• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
Biochem Biophys Res Commun. Author manuscript; available in PMC Apr 14, 2010.
Published in final edited form as:
PMCID: PMC2854581
NIHMSID: NIHMS25540

Retinoic Acid-Inducible G Protein-Coupled Receptors Bind to Frizzled Receptors and May Activate Non-canonical Wnt Signaling

Abstract

Frizzled (Fz) seven-pass transmembrane receptors are Wnt receptors and function in a variety of developmental pathways. Here we identify retinoic acid-inducible gene-1, 2, 3, and 4 (RAIG1, 2, 3, and 4) as potential Fz binding proteins. RAIG proteins are seven-pass transmembrane receptors, and Xenopus RAIG2, 3, and 4 are expressed in early gastrula. XRAIG2 can activate small GTPases, such as RhoA, Rac, and Cdc42, and Jun N-terminal kinase, thus exhibit activities that overlap with non-canonical Wnt/Fz signaling. Injection of XRAIG2 mRNA into Xenopus embryo causes a severe shortened and bent body axis due to defective gastrulation movements, reminiscent of abnormal non-canonical Wnt signaling. XRAIG2 affects convergent extension in activin-treated animal caps, which can be partially rescued by co-injection of a dominant-negative form of Cdc42. In zebrafish embryo, XRAIG2 also causes Ca2+ flux, one of the consequences of non-canonical Wnt signaling. These results suggest a possible crosstalk/integration between Wnt/Frizzled and RAIG signal transduction pathways.

Keywords: RAIG, Frizzled, G protein-coupled receptor, RhoA, Rac, Cdc42, JNK, Ca2+ flux, convergent extension, gastrulation

Introduction

Signaling by the Wnt family of secreted growth factors has diverse roles in developmental processes such as cell proliferation, differentiation, polarity and migration [1]. Wnt signaling is mediated via members of the Frizzled (Fz) family of seven-pass transmembrane receptors, and Wnt-Fz interaction activates different intracellular signaling cascades, such as the Wnt/β-catenin signaling pathway and non-canonical Wnt signaling pathways. Canonical Wnt/β-catenin signaling leads to the accumulation of β-catenin protein that associates with the TCF/LEF (T cell factor/Lymphoid enhancer factor) family of transcription factors, resulting in the activation of Wnt-responsive transcription [1]. In Xenopus laevis embryos, Wnt/β-catenin signaling contributes to the establishment of the dorsal-ventral axis. In contrast, non-canonical Wnt signaling controls morphogenetic movements in vertebrates [reviewed in ref. 2]. During gastrulation, dorsal mesodermal cells intercalate in the mediolateral axis (convergence), resulting in anteroposterior extension of the body axis. This convergent extension movement is under the control of non-canonical Wnt signaling involving Wnt-11 and Fz7 [35], which bears significant similarity with the planar cell polarity (PCP) signaling in Drosophila [6]. In this so-called Wnt/PCP signaling pathway, Wnt binding to Fz results in the activation of small GTPases such as RhoA and Rac, and of c-jun N-terminal kinase (JNK) [2, 7, 8], leading to cytoskeletal rearrangements and cell polarization and movements [9, 10]. In addition to Fz, other transmembrane proteins, such as paraxial protocadherin and neurotrophin receptor homologue 1, are also known to activate the Rho family GTPases and JNK [1113] and to regulate convergent extension movements. Non-canonical Wnt signaling also triggers the release of Ca2+ influx [14, 15], resulting in the activation of Ca2+ sensitive protein kinases, such as protein kinase C and calcium/calmodulin-dependent kinase II [reviewed in ref. 2].

In the present study, we screened for binding proteins for Fz by a proteomic analysis, and demonstrated the specific binding between Fz and the protein product of retinoic acid-inducible genes (RAIGs), which encode G protein-coupled seven-pass transmembrane receptor. Interestingly, RAIG can activate Rho family GTPases and JNK and the intracellular Ca2+ release, and perturb convergent extension movements in Xenopus and zebrafish.

