• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of jbcAbout JBCASBMBSubmissionsSubscriptionsContactJBCThis Article
J Biol Chem. Mar 19, 2010; 285(12): 8985–8994.
Published online Jan 25, 2010. doi:  10.1074/jbc.M109.078725
PMCID: PMC2838320

Outer Membrane Protein I of Pseudomonas aeruginosa Is a Target of Cationic Antimicrobial Peptide/Protein*

Abstract

Cationic antimicrobial peptides/proteins (AMPs) are important components of the host innate defense mechanisms against invading microorganisms. Here we demonstrate that OprI (outer membrane protein I) of Pseudomonas aeruginosa is responsible for its susceptibility to human ribonuclease 7 (hRNase 7) and α-helical cationic AMPs, instead of surface lipopolysaccharide, which is the initial binding site of cationic AMPs. The antimicrobial activities of hRNase 7 and α-helical cationic AMPs against P. aeruginosa were inhibited by the addition of exogenous OprI or anti-OprI antibody. On modification and internalization of OprI by hRNase 7 into cytosol, the bacterial membrane became permeable to metabolites. The lipoprotein was predicted to consist of an extended loop at the N terminus for hRNase 7/lipopolysaccharide binding, a trimeric α-helix, and a lysine residue at the C terminus for cell wall anchoring. Our findings highlight a novel mechanism of antimicrobial activity and document a previously unexplored target of α-helical cationic AMPs, which may be used for screening drugs to treat antibiotic-resistant bacterial infection.

Keywords: Antimicrobial Peptides, Protein/Protein-Protein Interactions, Lipopolysaccharide (LPS), Membrane Proteins, Protein Purification, Pseudomonas aeruginosa, SMAP-29, Ribonuclease 7, Target Protein

Introduction

Pseudomonas aeruginosa infection is one of the leading causes of death by Gram-negative septicemia. It colonizes the lower respiratory and gastrointestinal tracts as well as the mucosa and skin of hospitalized patients treated with broad spectrum antibiotics. P. aeruginosa usually develops high intrinsic resistance to many antibiotics, in part because of the inefficient uptake of antibiotics across the outer membrane (1). However, human skin is perpetually exposed to microorganisms but free of infection. In addition to the physical barrier of intact skin, the existence of a chemical barrier consisting of antimicrobial peptides/proteins (AMPs)2 in a wide variety of organisms might contribute to the natural defense of skin against microbial infections (2,4). For example, secretion of defensins, psoriasin (S100A7), and hRNase 7 usually protects human skin against infection by most bacteria (5,8).

As a member of the RNase A superfamily, hRNase 7 is a highly positively charged protein with 128 amino acids (6, 9, 10). It is abundant in healthy epithelial tissues, skin, and the respiratory tract and can be induced by interleukin 1β, interferon γ, and bacterial challenge in epithelial cell culture. It exhibits effective antimicrobial activity against pathogenic microorganisms, including P. aeruginosa and the vancomycin-resistant Enterococcus faecium and is among the most potent and efficacious of human antimicrobial proteins. Four flexible and clustered lysine residues (Lys1, Lys3, Lys111 and Lys112) are crucial for its bactericidal activity (11). In addition to hRNase 7, an α-helical cationic peptide, sheep myeloid antimicrobial peptide 29 (SMAP-29), from sheep leukocytes belonging to the cathelicidin family possesses broad spectrum antimicrobial activity. It can reduce the bacterial concentration in both the bronchoalveolar lavage fluid and the consolidated pulmonary tissues of infected lambs (12). However, the bacterial target(s) of these AMPs and their mechanism(s) of bactericidal action remain unclear.

Although cationic AMPs possess diverse secondary structures, their surfaces are amphipathic and contain both hydrophobic and hydrophilic residues in hydrophobic environments. These AMPs have multiple modes of action that differ from those of conventional antibiotics (2, 8, 13). Until now, most studies have proceeded on the tacit assumption that cationic AMPs act on bacteria through electrostatic interactions and that lipopolysaccharide (LPS) is the initial AMP-binding site in Gram-negative bacteria. However, the specific role of LPS in the bactericidal activity of AMP remains debated. LPS exists ubiquitously in the outer membrane of most Gram-negative bacteria; however, its presence is not consistently associated with susceptibility to AMPs (14, 15). Thus, one cannot rule out that cationic AMPs work through a cell surface receptor. In this report, we identify a polymeric lipoprotein, OprI, from the outer membrane of P. aeruginosa that is responsible for the bacterial susceptibility to α-helical cationic AMPs (16).

