAP12 in vivo (Figure 5E). We obtained similar confirmatory results implicating β2 integrins and Syk in inhibitory signaling in human macrophages using CD18 blocking antibodies or piceatannol to inhibit Syk (Figure S4). Collectively, these results strongly implicate a β2 integrin-DAP12-Syk pathway in the induction of IL-10, SOCS3 and A20 expression and inhibitory signaling.

Figure 5
β2 Integrins, DAP12 and Syk Mediate Inhibitory Signaling

Calcium Pathways Induce Signaling Inhibitors via p38 and MSKs

DAP12 and Syk activate calcium signaling pathways, and we have proposed a role for calcium signaling in mediating crosstalk between ITAM-associated and heterologous receptors (Ivashkiv, 2009). Thus, we tested the role of calcium pathways in induction of signaling inhibitors by Fb. Chelation of calcium using BAPTA or inhibition of calmodulin using W-7 suppressed Fb-mediated induction of IL-10, SOCS3 and A20 expression (Figure 6A). To establish a molecular link between calcium signaling and downstream activation of signaling inhibitors, we tested the role of Pyk2, a calcium-dependent protein tyrosine kinase that transmits calcium signals to downstream activation of MAPKs such as p38 that have been implicated in induction of IL-10, SOCS3 and A20 expression (Avraham et al., 2000; Bode et al., 1999; Hu et al., 2006). Plating of human macrophages on Fb induced tyrosine phosphorylation and thus activation of Pyk2 with delayed kinetics that correlated with IL-10 expression (Figure 6B). Activation of Pyk2 in our system was dependent on calcium as it was abolished by the calcium chelator BAPTA and the calmodulin inhibitor W7 (Figure 6C). Pyk2 activation was also suppressed by the Src inhibitor PP2 (Figure 6C); Src kinases can activate Pyk2 via ITAM-calcium signaling or by direct interaction and phosphorylation. Downregulation of Pyk2 expression using RNA interference or inhibition of Pyk2 using a chemical inhibitor AG17 resulted in diminished Fb-induced activation of STAT3 (Figure 6D and 6E). In addition, RNAi-mediated targeting of Pyk2 mRNA or inhibition by AG17 resulted in decreased IL-10 production and decreased expression of SOCS3 (Figure 6F and S5). These results indicate that Fb-induced inhibitory signaling is transduced at least in part by calcium-mediated signals and Pyk2, although signals that are independent of Pyk2 could complement Pyk2 signals.

Figure 6
A calcium-dependent Pyk2-p38-MSK Pathway Mediates Fb-induced Inhibitory Signaling

Pyk2 plays a role in the activation of MAPKs, and MAPKs have been implicated in the induction of IL-10, SOCS3 and A20 in other systems (Ananieva et al., 2008; Bode et al., 1999; Hu et al., 2006; Kim et al., 2008). Thus, we tested the role of MAPKs in transmitting Fb-induced calcium signals to induction of IL-10, SOCS3 and A20 expression. We found that Fb activated p38 with delayed kinetics that correlated with Pyk2 activation and shortly preceded IL-10 expression (Figure 6G), and p38 activation was dependent on calcium (Figure 6C) and on Pyk2 (Figure 6H). This suggested a role for p38 in downstream gene activation. We next tested the effects of inhibiting p38 on Fb-induced activation of STAT3 and expression of signaling inhibitors. Inhibition of p38 using SB203580 strongly suppressed Fb-induced STAT3 tyrosine phosphorylation (Figure 6I) and inhibited induction of IL-10, SOCS3, ABIN-3, Hes1 and A20 mRNA (Figure 6J). A role for p38α in induction of inhibitory molecules was confirmed using p38α-deficient macrophages (data not shown). Inhibition of ERK or JNK had a much smaller suppressive effect on expression of signaling inhibitors (data not shown), whereas inhibition of PKC using GF109203X, used here as a negative control, had no discernable effects (Figure 6J). Recent reports have demonstrated that paradoxical anti-inflammatory actions of p38 are mediated by downstream MSKs, in part by inducing IL-10 and DUSP1 expression (Ananieva et al., 2008; Kim et al., 2008). Thus, we tested the role of MSKs in Fb-induced expression of signaling inhibitors. Fb-induced expression of IL-10, SOCS3 and A20 was markedly attenuated, while IL-6 expression was preserved, in macrophages doubly deficient in MSK1 and MSK2 (Figure 6K). These results demonstrate that Fb-induced calcium signaling pathways couple to the p38-MSK pathway to induce expression of signaling inhibitors, and extend the anti-inflammatory functions of MSKs to the induction of SOCS3 and A20.