Materials and methods

Purification of hFz5-containig protein complex and mass spectrometry

HA-Flag-tagged hFz5 subcloned in pcDNA3 vector was transfected into HeLa cells, and cells stably expressing HA-Flag-hFz5 were isolated in the presence of 400 μg/mL Geneticin. Stable cell lines were propagated as suspension cells, and plasma membrane fraction was purified as described [16]. The plasma membrane fraction was applied to the anti-Flag (M2)-conjugated agarose beads (Sigma), and the hFz5-containing protein complex was eluted with Flag peptide. The eluted fraction was applied to the anti-HA (3F10)-conjugated agarose beads (Roche), and the hFz5-containing protein complex was eluted with HA peptide. The proteins were separated by SDS-PAGE and stained with Coomassie blue. The protein band was excised and analyses by mass spectrometory at the Harvard Medical School Taplin Biological Mass Spectrometry Facility.

RT-PCR–RNA from Xenopus embryo was prepared with TRIzol (invitrogen), and RT-PCR was performed as described [17] using the following primers; XRAIG1 (Fw primer: TCTTTATGTATTGCTGAACCC ; Rv primer: GATGATAATTAGTAGCGCC), XRAIG2 (Fw primer: TTTGTGATTGGCTATGGCTC ; Rv primer: GCAAGCCGGCTTCCTGTC), XRAIG3 (Fw primer: CCATGGCTTGTTTTTCATC ; Rv primer: TTGACAATCGAGCAAGGGT), XRAIG4 (Fw primer: AGTCGGGATGTCCCGTCC ; Rv primer: GATAGCTGATGGAAGGTTATG).

Embryo manipulations and animal cap explant assays

In vitro transcribed capped RNAs (mMessagemMachine, Ambion) were injected into Xenopus embryos at 2 or 4-cell stage as described [17]. Animal cap explant assays were performed using 20 ng/mL activin as described [18].

Whole-mount in situ hybridization

Whole-mount in situ hybridization was performed by using digoxigenin-labeled RNA probe and alkaline phosphatase substrate (NBT/BCIP, Roche) as described [19].

RhoA, Rac, and Cdc42 activity assay

These are performed as described [7].

JNK activity assay

Activation of JNK was determined by monitoring c-Jun phosphorylation. The Myc-tag was introduced at the amino terminus of Xenopus c-Jun in pCS2+ (Myc-c-Jun/pCS2+). RAIG or Fz mRNAs together with myc-tagged c-Jun mRNA (200 pg) was injected into two-cell embryos. At stage 11.5, twenty injected embryos were solubilized with 800 μL of buffer A [20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 2 mM EDTA, 1% (w/v) Triton X-100, 10% (w/v) glycerol, 50 mM, NaF, 1 mM Na3VO4, protease inhibitor cocktail (Roche)]. The extracts were centrifuged for 5 min at 18,400 ×g. The supernatant was incubated with anti-myc antibody (clone 9E10, Santa Cruz) at 4°C for 2 h, followed by incubation with GammaBind G Sepharose at 4°C for 1 h. The beads were washed four times with buffer A. Immunoblotting was performed using an anti-phospho-c-Jun(Ser63) antibody (Cell Signaling) and anti-c-Jun antibody (Santa Cruz).

Results

Human and Xenopus retinoic acid-inducible genes (RAIGs)

To identify proteins potentially involved in Fz function, we designed a strategy to isolate Fz-interacting proteins in the plasma membrane. Fz-containing protein complexes were purified from HeLa cells that stably express human Frizzled 5 (hFz5) tagged with both the Flag and hemagglutinin (HA) epitopes via affinity chromatography (see materials and methods). Mass spectrometric analysis revealed that retinoic acid-inducible gene-1 (RAIG1, HGMW-approved symbol RAI3; ref. 20) is one of the proteins co-purified in the hFz5 precipitates.

Besides RAIG1, three other closely related G protein-coupled receptors (GPCRs) - RAIG2 (HGMW-approved symbol GPRC5B), RAIG3 (HGMW-approved symbol GPRC5C), GPRC5D - have been reported in the human genome, and they form the group 5 of family C GPCRs [2023]. By performing a homology search in the Xenopus EST databases using these human RAIG cDNA sequences, we identified five Xenopus RAIG orthologs, XRAIG1, XRAIG2 (GenBank accession no. EF456760), XRAIG3 (GenBank accession no. EF456761), XRAIG4a (GenBank accession no. EF456762), and XRAIG4b (GenBank accession no. EF456763; Fig. 1A and B). XRAIG1 protein sequence was predicted from an EST clone (IMAGE Consortium clone 4057778). XRAIG4a and XRAIG4b likely represent pseudoalleles due to gene duplication in Xenopus laevis lineage, since they show 96% identity on the amino acid level.