EXPERIMENTAL PROCEDURES

Materials

The LPSs of P. aeruginosa and Escherichia coli and polymyxin B were obtained from Sigma-Aldrich; SYTOX® Green was from Molecular Probes (Carlsbad, CA); 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) and 3,3-dithiobissul fosuccinimidyl-propionate (DTSSP) were from Pierce; SMAP-29 (RGLRRLGRKIAHGVKKYGPTVLRIIRIAG-NH2), LL-37, CAP18, protegrin-1 (RGGRLCYCRRRFCVCVGR-NH2), and indolicidin (ILPWKWWPWWPWRR-NH2) were from Kelowna International Scientific Inc. (Taipei, Taiwan); SuperoseTM12 and CNBr-activated Sepharose 4B were from GE Healthcare (Waukesha, WI); nickel-nitrilotriacetic acid-agarose gel was from Qiagen; protease Factor Xa was from Novagen (Madison, WI); and Spurr's and HM-20 resins were from Electron Microscopy Sciences (Hatfield, PA).

Assays of Antimicrobial Activity and Permeability

The bacteria E. coli K-12 (M61655) and P. aeruginosa (Schroeter) Migula (ATCC BAA-47TM) were cultured in Luria-Bertani broth and plated on Luria-Bertani agar. Bacteria (5–10 × 104 cfu) were treated with AMP at 37 °C for 3 h and then plated for the determination of the remaining cfu (17). The fluorescence of SYTOX® Green in AMP-treated bacteria (107 cfu) was measured as described previously (11).

Identification of hRNase 7-binding Proteins

The membrane fraction of P. aeruginosa was isolated as described previously (18). The recombinant hRNase 7 was prepared as described previously (11). hRNase 7 (500 μg) was conjugated to 625 μl of CNBr-activated Sepharose 4B gel according to the manufacturer's manual (GE Healthcare). The bacterial membrane fraction (4 μg) was incubated with 20 μl of hRNase 7-conjugated gel in 10 mm sodium phosphate, pH 7.4. Specific proteins were pulled down by hRNase 7-conjugated gel, verified by competition assay with excess amounts of free hRNase 7, excised from SDS-PAGE gel, and subjected to in-gel trypsin digestion and liquid chromatography-tandem mass spectrometry as described previously (19).

Cloning, Expression, and Purification of OprI

The DNA fragment encoding OprI (A07695) was cloned from the genomic DNA of P. aeruginosa by PCR by the use of two primers (5′-TGCAGCAGCCACTCCAAAGAAACCG-3′ and 5′-CTCGAGTTACTTGCGGCTGGCTTTTTC-3′ with XhoI at the 3′ end) (16). The PCR product was cloned into the pGEM-T vector (Promega, Madison, WI), then further tagged with a DNA fragment (AAGCTTCGCATCATCATCATC ATCATATCGAAGGCCGTTGCAGCAGCCACTCCAAAG) containing HindIII, His6 peptide, and a Factor Xa cleavage site at the 5′ end, and subcloned into the expression vector pET32a (Novagen) at the HindΙΙΙ and XhoΙ sites. OprI was expressed in E. coli BL21(DE3) at 26 °C overnight in the presence of 0.5 mm isopropyl-β-d-thiogalactopyranoside. The recombinant fusion protein was purified by use of an nickel-nitrilotriacetic acid-agarose gel (Qiagen) column and digested by protease Factor Xa (Novagen). The flowthrough of a second nickel-nitrilotriacetic acid column was further purified by fast protein liquid chromatography SuperoseTM 12 column gel filtration chromatography. LPS of recombinant OprI (rOprI), hRNase 7, and buffers were determined and removed by use of a Limulus Amebocyte Lysate QCL-1000® kit and an EndoTrap® Red kit (Cambrex BioSciences Inc., Walkersville, MD).

Cross-linking Assay

Small aliquots of rOprI (2 μg in 20 μl) or bacterial suspensions (5–10 × 106 cfu in 45 μl) were incubated with increasing concentrations of EDC and DTSSP in 10 mm sodium phosphate, pH 5.5 and 7.5, respectively, at 37 °C for 30 min and subjected to SDS-PAGE and silver staining. Then Western blot analysis with anti-OprI antibody was performed.