Abrogation of Inhibitory Signaling by IFN-γ and in vivo in Arthritic Macrophages

Our findings suggested a more dominantly suppressive function for β2 integrins and ITAM-mediated signaling than previously appreciated (Abram and Lowell, 2009; Adams et al., 2007; Nimmerjahn and Ravetch, 2008). We reasoned that β2 integrin-induced inhibitory pathways may function strongly under homeostatic conditions, but may be regulated in inflammatory settings to prevent inappropriate or excessive suppression of immune responses. We first tested this notion by analyzing the effects of the potent macrophage activating cytokine IFN-γ on Fb-induced β2 integrin-mediated responses. Strikingly, IFN-γ strongly suppressed Fb-mediated induction of IL-10, SOCS3, ABIN-3 and A20 (Figure 7A and data not shown). These results suggest that inhibitory signaling by β2 integrins can be attenuated in an inflammatory environment where IFN-γ and STAT1 are active. We then tested whether Fb-induced inhibitory signaling was attenuated in vivo by testing macrophages freshly isolated from joints of patients with chronic inflammatory arthritis, such as rheumatoid arthritis, which show evidence of activation by IFN-γ in vivo and express a “STAT1 signature” (Ivashkiv and Hu, 2003). Interestingly, Fb-mediated induction of IL-10 was attenuated in arthritic macrophages (n = 8, p = 0.0016) (Figure 7B). Consistent with decreased IL-10 production, Fb-induced STAT3 activation was diminished in arthritic macrophages (Figure 7C). In contrast, Fb induced comparable amounts of TNF in control and arthritic macrophages and there was a trend towards increased IL-6 production in arthritic macrophages, showing that β2 integrins on these cells are functional and that arthritic macrophage responses to Fb are not globally suppressed (Figure 7B). As a control, IFN-γ-induced phosphorylation of STAT1 and STAT3 was intact in arthritic macrophages, and these cells expressed CD11b and CD18 (Figure S6). Fb-mediated activation of STAT3 was intact in synovial fluid macrophages from acute crystal-induced arthritis (n = 4) (data not shown), suggesting differences in macrophage responses to Fb in acute and chronic inflammatory diseases. These results demonstrate attenuation of the homeostatic effects of fibrinogen and β2 integrin signaling in a human chronic inflammatory disease; such attenuation may contribute to the maintenance of chronic inflammation.

Figure 7
Abrogation of Fibrinogen-induced Inhibitory Signaling by IFN-γ and in vivo in Arthritic Macrophages

DISCUSSION

A role for ITAM-associated receptors in suppressing myeloid cell activation has become well established, as has the concept that this suppression occurs via cross-inhibition of activating receptors such as TLRs. Several mechanisms of direct cross-inhibition have been described, but signaling pathways that mediate cross-inhibition are not known and indirect cross-inhibition mediated by induction of inhibitory proteins has not been previously investigated. In this study, we have demonstrated that calcium signaling pathways mediate inhibitory signaling downstream of ITAM-associated receptors by an indirect mechanism that involves coordinated induction of inhibitors of signaling and gene expression. A DAP12-Syk-calcium-Pyk2 pathway induced IL-10, STAT3, SOCS3, ABIN-3, Hes1 and A20, inhibitors that function in an integrated manner to strongly suppress TLR signaling, and have the capacity to cross-inhibit signaling by various activating receptors that utilize TRAF6 (inhibited by A20), NF-κB (inhibited by ABIN-3) or Jaks (inhibited by SOCS3), and to inhibit transcription of inflammatory cytokine genes (inhibited by Hes1 and STAT3). Inhibitory signaling was activated by β2 integrins and FcγRs that are ligated by factors expressed at sites of acute and chronic inflammation, namely fibrin, complement split products, and immune complexes. Thus, we have identified an inhibitory pathway that has the potential to cross-inhibit various macrophage-activating receptors and to play an important role in regulation of cytokine production and inflammation.

An important aspect of ITAM-induced cross-inhibition in our system is the coordinated induction of inhibitory molecules that can act in an integrated manner to deactivate macrophages. This coordinated induction and function of inhibitory molecules is reminiscent of the induction of T cell anergy by ligation of the TCR, which is also mediated by ITAM and calcium signaling. T cell anergy takes several days to become established and results from calcium-mediated activation of the transcription factor NFAT, which induces expression of multiple molecules that suppress signaling by T cell activating receptors, including the E3 ligases Cbl-b, Itch and GRAIL, and also GADD45β, DAG kinase α and Deltex1 (Borde et al., 2006; Hsiao et al., 2009). In contrast, in macrophages, cross-inhibition of activating receptors was established rapidly, within 1-3 hours of ligation of ITAM-associated receptors, and was mediated by an alternative calcium-dependent Pyk2-p38 pathway. One key event downstream of Pyk2 and p38 was induction of IL-10, leading to the activation of STAT3 and inhibition of cytokine gene transcription. In addition, β2 integrin ligation suppressed TLR4 signaling at a proximal step, likely via IL-10-independent induction of A20, which targets proximal TLR4-induced signaling pathways and inhibits downstream activation of both NF-κB and MAPKs. IL- 10 synergized with an IL-10-independent pathway downstream of β2 integrins to induce expression of ABIN-3, Hes1 and (in human cells) SOCS3, all of which can suppress inflammatory responses. We have provided evidence supporting a role for IL-10 and A20 in mediating Fb-induced suppression of TLR4 responses, but it is likely that the integrated function of various Fb-induced signaling inhibitors explains the striking and nearly complete inhibition of TLR responses that was observed.

