• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
Dev Biol. Author manuscript; available in PMC May 1, 2011.
Published in final edited form as:
PMCID: PMC2862458
NIHMSID: NIHMS186313

Stimulation of Chondrocyte Hypertrophy by Chemokine Stromal Cell-Derived Factor 1 in the Chondro-osseous Junction during Endochondral Bone Formation

Abstract

During endochondral bone formation, chondrocytes undergo differentiation toward hypertrophy before they are replaced by bone and bone marrow. In this study, we found that a G-protein coupled receptor CXCR4 is predominantly expressed in hypertrophic chondrocytes, while its ligand, chemokine stromal cell derived factor 1 (SDF-1) is expressed in the bone marrow adjacent to hypertrophic chondrocytes. Thus, they are expressed in a complementary pattern in the chondro-osseous junction of the growth plate. Transfection of a CXCR4 cDNA into pre-hypertrophic chondrocytes results in a dose-dependent increase of hypertrophic markers including Runx2, Col X, and MMP-13 in response to SDF-1 treatment. In organ culture SDF-1 infiltrates cartilage and accelerates growth plate hypertrophy. Furthermore, a continuous infusion SDF-1 into the rabbit proximal tibial physis results in early physeal closure, which is accompanied by a transient elevation of type X collagen expression. Blocking SDF-1/CXCR4 interaction suppresses the expression of Runx2. Thus, interaction of SDF-1 and CXCR4 is required for Runx2 expression. Interestingly, knocking down Runx2 gene expression results in a decrease of CXCR4 mRNA levels in hypertrophic chondrocytes. This suggests a positive feedback loop of stimulation of chondrocyte hypertrophy by SDF-1/CXCR4, which is mediated by Runx2.

Keywords: SDF-1/CXCR4, Chondrocyte Differentiation, Growth Plate

Introduction

All long bones in the vertebrate limb are developed through a process called endochondral bone formation, in which bone is formed from a cartilage anlage. The growth of the cartilage anlage, which is called a growth plate, determines the size and shape of the long bone. This morphogenic process is uniquely regulated by pathways within the growth plate and tissues adjacent to the growth plate cartilage. One of these neighboring tissues is the bone marrow located at the base of the growth plate adjacent to the hypertrophic zone.

The hypertrophic chondrocyte is an important regulatory cell during endochondral bone formation because bone lengthening is driven primarily by the rate of differentiation of the hypertrophic chondrocytes from proliferating chondrocytes. Type X collagen and matrix metalloprotease 13 (MMP-13) are well-known molecular markers up-regulated during chondrocyte hypertrophy (Schmid and Linsenmayer, 1985), while Runt-related transcription factor 2 (Runx2) is a transcription factor that promotes chondrocyte hypertrophy (Wang et al., 2004). Runx2(−/−) mice lack hypertrophic chondrocytes, while targeted expression of Runx2 in non-hypertrophic chondrocytes accelerates chondrocyte differentiation and leads to maturation of chondrocytes that do not normally become hypertrophic (Ducy et al., 1997; Komori et al., 1997). Previous studies have shown that the degradation of hypertrophic cartilage requires the presence of bone marrow (Cole et al., 1992). However, the molecular mechanism of this induction remains elusive. We hypothesize that the induction of hypertrophic matrix degradation may involve chemokine stromal cell-derived factor 1 (SDF-1) secreted by cells in the bone marrow area adjacent to the hypertrophic cartilage in the chondro-osseous junction.

Chemokines are soluble peptides that regulates cell movement, morphology, proliferation, and differentiation (Pulsatelli et al., 1999). Chemokines achieve their regulation by signaling through a family of seven transmembrane G-protein coupled receptors. SDF-1 is an 8 KDa peptide originally isolated from a bone marrow stromal cell line (Jo et al., 2000), which activates various primary cells by binding solely to its receptor, CXCR4 (Mohle et al., 1998; Pulsatelli et al., 1999). SDF-1 is also found in other cells, including endothelial cells and osteoblasts (Jung et al., 2006; Kollet et al., 2003; Sun et al., 2005). It has been shown previously that SDF-1 and its receptor CXCR4 play an important role in cell migration, embryonic development, and human immunodeficiency virus infection. SDF-1 signaling is important during development and morphogenesis, as both SDF-1 and CXCR4 knockout mice exhibit significant developmental abnormalities that lead to embryonic lethality (Ma et al., 1998). The goal of this study is to determine the distribution pattern of SDF-1 and its receptor CXCR4 in the growth plate, and to determine whether SDF-1/CXCR4 signaling regulates chondrocyte differentiation during endochondral bone formation.

Materials and Methods

Generation of Retrovirus Containing CXCR4 cDNA

CXCR4 cDNA was cloned into a myc-tagged retro-viral vector (RCAS) by RT-PCR from total RNA isolated from chick sternal cartilage with primers 5'- CAT GCC ATG GCA ATG GAC GGT TTG GAT −3', and 5'- CAT GCC ATG GCA GCT GGA ATG GAA ACT TGA −3' (sequence from 60 to 1133), designed according to a DNA sequence from GenBank™ (accession number AF294794) (Table 1). PCR products were digested with ClaI and ligated into a RCAS vector. RCAS-CXCR4 was sequenced to ensure no spontaneous mutations during subcloning. CDNAs contained myc as a marker of the exogenously transfected product. CXCR4-RCAS and empty RCAS vector were transfected into chicken embryonic fibroblasts respectively, and the virus was harvested from the medium as previously described (Chen et al., 1995). Medium from fibroblasts not transfected (mock) was also collected as a control.