Morphological Analysis by Transmission Electron Microscopy

P. aeruginosa (107 cfu in 95 μl) was treated with 5 μm hRNase 7 at 37 °C for 0–20 min as indicated. The bacteria were fixed by 2.5% glutaraldehyde and 1% osmium tetroxide in 0.1 m cacodylate buffer, pH 7.4, and embedded in Spurr's resin. Thin sections were double-stained with uranyl acetate and lead citrate, and morphological changes were examined under a Hitachi H-7000 transmission electron microscope. Alternatively, the hRNase 7-treated bacteria were fixed by 4% paraformaldehyde in 0.1 m cacodylate buffer and embedded in HM-20 resin. Thin sections were incubated with rabbit anti-OprI or anti-hRNase 7 antibodies and with 18-nm gold particle-labeled secondary antibodies.

Homology Modeling

A trimeric coiled-coil model of P. aeruginosa OprI was derived by use of a homology modeling routine of Modeler/Insight II (Accelrys Inc., San Diego, CA), with the crystal structure of E. coli Ala-mutated Lpp56 (Protein Data Bank 1JCC) used as a template (20). Because the sequence of OprI is longer than that of Ala-mutated Lpp56, the longer coiled-coil structure of the chicken tropomyosin monomer (Protein Data Bank 1IC2) (21) was superimposed onto the structure of the Ala-mutated Lpp56 to extend the coiled-coil helices for the modeling.

RESULTS

Possible Roles of LPS on the Bactericidal Activity of AMP

Among the AMPs tested, hRNase 7 and CAP-18 had the highest bactericidal activity (0.2 μm for 104-fold reduction in colony formation) against P. aeruginosa. LL-37 (0.3 μm), SMAP-29 (0.8 μm), polymyxin B (1.1 μm), protegrin-1 (1.2 μm), and indolicidin (4.0 μm) were weaker in activity (Fig. 1A). However, the bactericidal activity determined by the inhibition zone on Luria-Bertani agar plates, which contain divalent cations, differed from that by viable cell counting, especially for hRNase 7 and LL-37 (Fig. 1B). With viable cell counting assay, the bactericidal activity of hRNase 7 was almost abolished with 40 μm MgCl2, and that of LL-37 was slightly inhibited with 50~800 μm MgCl2, whereas those of polymyxin B, SMAP-29, and CAP-18 were resistant to MgCl2, even at 2 mm, the physiological concentration (Fig. 1C). Thus, divalent cations, which presumably bridge and stabilize the LPS of Gram-negative bacteria, inhibit the bactericidal activities of only some AMPs (14).

FIGURE 1.
Effect of LPS on the bactericidal activity of AMPs. A, effect of AMPs on viability of P. aeruginosa cells. Bacteria (5–10 × 104 cfu) were treated with AMP at 37 °C for 3 h and then plated for the determination of the remaining ...

To determine whether LPS is the direct target of AMPs in P. aeruginosa, we incubated P. aeruginosa with LPS from two bacteria with differing susceptibility to AMPs. P. aeruginosa was susceptible to both hRNase 7 and SMAP-29, whereas E. coli was susceptible to SMAP-29 but relatively resistant to hRNase 7 (Fig. 1D). Of interest, the bactericidal activity of hRNase 7 was more severely inhibited by exogenous LPS of E. coli than by LPS of P. aeruginosa. However, the bactericidal activity of SMAP-29 was markedly resistant to LPS of both sources (100-fold excess amount) (Fig. 1E). Both hRNase 7 and SMAP-29 bound P. aeruginosa with similar efficiency, but the hRNase 7 was markedly released from P. aeruginosa on treatment with MgCl2 or LPS from E. coli and P. aeruginosa (Fig. 1F, top panel). In contrast, most of SMAP-29 was still bound to bacteria upon MgCl2 and LPS treatments (Fig. 1F, bottom panel). The selective inhibition of LPS on bactericidal activities of only some AMPs suggests that a specific factor other than LPS is responsible for the susceptibility.