Our findings highlight the importance of calcium signaling in cross-regulation of heterologous receptors by ITAM-associated receptors. Engagement of calcium signaling pathways leading to delayed but sustained activation of p38 and MSKs and induction of multiple signaling inhibitors provides a mechanism by which high avidity engagement of ITAM-associated receptors cross-inhibits TLR signaling. This calcium signaling pathway confers a capacity for strong inhibitory signaling that distinguishes ITAM-associated receptors from more strongly activating receptors such as TLRs that activate p38 rapidly but transiently. Thus, although TLRs can transiently activate expression of the inhibitory effectors induced by Fb as part of feedback inhibition, on balance TLRs induce a more pro-inflammatory response and Fb induces a more sustained and dominant suppressive signal. It is tempting to speculate that differences in the kinetics and amplitude of p38 activation may help explain the different balance between activating and suppressive signaling by different receptors.

Genetic, biochemical and pharmacological evidence established that the DAP12-Syk-dependent pathway downstream of β2 integrins was necessary for inhibitory signaling. FcγRs activate a similar FcRγ-Syk signaling pathway and induced a similar, but quantitatively weaker, pattern of inhibitory molecule expression. The weak induction of IL-10 by FcγRs is consistent with previous work with murine macrophages (Lucas et al., 2005). It is currently not possible to test the inhibitory potency of additional ITAM-associated receptors in myeloid cells as their ligands are not known. One potential explanation for the quantitative difference between β2 integrin and FcγR responses is that β2 integrin cytoplasmic tails activate signals in addition to ITAM-dependent signaling (Abram and Lowell, 2009). Such additional signals include remodeling of the actin cytoskeleton associated with cell attachment or spreading and the formation of adhesion structures. Such cytoskeletal remodeling can promote sustained signaling (Nguyen et al., 2008) and lead to stronger and more sustained activation of downstream signaling molecules such as was observed with Pyk2, which has been previously shown to be activated in a sustained manner by integrin ligation in other systems (Abram and Lowell, 2009; Avraham et al., 2000). We provided evidence that Pyk2 activation was dependent on calcium, but it is possible that other pathways contribute to Pyk2 activation. Pyk2 activates downstream MAPK signaling leading to induction of signaling inhibitors, as shown in this study, and can also modulate additional signaling pathways, such as those mediated by Jaks (Wang et al., 2008) and β-catenin (Otero et al., 2009). Thus, Pyk2 appears to play a prominent role in signal transduction crosstalk. However, activation of Pyk2 appears not to be sufficient for downstream induction of signaling inhibitors, as ligation of β1 integrins by fibronectin, which also activates Pyk2, was ineffective in inducing expression of these molecules. Thus, other signaling effectors downstream of ITAMs or calcium may complement Pyk2 signals. It is likely that effective induction of signaling inhibitors and cross-inhibition of TLR responses requires cooperation of ITAM-dependent and independent pathways, both of which are activated by β2 integrins.

Our findings establish that pre-ligation of β2 integrins or FcγRs rapidly inhibited TLR signaling. Such preligation of ITAM-associated receptors occurs as monocytes exit the circulation and β2 integrins engage counter-receptors on endothelial cells, and as macrophages encounter fibrin, complement split products and immune complexes as they enter an inflammatory micro-environment. Alternatively, co-engagement of ITAM-associated receptors with TLRs can result in synergistic induction of inflammatory cytokine production, at least in the short term. For example, co-engagement of DAP12-associated receptors and TLRs, or of Dectin-1 and TLR2 by yeasts and zymosan, results in increased inflammatory cytokine and IL-23 production (Brown et al., 2003; Dennehy et al., 2008; Gantner et al., 2003; LeibundGut-Landmann et al., 2007; Manicassamy et al., 2009; Turnbull et al., 2005). However, even under conditions of simultaneous engagement of ITAM-associated receptors and TLRs, there is increased IL-10 production (Dennehy et al., 2008; LeibundGut-Landmann et al., 2007), indicating more effective induction of feedback inhibitory loops whose suppressive effects will become apparent at later time points than are typically analyzed in most studies. It will be interesting to test if simultaneous engagement of ITAM-associated receptors and TLRs also leads to increased and more sustained expression of SOCS3, ABIN-3, Hes1 and A20 than that induced by TLRs alone. Overall, our findings and previous reports support a dynamic crosstalk between ITAM-associated receptors and TLRs whose outcome is at least in part dependent on timing of receptor ligation. During chronic inflammation the timing and avidity of engagement of ITAM-associated receptors vs. more strongly activating receptors will vary depending on disease activity and cell localization, and thus ITAM-associated receptors have the potential to either augment or suppress inflammation.