Fig. 1
Amino acid sequence of XRAIGs and the expression pattern of XRAIG mRNAs during embryogenesis

To determine the temporal expression pattern of XRAIGs during embryogenesis, we executed RT-PCR analysis with cDNA derived from Xenopus embryos at various developmental stages. None of the XRAIG genes was expressed maternally (Fig. 1C). XRAIG2, XRAIG3 and XRAIG4 were expressed at the gastrulation and the later stages (Fig. 1C). In contrast, XRAIG1 was not expressed during gastrulation, and the transcript became observed at stage 28 (data not shown) and stage 41 (Fig. 1C). In the early gastrula, XRAIG2 exhibited relatively ubiquitous expression, whereas XRAIG3 and XRAIG4 were predominantly expressed in the ectodermal and dorsal mesodermal tissues (Fig. 1D and E).

Fz-RAIG interaction

To examine the interaction between Fz and RAIG proteins, co-immunoprecipitation analyses were performed in mammalian cell lines. In HEK 293T cells, Flag-tagged hRAIG1 was coexpressed with HA-hFz5 or HA-Smoothened (HA-Smo, ref. 24), which is a seven-transmembrane protein related to the Fz family. HA-hFz5 or HA-Smo was immunoprecipitated from cell lysates with anti-HA antibody. As shown in Fig. 2A, hRAIG1-Flag was co-immunoprecipitated with HA-hFz5 (lane 4), but not with HA-Smo (lane3), indicating specific interaction between hFz5 and hRAIG1 in several types of human cells.

Fig. 2
Interaction between Frizzled and RAIG proteins

Xenopus Frizzled7 (XFz7) plays important roles in dorsal development and gastrulation [4, 5, 25]. XFz7 transcripts are expressed on the dorsal side at the early gastrula stage [4, 5], thus are coexpressed with XRAIG2, 3, and 4 (Fig. 1E). We therefore examined a possible interaction between XFz7 and XRAIG2 in Xenopus embryos. XRAIG2-Flag mRNA was co-injected with HA-hFz5, HA-XFz7, or HA-Smo mRNA into Xenopus embryos, and HA-tagged proteins were immunoprecipitated with anti-HA antibody. As shown in Fig. 2B, Flag-XRAIG2 was co-immunoprecipitated with either HA-hFz5 (Fig. 2B, lane 9) or HA-XFz7 (Fig. 2B, lane 11), but not with HA-Smo (Fig. 2B, lane 8). A truncated form of XRAIG2 lacking the carboxy-terminal cytoplasmic region (XRAIG2ΔC-Flag) also associated with either HA-hFz5 (Fig. 2B, lane 10) or HA-XFz7 (Fig. 2B, lane 12), indicating that the carboxy-terminal cytoplasmic region of XRAIG2 is not necessary for the binding with Fz. Therefore XRAIG2 associates with XFz7 in Xenopus embryos.

Expression of hRAIG1 or XRAIG2 perturbs Xenopus gastrulation

Since hFz5 is known to activate canonical Wnt/β-catenin signaling [26], we next investigated whether hRAIG1 has any effect on this pathway. By RT-PCR analysis, we examined the expression of nodal-related 3 (Xnr3) and siamois, two well-known target genes of Wnt/β-catenin signaling. Injection of hRAIG1 mRNA into two-cell stage embryos induce the expression of neither Xnr3 nor siamois (Fig. 3A, lane 2), and injection of hRAIG1 mRNA into ventral blastomeres at the four-cell stage did not induce any ectopic axis formation (Fig. 3E). Conversely, hRAIG1 mRNA did not inhibit the expression of Xnr3 or siamois induced by Wnt3a or by the Wnt5a/hFz5 combination (Fig. 3B). These results suggest that hRAIG1 is not involved in Wnt/β-catenin signaling. Interestingly, however, embryos injected with hRAIG1 mRNA (1 ng) dorsally showed a reduction of trunk and tail structures and exhibited a spina bifida (64%, n = 53; Fig. 3D), implying the possible role of hRAIG1 in morphogenetic movements, which are regulated through non-canonical Wnt signaling pathway. Indeed, the hRAIG1 overexpression phenotype is very similar to that caused by XFz7 overexpression [4, 5].