Identification and Production of OprI

To investigate possible receptor(s) responsible for the susceptibility of P. aeruginosa to hRNase 7, potential receptor proteins were pulled down from membrane extracts by hRNase 7-conjugated gel (Fig. 2A) and verified by liquid chromatography-tandem mass spectrometry. The proteins obtained included OprI (NP_251543), three 50 S ribosomal proteins (L7/L12, NP_252961; L18, NP_252937), and one 30 S ribosomal protein (S6, NP_253622). The lipoprotein OprI contains 64-amino acid residues and fatty acids (predominantly hexadecanoic acid) (18). We suspected that surface protein OprI is the direct target of hRNase 7; we cloned oprI (16) from genomic DNA of P. aeruginosa and expressed it in E. coli BL21(DE3) as a thioredoxin-fused protein. After cleavage with protease Factor Xa, the rOprI showed faster mobility than did native OprI (nOprI), which contains the fatty acids at the N terminus. On SDS-PAGE, the purified rOprI was homogenous (Fig. 2B) having 6948 Daltons as revealed by Micromass ESI Q-TOF mass spectrometry.

FIGURE 2.
Identification and production of OprI. A, identification of hRNase 7-binding proteins. The membrane extracts of P. aeruginosa (2 μg) were incubated with 10 μl of hRNase 7 gel in the presence of increasing amounts of free hRNase 7 and subjected ...

Polymeric Structure of rOprI

rOprI exists in two polymeric forms, ~150 and ~40 kDa, respectively, as seen on fast protein liquid chromatography Superose 12 column gel filtration chromatography (Fig. 3, A–C). However, the nOprI from the membrane fraction existed in a larger complex than did rOprI by showing a smaller elution volume on chromatography (Fig. 3, D–G). rOprI was cross-linked into a dimer, trimer, tetramer, pentamer, and hexamer with the cross-linking agent EDC (Fig. 3, H–I); nOprI from the membrane fraction was also cross-linked into polymers, except hexamer (Fig. 3J). Of note, the protein migrating more slowly than the putative dimer nOprI, which decreased in level with increasing EDC, is likely to be a post-translationally modified form of nOprI. In contrast, the one dark band at the top of gel increased with increasing EDC is suggested to be a complex of OprI and its associated components.

FIGURE 3.
Polymeric structure of OprI. Gel filtration chromatographic analyses of rOprI (A), molecular size marker proteins (B), and both (C). Purified rOprI as well as immunoglobulin (150 kDa), ovalbumin (44 kDa), and bovine RNase A (14 kDa), 100 μg each, ...

rOprI was predicted to contain a very long α-helix by the SOPMA program (a self-optimized prediction method with alignment) (22) and a heptad repeat sequence pattern characteristic of coiled-coils by the COILS program, with the structure of a homologous E. coli Lpp-56 mutant protein used as a template (23, 24). The primary sequence of OprI contains several conserved alanine residues, especially in the hydrophobic a and d positions of the heptad repeat. The putative trimeric structure of OprI can be stabilized through the interhelical interactions of a and d alanines, but the surface is as acidic as that of E. coli Lpp (24).

Role of OprI in the Susceptibility of P. aeruginosa to α-Helical AMPs

To investigate the role of OprI in the susceptibility of P. aeruginosa to AMPs, we determined the bactericidal activities of AMPs in the presence of rOprI and anti-OprI antibody. Both were able to inhibit the activity of hRNase 7, SMAP-29, LL-37, and CAP-18 but not protegrin-1 or polymyxin B (Fig. 4, A and B). The unrelated antibody raised against E. coli methionine aminopeptidase (MAP) was unable to inhibit the activity. The hRNase 7-induced increase in membrane permeability with SYTOX® Green was also repressed by the anti-OprI antibody (Fig. 4C). The viability of P. aeruginosa was reduced 10%~60% with 1.6–40 μg/ml anti-OprI antibody but not anti-MAP antibody (Fig. 4D). Thus, the susceptibility of P. aeruginosa to hRNase 7 and α-helical AMPs but not non-α-helical AMPs is mediated by the essential OprI protein.

FIGURE 4.
Role of OprI in membrane permeability and susceptibility to α-helical AMPs. A, effect of rOprI on the viability of P. aeruginosa cells (1 × 105 cfu) treated with 0.6 μm hRNase 7, 1.2 μm polymyxin B, 5 μm indolicidin, ...