Although inhibitory functions for ITAM-associated receptors and β2 integrins have been previously described, our findings demonstrate the potential for stronger and more dominantly suppressive functions than previously appreciated. Indeed, the current paradigm is that the ligands used to elicit inhibitory signaling in this study, fibrin(ogen) and immune complexes, and their cognate receptors β2 integrins and FcγRs, are strong activators of inflammation and contributors to the pathogenesis of inflammatory diseases in murine models (Nimmerjahn and Ravetch, 2008). One reason that the inhibitory functions of these ITAM-associated receptors have not been previously fully appreciated is that β2 integrins and Fc receptors have mostly activating functions in neutrophils and mast cells, which predominate in the earliest phases of host defense and in relatively acute mouse models of chronic human diseases. Thus, gene deletion of β2 integrins or FcγRs may not reveal the suppressive effects of these receptors because their absence abolishes the initial activation phase of inflammation, often mediated by neutrophils or mast cells. In the absence of induction of an inflammatory response in the first place it is not possible to detect the suppressive functions of these receptors. However, emerging evidence supports suppressive functions for β2 integrins (especially αMβ2, the main β2 integrin receptor for fibrinogen that is also called complement receptor 3) and FcγRs in macrophages and DCs in cell-based functional assays and in select in vivo models. These receptors have been implicated in clearance of immune complexes, suppression of APC function of DCs, induction of IL-10 expression, and phagocytosis of apoptotic cells (which generates suppressive signals) ((Behrens et al., 2007; Mevorach et al., 1998; Skoberne et al., 2006) and refs. therein). Consistent with these in vitro studies, αMβ2 has been shown to suppress TLR-induced cytokine production in vivo, mediate UV-induced immunosuppression in the skin, mediate tolerance induction in the eye, suppress colitis and dermatitis, and attenuate SLE in the MRL/lpr model ((Hammerberg et al., 1998; Leon et al., 2006; Sohn et al., 2003) and refs. therein). Fc receptors also exert suppressive functions in vivo, including mediating suppression of IFN-γ responses, innate immune responses against Listeria monocytogenes and Leishmania, LPS toxicity, and glomerulonephritis ((Gerber and Mosser, 2001; Kanamaru et al., 2008; Nimmerjahn and Ravetch, 2008; Park-Min et al., 2007) and refs. therein). The suppressive effects of β2 integrins and FcγRs in vivo have been previously linked to production of IL-10, but underlying mechanisms were not known. Our findings have provided a detailed signaling pathway that leads to IL-10 expression and reveal additional molecular mechanisms by which β2 integrins and FcγRs can inhibit inflammation.

A second reason why ITAM-mediated inhibitory signaling may not be readily apparent in certain contexts is that ITAM-induced inhibitory pathways are subject to regulation that modulates the balance between pro- and anti-inflammatory ITAM effects. This notion is supported by our data that IFN-γ suppresses inhibitory signaling downstream of β2 integrins. In this scenario, inhibitory signaling is appropriately suppressed during an active immune response characterized by IFN-γ production. Then, as the infection is cleared, inhibitory signaling and suppressive functions of ITAM-associated receptors would emerge and participate in the resolution phase of inflammation. Alternatively, our results suggest that in pathological settings, such as chronic human autoimmune diseases characterized by ongoing IFN-γ-STAT1 activity, the inhibitory and homeostatic functions of ITAM-associated receptors are attenuated. This (inappropriate) suppression of ITAM-induced inhibitory signaling in chronic inflammatory diseases can contribute to pathogenesis and chronicity of inflammation. Augmentation of signaling by ITAM-mediated inhibitory pathways may represent an effective new therapeutic approach to control inflammation in diseases like rheumatoid arthritis.