Fig. 3
Functional analysis of overexpression of RAIG in Xenopus embryos

Similar to hRAIG1, dorsal injection of 2 ng of either XRAIG2 or XRAIG3 mRNA also resulted in shortening of the body axis (XRAIG2; 100%, n = 66 and XRAIG3; 74%, n = 54; data not shown). To understand whether this phenotype was caused by impaired convergent extension movements, we next executed the animal cap elongation assay. As reported, animal caps treated with activin formed dorsal type mesodermal tissue, which exhibited typical morphogenetic elongation (Fig. 3G). This elongation depended on the non-canonical Wnt-11 signaling and was suppressed by Xdd1, a dominant negative Dishevelled mutant, which is known to inhibit the convergent extension movements (Fig. 3H, ref. 18). XRAIG2 injection also inhibited the activin-induced elongation (Fig. 3I).

Whole mount in situ hybridization analysis showed that XRAIG2 did not affect the induction of mesodermal genes, such as Brachyury (Xbra) and Goosecoid (Gsc) (Fig. 3J-U), but rather altered their expression domain/positioning due to defective gastrulation movements. These results together indicate that XRAIG2 overexpression disrupts convergent extension movements without inhibiting mesoderm formation.

XRAIG activation of small GTPases and JNK

Convergent extension movements are regulated by the non-canonical Wnt signaling pathway through the small GTPases such as RhoA and Rac. Therefore, we examined whether XRAIG2 activated these effectors. As reported, overexpression of mouse Dishevelled 2 (mDvl2) in HEK 293T cells increased the level of GTP-bound active forms of RhoA and Rac, but not Cdc42 (Fig. 4A, ref. 7). Interestingly, overexpression of XRAIG2 in HEK 293T cells increased the level of active form of RhoA and Rac, and also Cdc42 (Fig. 4A). Importantly, XRAIG2 inhibition of elongation in activin-treated animal caps (Fig. 4D) was partially reversed by co-injection of mRNA for Cdc42(N17), a dominant negative form of Cdc42 (Fig. 4E), indicating that Cdc42 is indeed one of the downstream effectors of XRAIG2 signal transduction pathway in vivo.

Fig. 4
Signal transduction by XRAIGs

Convergent extension movement is also regulated by the JNK pathway [27], and components of non-canonical Wnt pathway are known to activate JNK in both Xenopus embryo and mammlian cells [2729]. To examine whether XRAIGs activate JNK, we monitored the phosphorylation level of c-Jun, one of the downstream targets of JNK. Overexpression of XFz7 in Xenopus embryos slightly activates JNK as reported (Fig. 4F, lane 3; ref. 28), and injection of XRAIG2 or XRAIG3 mRNA also increased the phosphorylation level of c-Jun (Fig. 4F, lanes 4 and 5). Interestingly, the phosphorylation level was enhanced by the co-injection of XFz7 and XRAIG3 (Fig. 4F, lane 6), suggesting that XFz7 and XRAIG3 collaboratively activate the same pathway, such as the Rho family GTPases and JNK.

Activation of intracellular calcium flux by XRAIG2

In zebrafish embryo, overexpression of XRAIG2 also caused the multiple defects consistent with alterations in convergent extension movements, including short anteroposterior axis (Fig. 4H) and cyclopia (Fig. 4J). Since activation of Wnt-Ca2+ pathway is also implicated in the regulation of convergent extension movements [30], we investigated the possible stimulation of Ca2+ flux by XRAIG2. In vivo image analysis in zebrafish showed that XRAIG2 overexpression increased Ca2+ release frequency (Fig. 4L), indicating that the phenotypic defects are in part due to the altered Ca2+ flux.

Discussion

RAIG1 was originally identified as a retinoic acid responsive gene in human carcinoma cells [20]. Recently, human RAIG2, RAIG3, and GPCR5D were also identified [2123], and these four genes belong to group 5 of family C GPCRs. Other family C members, such as metabotropic glutamate receptors, calcium sensing receptor, and γ-aminobutyric acid type B receptors, have a large amino terminal extracellular domain of 500–600 amino acids, and the amino terminal domain is shown to be the agonist-binding site. In contrast, human RAIGs have short amino terminal domains of 30–50 amino acids. In the present study, we identified RAIGs as potential binding partners for Fz proteins. We report the sequence of five Xenopus orthologs of RAIGs, which also have characteristically short amino terminal domains. The endogenous ligands for RAIGs remain unknown, but the ligand-binding domain may lie in the extracellular loops of transmembrane domain as well as the short amino terminal domain [20, 31].