Table 1
RT-PCR Oligonucleotide primer sequences used for detection of target genes’ Mrna

Primary chick chondrocyte isolation and culture

Primary cultures of chick embryonic chondrocytes were established as described previously (Chen et al., 1995; Gibson and Flint, 1985). Caudal (proliferative), middle (prehypertrophic), and cephalic (hypertrophic) parts of the sterna from 17-day-old embryonic chickens were separated under a dissection microscope. They were subjected to enzymatic treatment with 0.1% trypsin (Sigma-Aldrich, St. Louis, MO), 0.3% collagenase (Worthington, Freehold, NJ), and 0.1% type 1 testicular hyaluronidase (Sigma-Aldrich, St. Louis, MO) (dissociation medium). After incubating for 30 min. at 37°C, the dissociation medium was removed and replaced with fresh dissociation medium and incubated at 37°C for an additional 1 hour. Chondrocytes were resuspended in plating medium plus 0.01% testicular hyaluronidase (plating medium: 10% fetal bovine serum in Ham F-12 medium; Gibco, Grand Island, NY). After culturing overnight, the medium of the chondrocyte culture was replaced with fresh medium without hyaluronidase. Medium was changed every other day.

Chondrocyte Cell Transfection

Primary chicken chondrocytes were cultured as previously described (Chen et al., 1995). When cell cultures became 50% confluent, cells were infected with retrovirus conditional medium containing RCAS/CXCR4, or empty RCAS, or mock (no virus). After a four-day incubation, transfected cells were analyzed by immunocytochemistry with a mAb against myc-tag (9B11 Cell signaling, Danvers, MA) to confirm the infection. Before collecting samples for experiment, the cells were stimulated with SDF-1 (100ng/mL; Cat# 351-FS, R&D Systems, Inc. Minneapolis, MN) for 24h or pretreated with AMD3100 for 2 h (5ug/mL; Cat# 155148–31–5, Sigma-Aldrich, St. Louis, MO), a specific inhibitor for CXCR4, before stimulation with SDF-1. In some cases, the cells were transfected with full length Runx2 cDNA plasmid (a gift from Dr. D. Chen, Rochester University) or Runx2-siRNA (Dharmacon Com. Lafayette, CO).

Immunocytochemistry

After four-day incubation, transfected cells were analyzed by immunocytochemistry with a mAb against myc-tag (1:200, Cat# 9B11, Cell signaling, Danvers, MA). The transfected cells on 8 chamber polystyrene vessel tissue culture treated glass slides (REF 354108, BD biosciences, Bedford, MA) were fixed at −20°C with 70% ethanol, 50 mM glycine, pH 2.0 for 20 min. Slides were then washed with PBS and incubated with primary antibodies. After washing with PBS, affinity-purified TRITC conjugated donkey anti-mouse antibodies (1:500, Jackson ImmunoResearch, West Grove, PA) were applied with Hoechst nuclear dye (0.5 mg/ml). Slides were washed and mounted in 95% glycerol in PBS. Single or multiple exposure photography was performed with a Nikon E800 microscope (Melville, NY).

Organ culture

Whole sterna were isolated from 15 day old embryonic chickens and cultured in HBSS containing synthetic SDF-1 peptide (100ng/ml; 351-FS, R&D Systems, Inc. Minneapolis, MN) for 1 hr, 3hr, and 24hr. Tibia growth plates were isolated from 12-day-old embryonic chicken and cultured in F12 containing 10% FBS and, synthetic SDF-1 peptide (100ng/ml) for 2, 4, and 6 days. The samples were collected, embedded in Tissue Tek (Sakura Finetechanical Co., Ltd., Tokyo, Japan), and subjected to frozen sectioning. Ten µm sections were analyzed by immunohistochemistry with a mAb against SDF-1 (25 µg/mL; MAB 310, R&D Systems, Inc. Minneapolis, MN) or with a mAb against type X collagen (1:2 dilution; Cat# X-AC-9, Developmental Studies Hybridoma Bank, Iowa City, IA). To detect the distribution of Runx2 in growth plate, 10 µm sections from one-day-old mice tibia growth plates (C57BL/6) was analyzed by immunofluorescent staining with a rabbit Ab against Runx2 (1:200; Cat# AB/RNT20, CeMines, Inc. Golden, CO). The sections were fixed at −20°C with 70% ethanol, 50 mM glycine, pH 2.0 for 20 min. Slides were then washed with PBS and incubated with primary antibody. After washing with PBS, affinity-purified TRITC conjugated donkey anti-mouse antibody or affinity-purified FITC conjugated donkey anti-rabbit antibody (1:500, Jackson ImmunoResearch, West Grove, PA) were applied with Hoechst nuclear dye (0.5 mg/ml). The sections were washed and mounted in 95% glycerol in PBS. Single or multiple exposure photography was performed with a Nikon E800 microscope (Melville, NY).