EXPERIMENTAL PROCEDURES

Cell Culture, Mice and Reagents

Peripheral blood mononuclear cells (PBMC) were obtained from blood leukocyte preparations purchased from the New York Blood Center by density gradient centrifugation with Ficoll (Invitrogen, Carlsbad, CA, USA) using a protocol approved by the Hospital for Special Surgery Institutional Review Board. Human monocytes were purified from PBMCs immediately after isolation by positive selection with anti-CD14 magnetic beads, as recommended by the manufacturer (Miltenyi Biotec, Auburn, CA, USA) and cultured in RPMI-1640 medium (Invitrogen) supplemented with 10% FBS (Hyclone, Waltham, MA, USA) and M-CSF (10 ng/ml). Monocyte-derived macrophages obtained after 2 d of culture with human M-CSF were used unless otherwise noted in figure legends, and purity of monocytes/macrophages was >97%, as verified by flow cytometric analysis. For stimulation with Fb, macrophages were harvested and added to plates that had been coated with Fb (Sigma Aldrich, St. Louis, MO, USA) by incubation overnight with Fb (100 μg/ml in PBS) followed by PBS washes. Inflammatory arthritis macrophages were purified using anti-CD14 magnetic beads from pre-existing synovial fluids that had been obtained during the course of standard clinical care from patients with inflammatory arthritis using a protocol approved by the Hospital for Special Surgery Institutional Review Board. Experiments with animals were approved by the Hospital for Special Surgery Animal Care and Use Committee. DAP12-deficient (Wang et al., 2008), MSK1/MSK2-deficient (Ananieva et al., 2008) and myeloid lineage p38α-deficient (Kang et al., 2008) mice have been previously described. Heterozygous Syk-deficient mice were from V. Tybulewicz (National Institute for Medical Research, London, UK), and C57BL/6, IL-10-deficient, and Itgb2hypo mice were purchased from Jackson Laboratories, Bar Harbor, ME, USA. Murine BMDMs were obtained by culturing BM cells for 5 days on Petri dishes (Midwest Scientific, St. Louis, MO, USA) with mouse M-CSF (10 ng/ml; Peprotech, Rocky Hill, NJ, USA). Syk-deficient macrophages were obtained using cultures of fetal liver cells as previously described (Wang et al., 2008). Recombinant human IFN-αA was from Biosource International (Camarillo, CA, USA), M-CSF was from PeproTech and LPS and Pam3Cys were from Invivogen (San Diego, CA, USA). BAPTA, W-7, AG17, GF109203X, SB203580 and MG-132 were from CalBiochem (San Diego, CA, USA). ELISA was performed using paired antibodies (Clone numbers JES3-19F1, JES3-12G8, MQ2-13A5, MQ2-39C3, MAb1, Mab11) or kits (Catalog numbers 55252, 555240, 555268) purchased from BD Biosciences (San Jose, CA, USA) following the instructions of the manufacturer.

Immunoblotting

Whole cell extracts were obtained, and protein amounts quantitated with the Bradford assay (BioRad, Hercules, CA, USA). For immunoblotting, cell lysates (10 μg) were fractionated on 7.5% or 10% polyacrylamide gels using SDS-PAGE. Monoclonal antibodies (mAbs) to STAT1 (clone 1) and STAT3 (clone 84) were from BD Transduction Laboratories (Lexington, KY, USA); Pyk2 (N-19), Hes1 (H-140) and TBP (N-12) antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Antibodies specific for pY-STAT1 (Y701) (catalog number 9171), pY- STAT3 (Y705) (number 9131), pY-Pyk2 (Y402) (number 3291), A20/TNFAIP3 (number 4625), pIκBα (S32) (number 2859), pERK(T202/Y204) (number 9101), pJNK(T183/Y185) (number 9251) and SOCS3 (number 2923) were from Cell Signaling Technology (Danvers, MA, USA).

Gene Expression Analysis

Real-time quantitative PCR was performed using triplicate wells and the iCycler iQ real-time PCR detection system (Bio-Rad) as previously described. Oligonucleotide primers were: human SOCS3: 5’- CACTCTTCAGCATCTCTGTCGGAAG -3’ and 5’- CATAGGAGTCCAGGTGGCCGTTGAC -3’; human CXCL9: 5’- ATCAGCACCAACCAAGGGACT -3’ and 5’- GCTTTTTCTTTTGGCTGACCTG -3’; human GAPDH: 5’- ATCAAGAAGGTGGTGAAGCA -3’ and 5’- GTCGCTGTTGAAGTCAGAGGA -3’; human IL-10: 5’- TTATCTTGTCTCTGGGCTTGG -3’ and 5’- GTTGGGGAATGAGGTTAGGG - 3’ ; human A20: 5’- CCGGCTGCGTGTATTTTGGGACTC -3’ and 5’- GGAACCTGGACGCTGTGGGACTGA -3’; human ABIN-3: 5’- GTGCCTGGTCATGTTTTCCT - 3’ and 5’- CATCCATCTGCCAAGTCTCA -3’; human HES1: 5’- CAG GCT GGA GAG GCG GCT AAG GTG -3’ and 5’- GGA GGT GCC GCT GTT GCT GGT GTA -3’; human IL-6: 5’- TAATGGGCATTCCTTCTTCT -3’ and 5’- TGTCCTAACGCTCATACTTTT -3’; human TNFα:5’- AATAGGCTGTTCCCATGTAGC -3’ and 5’- AGAGGCTCAGCAATGAGTGA -3’; mouse GAPDH: 5’- ATCAAGAAGGTGGTGAAGCA -3’ and 5’- AGACAACCTGGTCCTCAGTGT -3’; mouse IL-10: 5’- CTTTGCTATGGTGTCCTTTCA -3’ and 5’- AAGACCCATGAGTTTCTTCAC - 3’; mouse SOCS3: 5’- GTTTACAATTTGCCTCAATCA -3’ and 5’- TTCAAGCATCTTCAGACAGC -3’; mouse A20: 5’- GACCACGGCACGACTCACCTG -3’ and 5’- GATCGCTGTTCTCCTGCCATTTCT -3’; mouse IL-6: 5’- AGGCATAACGCACTAGGTTT -3’ and 5’- AGCTGGAGTCACAGAAGGAG -3’; mouse TNFα: 5’- GTCAGGTTGCCTCTGTCTCA -3’ and 5’- TCAGGGAAGAGTCTGGAAAG -3’.