Association of OprI with Surface Components

As shown in Fig. 3 (D–G and J), nOprI may associate with other membrane components to form a large OprI complex; here we further demonstrate that surface OprIs form a large complex in vivo, instead of forming oligomers, upon treatment with EDC or a disulfide bond-containing linker, DTSSP (Fig. 5, A and B). The complex linked by the latter agent was dissociated by 2-mercaptoethanol treatment (Fig. 5B, right lane). The putative complex of nOprI and the surface components was protected against EDC cross-linking by anti-OprI antibody but not an unrelated anti-MAP antibody (Fig. 5C). In contrast, nOprI was not accessible to EDC on treating bacteria with α-helical AMPs such as hRNase 7 (10 μm) and SMAP-29 (40 μm) but not polymyxin B (40 μm) or bovine RNase A (10 μm) (Fig. 5D). It is suggested that nOprI is accessible to both EDC and specific antibody, and its association with surface components is interrupted by hRNase 7 and α-helical AMPs.

FIGURE 5.
Association of OprI with surface components. A and B, analysis of OprI complex after cross-linking. Small aliquots of P. aeruginosa were suspended in 10 mm sodium phosphate, pH 5.5 and 7.5, respectively, with increasing concentrations of EDC (A) or DTSSP ...

Dissociation of OprI-LPS Complex by hRNase 7 in Vitro

To investigate whether LPS is the surface component associated with nOprI, we examined their interaction in vitro. rOprI formed oligomers by themselves but formed a larger complex with LPS, as shown after EDC cross-linking (Fig. 6, top of gel, second through fifth lanes from the left). The association of rOprI with LPS was released by EDTA, which is thought to destabilize LPS, but not by MgCl2 (sixth and seventh lanes from the left). Interestingly, rOprI in the large complex was released into oligomers on treatment with 1.5–6 μm hRNase 7 (first through third lanes from the right). These results further confirm that OprI is associated with LPS in a divalent cation-dependent manner, but the association is disrupted by hRNase 7.

FIGURE 6.
Dissociation of OprI-LPS complex by hRNase 7 in vitro. rOprI (2 μg) incubated with increasing amounts of LPS for 10 min was cross-linked with 125 mm EDC for 30 min at pH5.5 and underwent SDS-PAGE and silver staining (A) and then Western blot analysis ...

Direct Targeting of OprI by hRNase 7

Only hRNase 7, but not other ribonucleases (e.g. bullfrog RC-RNase 6, bovine RNase A), blotted on nitrocellulose membrane was recognized by rOprI (Fig. 7A). rOprI was bound to hRNase 7 in gels, but with less efficiency than that of nOprI, and the binding of both OprIs to hRNase 7 in gels was abolished by anti-OprI antibody (Fig. 7B). hRNase 7 exhibited the most effective bactericidal activity to P. aeruginosa at pH 5.5 (Fig. 7C), because that of human skin in which hRNase 7 is mainly expressed. Although the bacteria exhibited similar binding ability to hRNase 7 between pH 5.5 and 8.5 (Fig. 7D), both nOprI and rOprI exerted the strongest binding to hRNase 7 at pH 5.5 (Fig. 7E, top and bottom panel, respectively). The coincidence of bactericidal activity and OprI binding of hRNase 7 in a pH-dependent manner supports that OprI is a direct target of hRNase 7 on the outer membrane. Furthermore, the hRNase 7 was able to bind nOprI, which exists in a large complex, and process it into oligomers with a smaller molecular size similar to that of rOprI determined by gel filtration chromatography at pH 5.5 (Fig. 7F) and SDS-PAGE/Western blotting (Fig. 7G). These results suggest that the recognition and modification of OprI by hRNase 7 are critical for its susceptibility.

FIGURE 7.
Actions of hRNase 7 on OprI. A, recognition of rOprI by ribonucleases. Increasing amounts of rOprI (0.005, 0.05, and 0.5 μg), hRNase 7, bullfrog RC-RNase 6, and bovine RNase A (0.025, 0.25, and 2.5 μg) were blotted on nitrocellulose membrane, ...