Immunohistochemistry

To detect the distribution of CXCR4 and SDF-1 in growth plate, the knee joints from one-day-old mice (C57BL/6) were fixed overnight in 4% paraformaldehyde in phosphate-buffered saline (pH 7.4), dehydrated in ethanol, cleared in xylene, and embedded in paraffin. Ten µm sections were prepared and collected on positively charged glass slides (Superfrost Plus, Fisher Scientific). The sections were dried on a hot plate to increase adherence to the slides. Immunohistochemistry was carried out using the Histostain-SP Kits (Zymed, Cat# 95–9943). Sections were de-paraffined and re-hydrated through conventional methods. Endogenous peroxidase was blocked by treating the sections with 3% hydrogen peroxide in methanol for 30 min. The sections were digested by 5 mg/mL hyaluronidase (Cat# H3506, Sigma-Aldrich, St. Louis, MO) for 20 min. Nonspecific protein binding was blocked by incubation with a serum blocking solution. The sections were incubated with affinity-isolated Ig G fractions of monoclonal mouse Ab against human CXCR4 (25µg/mL; Cat# MAB171 R&D Systems, Inc., Minneapolis, MN) and a mAb against SDF-1 (25µg/mL; Cat# MAB310 R&D Systems, Inc., Minneapolis, MN) respectively at 4°C overnight. The negative control sections were incubated with isotype control (25µg/mL; Cat# MAB002 R&D Systems, Inc., Minneapolis, MN) in 0.01 M PBS. Thereafter, the sections were treated sequentially with ready to use biotinylated secondary antibody and ready to use streptavidin-peroxidase conjugate (Zymed), then were followed by standardized development in AEC chromogen (Zymed). The sections were counterstained with ready to use hematoxylin (Zymed). Photography was performed with a Nikon E800 microscope (Melville, NY).

Reverse transcriptase-polymerase chain reaction (RT-PCR)

Seventeen-day-old embryonic chicken sterna were separated into three parts under a dissection microscope: lower third/caudal (proliferative zone), middle (prehypertrophic zone), and upper third/cephalic (hypertrophic zone). Total RNA was extracted from each zone using RNeasy mini kit (Qiagen, Valencia, CA) according to the manufacturer's protocol. First-strand complementary DNA (cDNA) was made from 1 µg of total RNA with Superscript II reverse transcriptase (Gibco BRL) following the manufacturer's protocol. Primers used in amplification of target genes mRNA are shown in Table 1. PCR reactions were performed as follows: 40 cycles with the GoldTaq PCR system (Perkin Elmer, Norwalk, CT) at 94°C for 30 seconds, 50°C for 1 minute, and 72°C for 2 minutes. GAPDH housekeeping gene mRNA was amplified at the same time as the internal control. The amplified cDNA fragments were detected by electrophoresis in 1.2% (weight/volume) agarose gels.

Real-time PCR

After cells were incubated with SDF-1 for 24 hours, total RNA was isolated with the RNeasy mini kit (QIAGEN). One µg total of RNA was reverse transcribed with the iScript™ cDNA Synthesis Kit (Bio-Rad, Hercules, CA). Real-time quantitative PCR amplification was performed using the QuantiTect SYBR Green PCR kit (QIAGEN, Valencia, CA) with the DNA Engine Opticon 2 Continuous Fluorescence Detection System (MJ Research, Waltham, MA). Primers used in amplification of target genes mRNA are shown in Table 1. mRNA levels were normalized to 18S mRNA levels (Zhen, 2001). Calculation of mRNA values was performed as previously described (Wei L, 2006). The cycle threshold (Ct) values for 18S RNA and that of samples were measured and calculated by computer software (MJ Research, Waltham, MA). Relative transcription levels were calculated as x = 2−ΔΔCt, in which ΔΔCt = ΔE − ΔC, and ΔE =Ctexp−Ct18s; ΔC = Ctctl−Ct18s.

In Vivo infusion of SDF-1 in rabbit tibial physis

The study was approved by the Institutional Animal Care and Use Committee of Rhode Island Hospital. The animals were a subset of those used for a previous study (Lee et al., 2007). A continuous infusion system consisting of a fenestrated catheter and an osmotic pump were implanted into the right proximal tibial physis of twenty six-week-old New Zealand White rabbits (Millbrook Breeding Labs, Amherst, MA). Ten animals received an osmotic pump loaded with human recombinant SDF-1 α (PeproTech, Rocky Hill, New Jersey) at a concentration of 250 µg/mL in phosphate-buffered saline solution for 4 weeks (SDF-1 -treated group). The sham-treated group consisted of ten rabbits implanted with a pump housing phosphate-buffered saline solution for 4 weeks. The catheter was inserted into the growth plate cartilage and after 8 weeks was in the subchondral bone marrow region due to growth.

Two rabbits were randomly chosen from both the SDF-1-treated group and the sham-treated group at two and four weeks after implantation. The animals were killed with a sodium pentobarbital overdose (100 mg/kg). The remaining rabbits from each group were killed at eight weeks with use of the same method. The proximal part of the tibiae from the rabbits was harvested, placed in 4% paraformaldehyde for 2 days, decalcified in Richman-Gelfand-Hill solution for sixteen hours, washed with tap water for eight hours, dehydrated with serial ethanol and xylene washes, and then were embedded in paraffin. Multiple 6-µm sections were obtained and stained with hematxylin and eosin as well as safranin O for histological analysis.