RNA Interference

Primary human monocytes were nucleofected immediately after isolation with 150 pmol of siRNA oligonucleotides (DHARMACON, Inc., Chicago, IL and Invitrogen) using the Human Monocyte Nucleofector Kit and the AMAXA Nucleofector System according to the manufacturer’s instructions. Cells were harvested 2 or 4 days after nucleofection.

Supplementary Material

01

Acknowledgments

We thank V. Tybulewicz (National Institute for Medical Research, London, UK) for providing Syk-deficient mice and X. Hu for critically reviewing the manuscript. We thank M. Hong and M. Otsuka for assistance with obtaining p38α-deficient macrophages and A. Ding for providing MyD88- and Trif-deficient mice. We thank the Hospital for Special Surgery rheumatologists for providing synovial specimens. This work was supported by grants from the NIH to L.B.I. and the Kirkland Center for Lupus Research. L.W. was supported by a training grant from the NIH (T32 AR07517). K.H.-P.M. is supported by a grant from the Arthritis Foundation. L.W. designed and performed most of the experiments and wrote the manuscript, R.A.G. performed the experiments with arthritic macrophages, L.H., X.S. and K.H.-P.M. contributed to experiments with IFNs, J.H. and J.S.C.A. provided mice and cells, G.D.K. oversaw the arthritic macrophage experiments, and L.B.I. conceptualized the project, designed and supervised research, and wrote the manuscript.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • Abram CL, Lowell CA. The expanding role for ITAM-based signaling pathways in immune cells. Sci STKE 2007. 2007:re2. [PubMed]
  • Abram CL, Lowell CA. The ins and outs of leukocyte integrin signaling. Annu Rev Immunol. 2009;27:339–362. [PMC free article] [PubMed]
  • Adams RA, Schachtrup C, Davalos D, Tsigelny I, Akassoglou K. Fibrinogen signal transduction as a mediator and therapeutic target in inflammation: lessons from multiple sclerosis. Curr Med Chem. 2007;14:2925–2936. [PubMed]
  • Ananieva O, Darragh J, Johansen C, Carr JM, McIlrath J, Park JM, Wingate A, Monk CE, Toth R, Santos SG, et al. The kinases MSK1 and MSK2 act as negative regulators of Toll-like receptor signaling. Nat Immunol. 2008;9:1028–1036. [PubMed]
  • Avraham H, Park SY, Schinkmann K, Avraham S. RAFTK/Pyk2-mediated cellular signalling. Cell Signal. 2000;12:123–133. [PubMed]
  • Behrens EM, Sriram U, Shivers DK, Gallucci M, Ma Z, Finkel TH, Gallucci S. Complement receptor 3 ligation of dendritic cells suppresses their stimulatory capacity. J Immunol. 2007;178:6268–6279. [PubMed]
  • Bode JG, Nimmesgern A, Schmitz J, Schaper F, Schmitt M, Frisch W, Haussinger D, Heinrich PC, Graeve L. LPS and TNFalpha induce SOCS3 mRNA and inhibit IL-6-induced activation of STAT3 in macrophages. FEBS Lett. 1999;463:365–370. [PubMed]
  • Borde M, Barrington RA, Heissmeyer V, Carroll MC, Rao A. Transcriptional basis of lymphocyte tolerance. Immunol Rev. 2006;210:105–119. [PubMed]
  • Brown GD, Herre J, Williams DL, Willment JA, Marshall AS, Gordon S. Dectin-1 mediates the biological effects of beta-glucans. J Exp Med. 2003;197:1119–1124. [PMC free article] [PubMed]
  • Cao W, Rosen DB, Ito T, Bover L, Bao M, Watanabe G, Yao Z, Zhang L, Lanier LL, Liu YJ. Plasmacytoid dendritic cell-specific receptor ILT7-Fc epsilonRI gamma inhibits Toll-like receptor-induced interferon production. J Exp Med. 2006;203:1399–1405. [PMC free article] [PubMed]
  • Coornaert B, Carpentier I, Beyaert R. A20: central gatekeeper in inflammation and immunity. J Biol Chem. 2009;284:8217–8221. [PMC free article] [PubMed]
  • Dennehy KM, Ferwerda G, Faro-Trindade I, Pyz E, Willment JA, Taylor PR, Kerrigan A, Tsoni SV, Gordon S, Meyer-Wentrup F, et al. Syk kinase is required for collaborative cytokine production induced through Dectin-1 and Toll-like receptors. Eur J Immunol. 2008;38:500–506. [PMC free article] [PubMed]
  • Fukao T, Koyasu S. PI3K and negative regulation of TLR signaling. Trends Immunol. 2003;24:358–363. [PubMed]