Entry of OprI and hRNase 7 Is Accompanied by Morphological Changes

To investigate the increase of membrane permeability and cytotoxic events in hRNase 7-treated bacteria, the morphology of P. aeruginosa was examined on transmission electron microscopy. The cellular components were extruded from the outer membrane of P. aeruginosa 5 min after hRNase 7 treatment, and the remaining cytoplasmic components were condensed into a heavily stained body, leaving behind a large vacuolar space 10 min after hRNase 7 treatment (Fig. 8A, inset). The detached nOprI (Fig. 8B) and internalized hRNase 7 (Fig. 8C) were evenly distributed in the electron-dense area of cytosol but not in the vacuolar space examined. Later on, most of the nOprI and hRNase 7, along with condensed components, were exported across the membrane, whereas some nOprI and hRNase 7 remained in the inner surface of the cytoplasmic membrane. However, only trace amounts of nOprI were detected in the membrane of untreated bacteria by use of the same fixation method and agents as that used for hRNase 7-treated bacteria, probably because the backbone of nOprI is embedded in the rigid outer membrane, and its exterior portion is masked by surface components such as LPS.

FIGURE 8.
Localization of OprI and hRNase 7 in hRNase 7-treated P. aeruginosa. A, morphological changes of P. aeruginosa after hRNase 7 treatment. P. aeruginosa was treated with hRNase 7 at 37 °C for 5 and 10 min and examined on transmission electron microscopy. ...

DISCUSSION

Most studies conclude that cationic AMPs act on Gram-negative bacteria through surface LPS. In this report, we demonstrated that LPS is involved only in the bactericidal activities of some AMPs and identified a hRNase 7-binding protein, OprI, from the outer membrane of P. aeruginosa that is responsible for the bacterial susceptibility to cationic AMPs. The OprI is one of the major outer membrane lipoproteins of P. aeruginosa (25, 26). It exists in two major forms: a bound form linked to a peptidoglycan of the cell wall and a free form without anchoring, but both contain hexadecanoic acid (18). The lipoprotein Lpp of E. coli, an ortholog of OprI, also exists in two forms (27). The bound form covalently links to the cell wall by the ϵ-amino group of the C-terminal lysine residue, and the free form (the remaining two thirds) has a free C-terminal lysine residue. Both forms anchor to the membrane through a glycerylcysteine, to which amide- and ester-linked palmitic acids are covalently bound (28). The structure of an Lpp mutant, Lpp-56, has been determined to be a trimeric α-helix with a diameter of ~21 Å and a length of ~83 Å on x-ray crystallography (24). The abundant Lpp (7.2 × 105 molecules/cell) is also thought to act as a barrier against the penetration of substances such as antibiotics and macromolecules (29). E. coli mutants lacking the lipoprotein spontaneously form large blebs on their surface, leak periplasmic enzymes into the medium, and have difficulty forming septa during cell division (30). On the basis of the similarities of amino acid sequence and biochemical properties between OprI and Lpp, OprI is predicted to contain an N-terminal flexible coil (1CSSHSKETE9) and a backbone (Ala10–Lys60,76 Å long). The N-terminal flexible coil may be EDC-accessible and responsible for the recognition of AMP and LPS and becomes inaccessible to EDC on treatment with hRNase 7, probably through internalization (Fig. 5). In contrast, the backbone embeds in the outer membrane by the formation of polymeric α-helices similar to that of E. coli Lpp, although hydrophobic residues reside in the interior of helices as that of Lpp (24). Elimination of N-terminal fatty acids from nOprI make it detached from membrane and render the membrane permeable. Further studies are required to determine whether fatty acids of OprI are eliminated directly by hRNase 7 or OprI-associated enzymes. Internalized OprI with an anionic surface could be directed to cationic cellular components, and cationic hRNase 7 is suspected to aggregate anionic nucleic acids. Eventually, all of the condensed components, including internalized hRNase 7 and OprI, are exported across the permeabilized membrane before cell death. The proposed model for these cytotoxic events exerted by hRNase 7 is shown in Fig. 9.

FIGURE 9.
Proposed action mechanism of hRNase 7 on P. aeruginosa. The polymeric α-helical OprIs embed in the outer membrane, which contains fatty acids at the N terminus for membrane integration, an EDC-accessible loop for AMP/LPS recognition, and a C-terminal ...

OprI plays a critical role only in the susceptibility of P. aeruginosa to hRNase 7 and cationic α-helical AMPs, such as SMAP-29, LL-37, and CAP18 (31,33), but not to other AMPs with different secondary structure, such as polymyxin B (14, 34), indolicidin (35), protegrin-1 (36), homo-polylysine (Mr = 4,000–15,000), homo-polyarginine (Mr = 5,000–15,000), and protamine (Mr = 4,236). Among these amphipathic AMPs, SMAP-29 contains an N-terminal flexible domain (1RGLRRLG7) and a C-terminal hydrophobic segment (residues 20–28) beyond the central α-helix (residues 8–17). Structurally, SMAP-29 resembles the N-terminal portion of hRNase 7, which contains a flexible and basic region (1KPKGM6) and an α-helix (residues 7–14) (11). Therefore, a cationic AMP possessing an N-terminal flexible region followed by a rigid α-helix may exert its bactericidal activity in P. aeruginosa through the receptor OprI.