To quantify the mRNA level of type X collagen, a Paradise FFPE Reagent System kit (Molecular Devices, Sunnyvale, CA) was used to extract and amplify RNA from laser captured cells (Sabo et al., 2008). In brief, 6-µm sections were air dried and dehydrated through graded alcohols, and subjected to laser captured microdissection (LCM) within 2 h of deparaffinization. Five thousand cells were microdissected from the proliferative and hypertrophic zone tissue sections respectively and captured on LCM Macro CapSure caps (Molecular Devices) using an AutoPix Automated LCM instrument (Molecular Devices). The quantification of mRNA was performed by real time PCR using the QuantiTect SYBR Green PCR kit (QIAGEN, Valencia, CA) with the DNA Engine Opticon 2 Continuous Fluorescence Detection System (MJ Research, Waltham, MA). Primers (5’-3’) for rabbit Type X collagen were: forward, CCAGTGAGAGGAGAACAAGG; reverse, TGGCACAGAAATGCCAGCTG (Access Number: AF247705. 306bp). Amplification conditions were as follows: 2 min preincubation at 50°C, 10 minutes at 95°C for enzyme activation, and 40 cycles at 95°C denaturation for 10s, 55°C annealing for 30s and 72°C extension for 30s. The comparative threshold cycle (Ct) method, i.e., 2−ΔΔCT method was used for the calculation of fold amplification (Wei L, 2006).

Statistical analysis

Two-tailed t-tests were used to compare mRNA levels from proliferative chondrocyte to hypertrophic chondrocytes. MRNA levels in chondrocytes under different conditions were analyzed by one-way ANOVA with the Dunnett Multiple Comparison post-hoc test at a rejection level of 5% unless specifically noted.

Results

Distribution of CXCR4 and SDF-1 in a growth plate

As the first step to evaluate the potential role of the SDF-1/CXCR4 axis in the growth plate, we analyzed distribution of SDF-1 and its receptor CXCR4 in tibial growth plates from one-day-old mice by immunohistochemistry (Fig. 1). SDF-1 receptor, CXCR4, was strongly expressed in the hypertrophic zone of the growth plate, while weak expression was found in the proliferative and prehypertrophic zones (Fig. 1A, red color). SDF-1 was present at very low levels in growth plate cartilage in comparison to its strong expression in the bone marrow area adjacent to the hypertrophic zone of the growth plate (Fig. 1B, brown color).

Fig. 1
Distribution of SDF-1 and CXCR4 in the growth plate

Expression levels of CXCR4, Type X collagen, and Runx2 in the growth plate

To quantify the expression levels of CXCR4 in different zones of growth plates, we used embryonic chicken sterna, which were separated into the three different zones under a dissection microscope. Quantitative real time RT-PCR analysis indicated that CXCR4 mRNA was most highly expressed in hypertrophic chondrocytes, while it was expressed at very low levels in the proliferating or pre-hypertrophic chondrocytes (Fig. 2A, 2B). This is similar to the up-regulation of type X collagen and Runx2 mRNA in hypertrophic chondrocytes (Fig. 2B).

Fig. 2
Expressions of CXCR4, Type X, and Runx2 in proliferative, pre-hypertrophic, and hypertrophic chondrocytes

SDF-1/CXCR4 interaction stimulates chondrocyte hypertrophy

To test whether the interaction of SDF-1 and CXCR4 stimulates chondrocyte hypertrophy, we cloned a full-length CXCR4 cDNA from chicken growth plate chondrocytes and then cloned it into a retroviral vector RCAS. The RCAS-CXCR4 cDNA was then transfected into proliferative chondrocytes (Fig 3A). Cells transfected with CXCR4 showed a significant increase of type X collagen and MMP-13 mRNA levels in response to SDF-1 treatment in a dose-dependent manner (Fig. 3B and 3C). In contrast, proliferative chondrocytes transfected with empty vector RCAS had no increase in the mRNA levels of type X collagen or MMP13 in response to SDF-1 treatment.

Fig. 3
SDF-1/CXCR4 induction of chondrocyte hypertrophy

SDF-1 infiltrates cartilage tissue and accelerates growth plate hypertrophy

To determine whether SDF-1 could conceivable diffuse into growth plate cartilage tissue from adjacent tissue, sternal cartilage was incubated with 100ng/ml SDF-1 for 1, 3, and 24 h in organ culture. Immunohistochemistry was performed to detect SDF-1 in cartilage tissue using a mAb against SDF-1. While SDF-1 was barely detectable after 1hr incubation (Fig. 4A), a faint staining of SDF-1 was detected around chondrocytes after 3hr incubation (Fig. 4B). SDF-1 was detected surrounding many chondrocytes after 24hr incubation (Fig. 4C). This suggests that SDF-1 is capable of diffusing into cartilage tissue and interacting with chondrocytes.

Fig. 4
SDF-1 can diffuse into cartilage

To further test whether SDF-1 induces chondrocyte hypertrophy in organ culture, entire tibia cartilaginous growth plates were dissected from 12-day old chicken embryos and incubated in the presence or absence of SDF-1 (100 ng/ml) for 2, 4, and 6 days. Immunohistochemical analysis with a mAb against type X collagen was performed to determine the length of the hypertrophic zone. Compared to non-SDF-1 treated samples, the length of the hypertrophic zone was increased significantly after incubation with SDF-1 for 4 days, and was further increased after incubation for 6 days (Fig. 5). The decrease of the length of the proliferative and pre-hypertrophic zones in the SDF-1 treated growth plate was also accelerated, possibly due to an increase of the conversion rate to hypertrophy.