Dorsal injection of hRAIG1 or XRAIG2 mRNA induced a shortened/kinked axis and severe gastrulation defects, and XRAIG2 also prevented elongation of activin-induced animal caps without affecting expression of mesodermal marker genes. These results indicate that RAIG causes perturbation of cell movements, rather than change in cell specification. These phenotypes are highly reminiscent of those caused by perturbation of Wnt/Fz PCP signaling [3, 4, 5]. Indeed XFz7 and XRAIG can activate a very similar set of effectors, such as RhoA, Rac, Cdc42, and JNK (Fig. 4, refs. 2, 7, 8, 28), and to trigger Ca2+ flux. The physical interaction between RAIG and Fz is rather specific, as hRAIG1-hFz5 and XRAIG2-XFz7 associations are readily demonstrated in mammalian cells and Xenopus embryos, whereas neither hRAIG1 nor XRAIG2 exhibits detectable association with Smo, a more distantly related member of the Fz family. The biological significance of Fz-RAIG interaction, however, remains to be elucidated. As XRAIG genes, like XFz7, are expressed in dorsal tissues during gastrulation, and their overexpression phenotypes are similar to those of XFz7 overexpression, we attempted to carry out loss-of-function studies using morpholino antisense oligonucleotides against XRAIG2, XRAIG3, and XRAIG4a and XRAIG4b. However, injection of morpholino oligos alone or in combination has thus far failed to cause any severe defects in gastrulation or animal cap elongation (data not shown). We note, however, that it remains possible that our depletion of four XRAIG proteins, which are likely to have redundant functions, was incomplete, thus precluding us from a clear ‘loss-of-function’ phenotype.

Supplementary Material

Acknowledgments

This work was in part supported by NIH grants to X.H. We thank Dr. Makoto Asashima (University of Tokyo) for Xenopus c-Jun in pCS2+ vector.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