The bactericidal activity of hRNase 7 was almost abolished by treatment with 50% fetal bovine serum or 20–40 μm divalent cations. Thus, hRNase 7 expressed on human skin can kill bacteria residing on the surface of the skin. However, the bactericidal activity of SMAP-29 was not inhibited by 50% fetal bovine serum and divalent cations at concentrations higher than physiological environments (up to 2.5 mm). Therefore, AMPs having properties similar to that of SMAP-29 may be used to combat systemic bacterial infection, and indeed therapeutic efficacy of SMAP-29 against respiratory pathogens has been shown in an ovine model of pulmonary infection (12). Among hundreds of AMPs in nature, a family of OprI homologous proteins in Gram-negative bacteria may be responsible for their susceptibilities; examples are E. coli Lpp and Klebsiella pneumonia Lpp (16). Thus, identification of a specific receptor on the bacterial surface is a prerequisite for the design and screening of antimicrobial agents against bacterial pathogens.

In conclusion, OprI plays a critical role in maintaining the integrity of the outer membrane of microbes and serves as the receptor for cationic α-helical AMPs. This report highlights a novel mechanism of antimicrobial activity and provides a new target for screening drugs (especially oligopeptide drugs) to treat antibiotic-resistant bacteria.

Acknowledgments

We thank Drs. Helene F. Rosenberg and Chen-Pei David Tu for critical reading and suggestions on how to improve the manuscript. We thank the Proteomics Core Facility of the Institutes of Biomedical Sciences and the core Facility of the Institute of Cellular and Organismic Biology (Academia Sinica) for assistance in liquid chromatography-tandem mass spectrometry analysis and immunohistochemistry, respectively.

*This work was supported by National Science Council Grant NSC95-2311-B-001-067-MY3 and funds from the Academia Sinica (Taiwan).

2The abbreviations used are:

AMP
antimicrobial peptide/protein
cfu
colony-forming unit
hRNase 7
human ribonuclease 7
SMAP-29
sheep myeloid antimicrobial peptide 29
EDC
1-ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride)
DTSSP
3,3-dithiobissulfosuccinimidyl-propionate
LPS
lipopolysaccharide
rOprI
recombinant OprI
nOprI
native OprI
MAP
methionine aminopeptidase.