Fig. 5
SDF-1 accelerates growth plate chondrocyte hypertrophy in organ culture

SDF-1/CXCR4 interaction stimulates Runx2 expression

To test whether SDF-1 treatment of chondrocytes induces Runx2, proliferating chondrocytes were incubated with 100ng/ml SDF-1 after transfection with CXCR4 or empty vector. Real time RT-PCR results indicated that SDF-1 induced Runx2 mRNA expression in chondrocytes transfected with CXCR4 expression construct (Fig. 6A). Furthermore, this induction of Runx2 was partially inhibited by AMD3100, a specific inhibitor of CXCR4 (Fig. 6A). Western blot results show that the changes in Runx2 protein levels were similar to the changes in Runx2 mRNA (Fig. 6B).

Fig. 6
SDF-1/CXCR4 signaling regulates Runx2 expression

Runx2 regulates CXCR4, MMP-13, and type X collagen expression

To determine whether up regulation of CXCR4 in hypertrophic chondrocytes was dependent on Runx2 expression, hypertrophic chondrocytes from 17-day-old chicken embryo sterna were transfected with Runx2 SiRNA and/or Runx2 cDNA. Over-expression of Runx2 resulted in an increase of CXCR4 (Fig. 7A), MMP-13 (Fig. 7B), and type X collagen mRNA levels (Fig. 7C), while knocking down Runx2 expression led to a decrease of CXCR4, MMP-13, and type X collagen mRNA levels (Fig. 7A, 7B, and 7C).

Fig. 7
Runx2 regulates CXCR4, MMP-13, and Type X collagen expression

SDF-1 induces physeal closure and stimulates type X collagen expression in rabbit proximal tibial physis

To determine the effect of activating the SDF-1/CXCR4 pathway on regulation of chondrocyte differentiation in vivo, human recombinant SDF-1 (250 µg/mL) or PBS controls were administrated into a growth plate in vivo by using a continuous infusion system, consisting of a fenestrated catheter and an osmotic pump implanted into the right proximal tibial physis of twenty six-week-old New Zealand White rabbits. As we reported previously, in the SDF-1-treated group, the SDF-1-treated leg demonstrated a significant decrease in length of 3.7±3.1 mm compared with the control leg (p=0.006; Lee et al., 2007). Histologic analysis indicates a marked difference in physeal morphology between the SDF-1-treated and PBS-treated groups at the eight-week time-point. The PBS-treated physes demonstrated a normal column cellular arrangement (Fig. 8A-a), while the SDF-1-treated physes were narrowed with gross disruption of the columnar organization. The border between the residual proliferative and hypertrophic zones of SDF-1-treated physes was indistinct, and the cartilage column was replaced by vessels and new bone formation, similal to normal physeal closure (Fig. 8B–a). To determine whether the SDF-1 induced physeal closure involves stimulation of chondrocyte hypertrophy, 5,000 cells were microdissected through laser capture from the proliferative and hypertrophic zones of the proximal tibial physis respectively (Fig. 8A–b and 8A –c). Five thousand cells were also microdissected from the residual growth plate without distinction between the proliferative and hypertrophic zones in the physes treated with SDF-1 for eight weeks (Fig. 8B–c). Real time RT-PCR results demonstrated that in controls, type X collagen expression was only detectable in the hypertrophic zone and the residual growth plate, but not in the proliferative zone. After SDF-1 treatment for four weeks, Col X mRNA levels were increased in the hypertrophic zone compared to control (Fig. 8C). After SDF-1 treatment for two weeks, Col X mRNA levels were not increased compared to control. The Col X mRNA level in the residual growth plate of the eight week SDF-1 treatment group was equivalent to that in the hypertrophic zone of the control rabbits (Fig. 8C).

Figure 8Figure 8
SDF-1 infusion results in the tibial physeal closure and stimulates type X collagen expression

Discussion

The cartilaginous growth plate determines the size and shape of a long bone by maintaining sequential differentiation of chondrocytes from proliferation to hypertrophy, and by regulating the production rate of hypertrophic chondrocytes. Misregulation of this process may lead to chondrodysplasia. The signaling pathways regulating growth plate chondrocyte hypertrophy are not completely understood. There are two major transition points regulating chondrocyte hypertrophy. The first is the entry of the hypertrophic stage from proliferation, which occurs mainly in the pre-hypertrophic zone that expresses the Ihh and PTHrP receptors. Previous studies have suggested a negative feedback loop in which Ihh induces PTHrP at the proximal end of the growth plate, whose interaction with its receptor in the prehypertrophic zone potently inhibits chondrocyte entry into hypertrophy (Vortkamp et al., 1996). The second transition point is the exit of hypertrophic cartilage to bone, which occurs at the chondro-osseous junction. Previous studies have shown that this transition requires degradation of hypertrophic cartilage, which is not only mediated by metalloproteinases including MMP 9 and 13 in hypertrophic chondrocytes (Vu et al., 1998), but also is induced by the presence of cells from the bone marrow area in the chondro-osseous junction (Cole et al., 1992). However, the molecular nature of this induction remains elusive.