  • Gantner BN, Simmons RM, Canavera SJ, Akira S, Underhill DM. Collaborative induction of inflammatory responses by dectin-1 and Toll-like receptor 2. J Exp Med. 2003;197:1107–1117. [PMC free article] [PubMed]
  • Gerber JS, Mosser DM. Reversing lipopolysaccharide toxicity by ligating the macrophage Fc gamma receptors. J Immunol. 2001;166:6861–6868. [PubMed]
  • Grazia Cappiello M, Sutterwala FS, Trinchieri G, Mosser DM, Ma X. Suppression of Il-12 transcription in macrophages following Fc gamma receptor ligation. J Immunol. 2001;166:4498–4506. [PubMed]
  • Hamerman JA, Lanier LL. Inhibition of immune responses by ITAM-bearing receptors. Sci STKE 2006. 2006:re1. [PubMed]
  • Hamerman JA, Tchao NK, Lowell CA, Lanier LL. Enhanced Toll-like receptor responses in the absence of signaling adaptor DAP12. Nat Immunol. 2005;6:579–586. [PMC free article] [PubMed]
  • Hammerberg C, Katiyar SK, Carroll MC, Cooper KD. Activated complement component 3 (C3) is required for ultraviolet induction of immunosuppression and antigenic tolerance. J Exp Med. 1998;187:1133–1138. [PMC free article] [PubMed]
  • Hsiao HW, Liu WH, Wang CJ, Lo YH, Wu YH, Jiang ST, Lai MZ. Deltex1 is a target of the transcription factor NFAT that promotes T cell anergy. Immunity. 2009;31:72–83. [PubMed]
  • Hu X, Chung AY, Wu I, Foldi J, Chen J, Ji JD, Tateya T, Kang YJ, Han J, Gessler M, et al. Integrated regulation of Toll-like receptor responses by Notch and interferon-gamma pathways. Immunity. 2008;29:691–703. [PMC free article] [PubMed]
  • Hu X, Paik PK, Chen J, Yarilina A, Kockeritz L, Lu TT, Woodgett JR, Ivashkiv LB. IFN-gamma suppresses IL-10 production and synergizes with TLR2 by regulating GSK3 and CREB/AP-1 proteins. Immunity. 2006;24:563–574. [PubMed]
  • Ivashkiv LB. A signal-switch hypothesis for cross-regulation of cytokine and TLR signalling pathways. Nat Rev Immunol. 2008;12:12. [PMC free article] [PubMed]
  • Ivashkiv LB. Cross-regulation of signaling by ITAM-associated receptors. Nat Immunol. 2009;10:340–347. [PMC free article] [PubMed]
  • Ivashkiv LB, Hu X. The JAK/STAT pathway in rheumatoid arthritis: pathogenic or protective? Arthritis Rheum. 2003;48:2092–2096. [PubMed]
  • Kagan JC, Medzhitov R. Phosphoinositide-mediated adaptor recruitment controls Toll-like receptor signaling. Cell. 2006;125:943–955. [PubMed]
  • Kanamaru Y, Pfirsch S, Aloulou M, Vrtovsnik F, Essig M, Loirat C, Deschenes G, Guerin-Marchand C, Blank U, Monteiro RC. Inhibitory ITAM signaling by Fc alpha RI-FcR gamma chain controls multiple activating responses and prevents renal inflammation. J Immunol. 2008;180:2669–2678. [PubMed]
  • Kang YJ, Chen J, Otsuka M, Mols J, Ren S, Wang Y, Han J. Macrophage deletion of p38alpha partially impairs lipopolysaccharide-induced cellular activation. J Immunol. 2008;180:5075–5082. [PubMed]
  • Kim C, Sano Y, Todorova K, Carlson BA, Arpa L, Celada A, Lawrence T, Otsu K, Brissette JL, Arthur JS, Park JM. The kinase p38 alpha serves cell type-specific inflammatory functions in skin injury and coordinates pro- and anti-inflammatory gene expression. Nat Immunol. 2008;9:1019–1027. [PMC free article] [PubMed]
  • Klesney-Tait J, Turnbull IR, Colonna M. The TREM receptor family and signal integration. Nat Immunol. 2006;7:1266–1273. [PubMed]
  • LeibundGut-Landmann S, Gross O, Robinson MJ, Osorio F, Slack EC, Tsoni SV, Schweighoffer E, Tybulewicz V, Brown GD, Ruland J, Reis e Sousa C. Syk- and CARD9-dependent coupling of innate immunity to the induction of T helper cells that produce interleukin 17. Nat Immunol. 2007;8:630–638. [PubMed]
  • Leon F, Contractor N, Fuss I, Marth T, Lahey E, Iwaki S, la Sala A, Hoffmann V, Strober W, Kelsall BL. Antibodies to complement receptor 3 treat established inflammation in murine models of colitis and a novel model of psoriasiform dermatitis. J Immunol. 2006;177:6974–6982. [PubMed]
  • Lucas M, Zhang X, Prasanna V, Mosser DM. ERK activation following macrophage FcgammaR ligation leads to chromatin modifications at the IL-10 locus. J Immunol. 2005;175:469–477. [PubMed]