REFERENCES

1. Giamarellou H. (2002) J. Antimicrob. Chemother. 49, 229–233 [PubMed]
2. Zasloff M. (2002) Nature 415, 389–395 [PubMed]
3. Brown K. L., Hancock R. E. (2006) Curr. Opin. Immunol. 18, 24–30 [PubMed]
4. Bowdish D. M., Davidson D. J., Hancock R. E. (2005) Curr. Protein Pept. Sci. 6, 35–51 [PubMed]
5. Gläser R., Harder J., Lange H., Bartels J., Christophers E., Schröder J. M. (2005) Nat. Immunol. 6, 57–64 [PubMed]
6. Harder J., Schroder J. M. (2002) J. Biol. Chem. 277, 46779–46784 [PubMed]
7. Harder J., Bartels J., Christophers E., Schroder J. M. (2001) J. Biol. Chem. 276, 5707–5713 [PubMed]
8. Schröder J. M., Harder J. (2006) Cell Mol. Life Sci. 63, 469–486 [PubMed]
9. Zhang J., Dyer K. D., Rosenberg H. F. (2003) Nucleic Acids Res. 31, 602–607 [PMC free article] [PubMed]
10. Rosenberg H. F. (2008) J. Leukocyte Biol. 83, 1079–1087 [PMC free article] [PubMed]
11. Huang Y. C., Lin Y. M., Chang T. W., Wu S. J., Lee Y. S., Chang M. D., Chen C., Wu S. H., Liao Y. D. (2007) J. Biol. Chem. 282, 4626–4633 [PubMed]
12. Brogden K. A., Kalfa V. C., Ackermann M. R., Palmquist D. E., McCray P. B., Jr., Tack B. F. (2001) Antimicrob. Agents Chemother. 45, 331–334 [PMC free article] [PubMed]
13. Boix E., Nogués M. V. (2007) Mol. Biosyst. 3, 317–335 [PubMed]
14. Peterson A. A., Fesik S. W., McGroarty E. J. (1987) Antimicrob. Agents Chemother. 31, 230–237 [PMC free article] [PubMed]
15. Epand R. M., Vogel H. J. (1999) Biochim. Biophys. Acta 1462, 11–28 [PubMed]
16. Duchêne M., Barron C., Schweizer A., von Specht B. U., Domdey H. (1989) J. Bacteriol. 171, 4130–4137 [PMC free article] [PubMed]
17. Rosenberg H. F., Dyer K. D. (1995) J. Biol. Chem. 270, 30234. [PubMed]
18. Mizuno T., Kageyama M. (1979) J. Biochem. 85, 115–122 [PubMed]
19. Yang C. W., Hung S. I., Juo C. G., Lin Y. P., Fang W. H., Lu I. H., Chen S. T., Chen Y. T. (2007) J. Allergy Clin. Immunol. 120, 870–877 [PubMed]
20. Liu J., Dai J., Lu M. (2003) Biochemistry 42, 5657–5664 [PubMed]
21. Brown J. H., Kim K. H., Jun G., Greenfield N. J., Dominguez R., Volkmann N., Hitchcock-DeGregori S. E., Cohen C. (2001) Proc. Natl. Acad. Sci. U.S.A. 98, 8496–8501 [PMC free article] [PubMed]
22. Geourjon C., Deléage G. (1995) Comput. Appl. Biosci. 11, 681–684 [PubMed]
23. Lupas A., Van Dyke M., Stock J. (1991) Science 252, 1162–1164 [PubMed]
24. Shu W., Liu J., Ji H., Lu M. (2000) J. Mol. Biol. 299, 1101–1112 [PubMed]
25. Mutharia L. M., Nicas T. I., Hancock R. E. (1982) J. Infect. Dis. 146, 770–779 [PubMed]
26. Cote-Sierra J., Jongert E., Bredan A., Gautam D. C., Parkhouse M., Cornelis P., De Baetselier P., Revets H. (1998) Gene 221, 25–34 [PubMed]
27. Inouye M., Shaw J., Shen C. (1972) J. Biol. Chem. 247, 8154–8159 [PubMed]
28. Inoyye S., Takeishi K., Lee N., DeMartini M., Hirashima A., Inouye M. (1976) J. Bacteriol. 127, 555–563 [PMC free article] [PubMed]
29. Inouye M. (1974) Proc. Natl. Acad. Sci. U.S.A. 71, 2396–2400 [PMC free article] [PubMed]
30. Fung J., MacAlister T. J., Rothfield L. I. (1978) J. Bacteriol. 133, 1467–1471 [PMC free article] [PubMed]
31. Travis S. M., Anderson N. N., Forsyth W. R., Espiritu C., Conway B. D., Greenberg E. P., McCray P. B., Jr., Lehrer R. I., Welsh M. J., Tack B. F. (2000) Infect. Immun. 68, 2748–2755 [PMC free article] [PubMed]
32. Tack B. F., Sawai M. V., Kearney W. R., Robertson A. D., Sherman M. A., Wang W., Hong T., Boo L. M., Wu H., Waring A. J., Lehrer R. I. (2002) Eur. J. Biochem. 269, 1181–1189 [PubMed]
33. Zanetti M. (2005) Curr. Issues Mol. Biol. 7, 179–196 [PubMed]
34. Zavascki A. P., Goldani L. Z., Li J., Nation R. L. (2007) J. Antimicrob. Chemother. 60, 1206–1215 [PubMed]
35. Falla T. J., Karunaratne D. N., Hancock R. E. (1996) J. Biol. Chem. 271, 19298–19303 [PubMed]
36. Steinberg D. A., Hurst M. A., Fujii C. A., Kung A. H., Ho J. F., Cheng F. C., Loury D. J., Fiddes J. C. (1997) Antimicrob. Agents Chemother. 41, 1738–1742 [PMC free article] [PubMed]

Articles from The Journal of Biological Chemistry are provided here courtesy of American Society for Biochemistry and Molecular Biology
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...