Our study suggests that the chemokine stromal cell-derived factor 1 (SDF-1) may be involved in this process. We found that SDF-1 and its receptor CXCR4 are expressed in a complementary pattern at the chondro-osseous junction in the growth plate, with hypertrophic cartilage positive for the receptor CXCR4, and its adjacent bone marrow expressing the ligand SDF-1. Interestingly, such a complementary expression pattern of SDF-1/CXCR4 exists in a wide variety of opposed tissue pairs during development, including gastrular mesoderm/ectoderm, vascular endothelium/mesoderm, thyroid endodermal epithelium/mesenchyme, and nasal ectodermal epithelium/mesenchyme (McGrath et al., 1999). Such a complementary gene expression pattern results in a paracrine regulatory mechanism in which an SDF-1 producing tissue induces the development of the opposing tissue that expresses CXCR4. Based on this complementary gene expression pattern in the growth plate, we hypothesized that SDF-1 from bone marrow induces and/or enhances differentiation and degradation of hypertrophic cartilage, which expresses CXCR4.

In this study, we tested this hypothesis directly by examining the role of the chemokine SDF-1 and its receptor CXCR4 in this regulatory process in cells, organ cultures, and in vivo. We found that transfection of CXCR4 into proliferative chondrocytes resulted in a dose-dependent increase of MMP-13 and type X collagen in response to SDF-1 treatment. Both MMP-13 and type X collagen are well-known markers for hypertrophic chondrocytes. In organ culture, SDF-1 is capable of diffusing into sternal cartilage rapidly and accumulates around chondrocytes. This suggests that SDF-1 synthesized by cells in bone marrow may be capable of diffusing into the adjacent cartilage in the chondro-osseous junction. Previous data have shown that SDF-1 binds to glycosaminoglycans in the extracellular matrix or on the cell surface (Fermas et al., 2008; Uchimura et al., 2006; Mbemba et al., 1999). Such binding may stabilize SDF-1 and result in its accumulation around chondrocytes.

We have shown that, when a tibia growth plate was incubated with SDF-1, SDF-1 stimulated elongation of the hypertrophic zone at the distal end of the growth plate towards the proximal end. However, it did not result in a neo hypertrophic zone at the top of the growth plate. How is this polarity achieved? Our data suggest that this zone specific induction may be due to the specific expression of the SDF-1 receptor CXCR4 in the hypertrophic cartilage. We have shown that induction of hypertrophic chondrocyte markers, including Runx2, Col X, and MMP-13 in chondrocytes, requires the presence and interaction of both SDF-1 and CXCR4. In organ culture, although SDF-1 infiltrates the growth plate tissue in all directions, only the distal region of a growth plate contains CXCR4, and this is the area where hypertrophy is enhanced by SDF-1. Since a major source of SDF-1 in vivo is from cells in the bone marrow area at the chondro-osseous junction adjacent to the hypertrophic cartilage, these cells may be involved in inducing the hypertrophic cartilage phenotype including synthesis of type X collagen and MMP-13 (Inada et al., 2004).

The in vivo effects of SDF-1 on gene expression in the growth plate were consistent with our in vitro findings. Elevation of SDF-1 concentration in rabbit growth plates in vivo leads to increased type X collagen gene expression, degradation of the cartilage matrix, potentially from MMP-13, and premature closure of the growth plate (Lee et al., 2007). Thus, the closure of growth plate in the SDF-1-treated physis is associated with stimulation of chondrocyte hypertrophy.

Interaction of SDF-1 and CXCR4 in articular chondrocytes results in up-regulation and release of MMP-3, −9, and −13 (Kanbe et al., 2002; Kanbe et al., 2004). Interestingly, high concentration of SDF-1, which occurs in the synovium of rheumatoid arthritis and osteoarthritis patients, results in death of articular chondrocytes (Lei Wei, 2006). Since chondrocytes from the hypertrophic zone of a growth plate and those from OA articular cartilage share some common features including up-regulation of Col X and MMP-13, one may hypothesize that a high concentration of SDF-1 may also contribute to cell death occurring in the chondro-osseous junction in the growth plate, similar to that in OA cartilage. This hypothesis remains to be tested.

Our study reveals a role for Runx2, a transcription factor critical for bone formation (Dong et al., 2006; Ducy et al., 1997; Kamekura et al., 2006; Komori et al., 1997; Yoshida et al., 2004; Zou et al., 2006) in regulating chondrocyte hypertrophy by SDF-1/CXCR4 signaling. This role is twofold. First, Runx2 mediates SDF-1 induction of chondrocyte hypertrophy. We have shown that treating the CXCR4 cDNA transfected proliferating chondrocytes with SDF-1 resulted in a significant increase of Runx2 mRNA and protein levels. Runx2, in turn, was involved in activating Col X expression. Recent data have shown that SDF-1 also regulates osteoblast properties through Runx2 (Wei Zhu, 2007). Second, Runx2 up-regulates CXCR4 in hypertrophic chondrocytes. Through Runx2 over-expression and knock-down experiments, we demonstrated that Runx2 plays an important role for CXCR4 expression in hypertrophic chondrocytes. Thus, our findings suggest a positive feedback loop in which Runx2 regulates chondrocyte differentiation through activation of SDF-1/CXCR4 signaling; and activation of SDF-1/CXCR4 signaling further enhances Runx2 expression, thereby inducing chondrocyte hypertrophy.

Supplementary Material

01

Supplement Fig.1 The immuno-fluorescent stained images of type X collagen (right) are superior to the H&E stained images (left) for identifying the border between the pre-hypertrophic and hypertrophic zones..