  • Manicassamy S, Ravindran R, Deng J, Oluoch H, Denning TL, Kasturi SP, Rosenthal KM, Evavold BD, Pulendran B. Toll-like receptor 2-dependent induction of vitamin A-metabolizing enzymes in dendritic cells promotes T regulatory responses and inhibits autoimmunity. Nat Med. 2009;15:401–409. [PMC free article] [PubMed]
  • Mevorach D, Mascarenhas JO, Gershov D, Elkon KB. Complement-dependent clearance of apoptotic cells by human macrophages. J Exp Med. 1998;188:2313–2320. [PMC free article] [PubMed]
  • Murray PJ. The primary mechanism of the IL-10-regulated antiinflammatory response is to selectively inhibit transcription. Proc Natl Acad Sci U S A. 2005;102:8686–8691. [PMC free article] [PubMed]
  • Murray PJ. The JAK-STAT signaling pathway: input and output integration. J Immunol. 2007;178:2623–2629. [PubMed]
  • Nguyen K, Sylvain NR, Bunnell SC. T cell costimulation via the integrin VLA-4 inhibits the actin-dependent centralization of signaling microclusters containing the adaptor SLP-76. Immunity. 2008;28:810–821. [PubMed]
  • Nimmerjahn F, Ravetch JV. Fcgamma receptors as regulators of immune responses. Nat Rev Immunol. 2008;8:34–47. [PubMed]
  • Otero K, Turnbull IR, Poliani PL, Vermi W, Cerutti E, Aoshi T, Tassi I, Takai T, Stanley SL, Miller M, et al. Macrophage colony-stimulating factor induces the proliferation and survival of macrophages via a pathway involving DAP12 and beta-catenin. Nat Immunol. 2009;10:734–743. [PMC free article] [PubMed]
  • Park-Min KH, Serbina NV, Yang W, Ma X, Krystal G, Neel BG, Nutt SL, Hu X, Ivashkiv LB. FcgammaRIII-dependent inhibition of interferon-gamma responses mediates suppressive effects of intravenous immune globulin. Immunity. 2007;26:67–78. [PubMed]
  • Pasquier B, Launay P, Kanamaru Y, Moura IC, Pfirsch S, Ruffie C, Henin D, Benhamou M, Pretolani M, Blank U, Monteiro RC. Identification of FcalphaRI as an inhibitory receptor that controls inflammation: dual role of FcRgamma ITAM. Immunity. 2005;22:31–42. [PubMed]
  • Sancho D, Joffre OP, Keller AM, Rogers NC, Martinez D, Hernanz-Falcon P, Rosewell I, Reis e Sousa C. Identification of a dendritic cell receptor that couples sensing of necrosis to immunity. Nature. 2009;458:899–903. [PMC free article] [PubMed]
  • Skoberne M, Somersan S, Almodovar W, Truong T, Petrova K, Henson PM, Bhardwaj N. The apoptotic-cell receptor CR3, but not alphavbeta5, is a regulator of human dendritic-cell immunostimulatory function. Blood. 2006;108:947–955. [PMC free article] [PubMed]
  • Sohn JH, Bora PS, Suk HJ, Molina H, Kaplan HJ, Bora NS. Tolerance is dependent on complement C3 fragment iC3b binding to antigen-presenting cells. Nat Med. 2003;9:206–212. [PMC free article] [PubMed]
  • Swiecki MK, Colonna M. Running to stand still: BCR-like signaling suppresses type I IFN responses in pDC. Eur J Immunol. 2007;37:3327–3329. [PubMed]
  • Turnbull IR, Colonna M. Activating and inhibitory functions of DAP12. Nat Rev Immunol. 2007;7:155–161. [PubMed]
  • Turnbull IR, McDunn JE, Takai T, Townsend RR, Cobb JP, Colonna M. DAP12 (KARAP) amplifies inflammation and increases mortality from endotoxemia and septic peritonitis. J Exp Med. 2005;202:363–369. [PMC free article] [PubMed]
  • Wang L, Tassiulas I, Park-Min KH, Reid AC, Gil-Henn H, Schlessinger J, Baron R, Zhang JJ, Ivashkiv LB. ‘Tuning’ of type I interferon-induced Jak-STAT1 signaling by calcium-dependent kinases in macrophages. Nat Immunol. 2008;9:186–193. [PubMed]
  • Weaver BK, Bohn E, Judd BA, Gil MP, Schreiber RD. ABIN-3: a molecular basis for species divergence in interleukin-10-induced anti-inflammatory actions. Mol Cell Biol. 2007;27:4603–4616. [PMC free article] [PubMed]
  • Yamasaki S, Ishikawa E, Sakuma M, Hara H, Ogata K, Saito T. Mincle is an ITAM-coupled activating receptor that senses damaged cells. Nat Immunol. 2008;9:1179–1188. [PubMed]
  • Yoshimura A, Naka T, Kubo M. SOCS proteins, cytokine signalling and immune regulation. Nat Rev Immunol. 2007;7:454–465. [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...