1. Cadigan KM, Nusse R. Wnt signaling: a common theme in animal development. Genes Dev. 1997;11:3286–3305. [PubMed]
2. Veeman MT, Axelrod JD, Moon RT. A second canon. Functions and mechanisms of beta-catenin-independent Wnt signaling. Dev Cell. 2003;5:367–377. [PubMed]
3. Tada M, Smith JC. Xwnt11 is a target of Xenopus Brachyury: regulation of gastrulation movements via Dishevelled, but not through the canonical Wnt pathway. Development. 2000;127:2227–2238. [PubMed]
4. Djiane A, Riou J, Umbhauer M, Boucaut J, Shi D. Role of frizzled 7 in the regulation of convergent extension movements during gastrulation in Xenopus laevis. Development. 2000;127:3091–3100. [PubMed]
5. Medina A, Reintsch W, Steinbeisser H. Xenopus frizzled 7 can act in canonical and non-canonical Wnt signaling pathways: implications on early patterning and morphogenesis. Mech Dev. 2000;92:227–237. [PubMed]
6. Adler PN. Planar signaling and morphogenesis in Drosophila. Dev Cell. 2002;2:525–535. [PubMed]
7. Habas R, Kato Y, He X. Wnt/Frizzled activation of Rho regulates vertebrate gastrulation and requires a novel Formin homology protein Daam1. Cell. 2001;107:843–854. [PubMed]
8. Penzo-Mendez A, Umbhauer M, Djiane A, Boucaut JC, Riou JF. Activation of Gβγ signaling downstream of Wnt-11/Xfz7 regulates Cdc42 activity during Xenopus gastrulation. Dev Biol. 2003;257:302–314. [PubMed]
9. Hall A. Rho GTPases and the actin cytoskeleton. Science. 1998;279:509–514. [PubMed]
10. Kaibuchi K, Kuroda S, Amano M. Regulation of the cytoskeleton and cell adhesion by the Rho family GTPases in mammalian cells. Annu Rev Biochem. 1999;68:459–486. [PubMed]
11. Medina A, Swain RK, Kuerner KM, Steinbeisser H. Xenopus paraxial protocadherin has signaling functions and is involved in tissue separation. EMBO J. 2004;23:3249–3258. [PMC free article] [PubMed]
12. Unterseher F, Hefele JA, Giehl K, De Robertis EM, Wedlich D, Schambony A. Paraxial protocadherin coordinates cell polarity during convergent extension via Rho A and JNK. EMBO J. 2004;23:3259–3269. [PMC free article] [PubMed]
13. Sasai N, Nakazawa Y, Haraguchi T, Sasai Y. The neurotrophin-receptor-related protein NRH1 is essential for convergent extension movements. Nat Cell Biol. 2004;6:741–748. [PubMed]
14. Slusarski DC, Yang-Snyder J, Busa WB, Moon RT. Modulation of embryonic intracellular Ca2+ signaling by Wnt-5A. Dev Biol. 1997;182:114–120. [PubMed]
15. Slusarski DC, Corces VG, Moon RT. Interaction of Wnt and a Frizzled homologue triggers G-protein-linked phosphatidylinositol signaling. Nature. 1997;390:410–413. [PubMed]
16. Simpson IA, Yver DR, Hissin PJ, Wardzala LJ, Karnieli E, Salans LB, Cushman SW. Insulin-stimulated translocation of glucose transporters in the isolated rat adipose cells: characterization of subcellular fractions. Biochim Biophys Acta. 1983;763:393–407. [PubMed]
17. Kato Y, Shi Y, He X. Neuralization of the Xenopus embryo by inhibition of p300/CREB-binding protein function. J Neurosci. 1999;19:9364–9373. [PubMed]
18. Sokol SY. Analysis of Dishevelled signalling pathways during Xenopus development. Curr Biol. 1996;6:1456–1467. [PubMed]
19. Harland RM. In situ hybridization: an improved whole-mount method for Xenopus embryos. Methods Cell Biol. 1991;36:685–695. [PubMed]
20. Cheng Y, Lotan R. Molecular cloning and characterization of a novel retinoic acid-inducible gene that encodes a putative G protein-coupled receptor. J Biol Chem. 1998;273:35008–35015. [PubMed]
21. Robbins MJ, Michalovich D, Hill J, Calver AR, Medhurst AD, Gloger I, Sims M, Middlemiss DN, Pangalos MN. Molecular cloning and characterization of two novel retinoic acid-inducible orphan G-protein-coupled receptors (GPRC5B and GPRC5C) Genomics. 2000;67:8–18. [PubMed]
22. Brauner-Osborne H, Krogsgaard-Larsen P. Sequence and expression pattern of a novel human orphan G-protein-coupled receptor, GPRC5B, a family C receptor with a short amino-terminal domain. Genomics. 2000;65:121–128. [PubMed]
23. Brauner-Osborne H, Jensen AA, Sheppard PO, Brodin B, Krogsgaard-Larsen P, O’Hara P. Cloning and characterization of a human orphan family C G-protein coupled receptor GPRC5D. Biochim Biophys Acta. 2001;1518:237–248. [PubMed]
24. van den Heuvel M, Ingham PW. Smoothened encodes a receptor-like serpentine protein required for hedgehog signaling. Nature. 1996;382:547–551. [PubMed]
25. Winklbauer R, Medina A, Swain RK, Steinbeisser H. Frizzled-7 signalling controls tissue separation during Xenopus gastrulation. Nature. 2001;413:856–860. [PubMed]
26. He X, Saint-Jeannet JP, Wang Y, Nathans J, Dawid I, Varmus H. A member of the Frizzled protein family mediating axis induction by Wnt-5A. Science. 1997;275:1652–1654. [PubMed]
27. Yamanaka H, Moriguchi T, Masuyama N, Kusakabe M, Hanafusa H, Takada R, Takada S, Nishida E. JNK functions in the non-canonical Wnt pathway to regulate convergent extension movements in vertebrates. EMBO Rep. 2002;3:69–75. [PMC free article] [PubMed]
28. Kinoshita N, Iioka H, Miyakoshi A, Ueno N. PKCδ is essential for Dishevelled function in a noncanonical Wnt pathway that regulates Xenopus convergent extension movements. Genes Dev. 2003;17:1663–1676. [PMC free article] [PubMed]
29. Habas R, Dawid IB, He X. Coactivation of Rac and Rho by Wnt/Frizzled signaling is required for vertebrate gastrulation. Genes Dev. 2003;17(2003):295–309. [PMC free article] [PubMed]
30. Torres MA, Yang-Snyder JA, Purcell SM, DeMarais AA, McGrew LL, Moon RT. Activities of the Wnt-1 class of secreted signaling factors are antagonized by the Wnt-5A class and by a dominant negative cadherin in early Xenopus development. J Cell Biol. 1996;133:1123–1137. [PMC free article] [PubMed]
31. Ji TH, Grossmann M, Ji I. G-protein-coupled receptors. I. Diversity of receptor-ligand interactions. J Biol Chem. 1998;273:17299–17302. [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...