02

Supplement Fig.2. Runx2 siRNAinhibits Runx2 Expression. Hypertrophic chondrocytes from 17-day chicken embryo sterna were transfected with Runx2 expression construct, Runx2 siRNA and/or control siRNA. Runx2 overexpression could be knocked down with Runx2 siRNA (* p<0.05).

Acknowledgments

This project was supported by grants AR052479, AG14399, AG00811, P20RR024484 from NIH, and a grant from the Aircast Foundation. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Center of Research Resources or the National Institutes of Health.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • Chen Q, Johnson DM, Haudenschild DR, Tondravi MM, Goetinck PF. Cartilage matrix protein forms a type II collagen-independent filamentous network: analysis in primary cell cultures with a retrovirus expression system. Mol. Biol. Cell. 1995;6:1743–1753. [PMC free article] [PubMed]
  • Cole AA, Luchene LJ, Linsenmayer TF, Schmid TM. The influence of bone and marrow on cartilage hypertrophy and degradation during 30-day serum-free culture of the embryonic chick tibia. Dev. Dyn. 1992;193:277–285. [PubMed]
  • Dong YF, Soung DY, Schwarz EM, O'Keefe RJ, Drissi H. Wnt induction of chondrocyte hypertrophy through the Runx2 transcription factor. J Cell. Physiol. 2006;208:77–86. [PubMed]
  • Ducy P, Zhang R, Geoffroy V, Ridall AL, Karsenty G. Osf2/Cbfa1: a transcriptional activator of osteoblast differentiation.[see comment] Cell. 1997;89:747–754. [PubMed]
  • Fermas S, Gonnet F, Sutton A, Charnaux N, Mulloy B, Du Y, Baleux F, Daniel R. Sulfated oligosaccharides (heparin and fucoidan) binding and dimerization of stromal cell-derived factor-1 (SDF-1/CXCL 12) are coupled as evidenced by affinity CE-MS analysis. Glycobiology. 2008;18:1054–1064. [PubMed]
  • Gibson GJ, Flint MH. Type X collagen synthesis by chick sternal cartilage and its relationship to endochondral development. J. Cell. Biol. 1985;101:277–284. [PMC free article] [PubMed]
  • Inada M, Wang Y, Byrne MH, Rahman MU, Miyaura C, Lopez-Otin C, Krane SM. Critical roles for collagenase-3 (Mmp13) in development of growth plate cartilage and in endochondral ossification. Proc. Natl. Acad. Sci. U. S. A. 2004;101:17192–17197. [PMC free article] [PubMed]
  • Jo DY, Rafii S, Hamada T, Moore MA. Chemotaxis of primitive hematopoietic cells in response to stromal cell-derived factor-1. J. Clin. Invest. 2000;105:101–111. [PMC free article] [PubMed]
  • Jung Y, Wang J, Schneider A, Sun YX, Koh-Paige AJ, Osman NI, McCauley LK, Taichman RS. Regulation of SDF-1 (CXCL12) production by osteoblasts; a possible mechanism for stem cell homing. Bone. 2006;38:497–508. [PubMed]
  • Kamekura S, Kawasaki Y, Hoshi K, Shimoaka T, Chikuda H, Maruyama Z, Komori T, Sato S, Takeda S, Karsenty G, Nakamura K, Chung U-i, Kawaguchi H. Contribution of runt-related transcription factor 2 to the pathogenesis of osteoarthritis in mice after induction of knee joint instability. Arthritis Rheum. 2006;54:2462–2470. [PubMed]
  • Kanbe K, Takagishi K, Chen Q. Stimulation of matrix metalloprotease 3 release from human chondrocytes by the interaction of stromal cell-derived factor 1 and CXC chemokine receptor 4.[see comment] Arthritis Rheum. 2002;46:130–137. [PubMed]
  • Kanbe K, Takemura T, Takeuchi K, Chen Q, Takagishi K, Inoue K. Synovectomy reduces stromal-cell-derived factor-1 (SDF-1) which is involved in the destruction of cartilage in osteoarthritis and rheumatoid arthritis. J. Bone Joint Surg. Br. 2004;86:296–300. [PubMed]
  • Kollet O, Shivtiel S, Chen Y-Q, Suriawinata J, Thung SN, Dabeva MD, Kahn J, Spiegel A, Dar A, Samira S, Goichberg P, Kalinkovich A, Arenzana-Seisdedos F, Nagler A, Hardan I, Revel M, Shafritz DA, Lapidot T. HGF, SDF-1, and MMP-9 are involved in stress-induced human CD34+ stem cell recruitment to the liver. J. Clin. Invest. 2003;112:160–169. [PMC free article] [PubMed]
  • Komori T, Yagi H, Nomura S, Yamaguchi A, Sasaki K, Deguchi K, Shimizu Y, Bronson RT, Gao YH, Inada M, Sato M, Okamoto R, Kitamura Y, Yoshiki S, Kishimoto T. Targeted disruption of Cbfa1 results in a complete lack of bone formation owing to maturational arrest of osteoblasts.[see comment] Cell. 1997;89:755–764. [PubMed]
  • Lee MC, Bier AD, Nickisch F, Eberson CP, Ehrlich MG, Chen Q. Epiphysiodesis with infusion of stromal cell-derived factor-1 in rabbit growth plates. J. Bone Joint Surg. Am. 2007;89:102–113. [PubMed]
  • Lei Wei XS, Wang Z, Sun C, Kanbe K, Terek R, Chen Q. Chondrocyte death induced by pathological concentration of chemokine stromal cell-derived factor-1. J. Rheum. 2006;33 [PubMed]
  • Ma Q, Jones D, Borghesani PR, Segal RA, Nagasawa T, Kishimoto T, Bronson RT, Springer TA. Impaired B-lymphopoiesis, myelopoiesis, and derailed cerebellar neuron migration in CXCR4- and SDF-1-deficient mice. Proc. Natl. Acad. Sci. U.S.A. 1998;95:9448–9453. [PMC free article] [PubMed]
  • Mbemba E, Benjouad A, Saffar L, Gattegno L. Glycans and proteoglycans are involved in the interactions of human immunodeficiency virus type 1 envelope glycoprotein and of SDF-1alpha with membrane ligands of CD4(+) CXCR4(+) cells. Virology. 1999;265:354–364. [PubMed]
  • McGrath KE, Koniski AD, Maltby KM, McGann JK, Palis J. Embryonic expression and function of the chemokine SDF-1 and its receptor, CXCR4. Dev. Biol. 1999;213:442–456. [PubMed]
  • Mohle R, Bautz F, Rafii S, Moore MA, Brugger W, Kanz L. The chemokine receptor CXCR-4 is expressed on CD34+ hematopoietic progenitors and leukemic cells and mediates transendothelial migration induced by stromal cell-derived factor-1. Blood. 1998;91:4523–4530. [PubMed]
  • Pulsatelli L, Dolzani P, Piacentini A, Silvestri T, Ruggeri R, Gualtieri G, Meliconi R, Facchini A. Chemokine production by human chondrocytes. J. Rheum. 1999;26:1992–2001. [PubMed]
  • Sabo E, Meitner PA, Tavares R, Corless CL, Lauwers GY, Moss SF, Resnick MB. Expression analysis of Barrett's esophagus-associated high-grade dysplasia in laser capture microdissected archival tissue. Clin. Cancer Res. 2008;14:6440–6448. [PMC free article] [PubMed]
  • Schmid TM, Linsenmayer TF. Developmental acquisition of type X collagen in the embryonic chick tibiotarsus. Dev. Biol. 1985;107:373–381. [PubMed]
  • Sun YX, Schneider A, Jung Y, Wang J, Dai J, Cook K, Osman NI, Koh-Paige AJ, Shim H, Pienta KJ, Keller ET, McCauley LK, Taichman RS. Skeletal localization and neutralization of the SDF-1(CXCL12)/CXCR4 axis blocks prostate cancer metastasis and growth in osseous sites in vivo. J. Bone Miner. Res. 2005;20:318–329. [PubMed]
  • Uchimura K, Morimoto-Tomita M, Bistrup A, Li J, Lyon M, Gallagher J, Werb Z, Rosen SD. HSulf-2, an extracellular endoglucosamine-6-sulfatase, selectively mobilizes heparin-bound growth factors and chemokines: effects on VEGF, FGF-1, and SDF-1. BMC Biochem. 2006;7:2. [PMC free article] [PubMed]
  • Vortkamp A, Lee K, Lanske B, Segre GV, Kronenberg HM, Tabin CJ. Regulation of rate of cartilage differentiation by Indian hedgehog and PTH-related protein [see comments] Science. 1996;273:613–622. [PubMed]
  • Vu TH, Shipley JM, Bergers G, Berger JE, Helms JA, Hanahan D, Shapiro SD, Senior RM, Werb Z. Mmp-9/gelatinase B is a key regulator of growth plate angiogenesis and apoptosis of hypertrophic chondrocytes. Cell. 1998;93:411–422. [PMC free article] [PubMed]
  • Wang X, Manner PA, Horner A, Shum L, Tuan RS, Nuckolls GH. Regulation of MMP-13 expression by RUNX2 and FGF2 in osteoarthritic cartilage. Osteoarthritis Cartilage. 2004;12:963–973. [PubMed]
  • Wei L SX, Terek R, Chen Q. CD95 induced osteoarthritic chondrocytes apoptosis and necrosis: dependency on p38 mitogen-activated protein kinase. Arthritis Res. Ther. 2006;8:R37. [PMC free article] [PubMed]
  • Wei Zhu OBA, Rawlins BA, Frenkel B, Boskey AL, Ivashkiv LB, Biobel CP. A novel regulatory role for SDF-1 signaling in BMP2-osteogenic differentiation of mesenchymal C2C12 cells. JBC. 2007 [PubMed]
  • Yoshida CA, Yamamoto H, Fujita T, Furuichi T, Ito K, Inoue KI, Yamana K, Zanma A, Takada K, Ito Y, Komori T. Runx2 and Runx3 are essential for chondrocyte maturation, and Runx2 regulates limb growth through induction of Indian hedgehog. Genes Dev. 2004;18:952–963. [PMC free article] [PubMed]
  • Zhen X, Wei L, Wu Q, Zhang Y, Chen Q. Mitogen-activated protein kinase p38 mediates regulation of chondrocyte differentiation by parathyroid hormone. J. Biol. Chem. 2001;276:4879–4885. [PubMed]
  • Zou L, Zou X, Li H, Mygind T, Zeng Y, Lu N, Bunger C. Molecular mechanism of osteochondroprogenitor fate determination during bone formation. Adv. Exp. Med. Biol. 2006;585:431–441. [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...