• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
J Neurosci. Author manuscript; available in PMC Jun 2, 2010.
Published in final edited form as:
PMCID: PMC2836809
NIHMSID: NIHMS175693

Nuclear Factor of Activated T cells isoform c4 (NFATc4/NFAT3) as a mediator of anti-apoptotic transcription in NMDA receptor-stimulated cortical neurons

Abstract

During cortical development, when NR2B subunit is the major component of the NMDA glutamate receptors (NMDAR), moderate NMDAR activity supports neuronal survival at least in part by regulating gene transcription. We report that in cultured cortical neurons from newborn rats, the NMDAR activated the calcium-responsive transcription regulator Nuclear Factor of Activated T cells (NFAT). Moreover, in developing rat cortex, the NFAT isoforms c3 and c4 (NFATc3 and c4) were expressed at relatively higher levels at postnatal day 7 (P7) than P21 overlapping with the period of NMDAR-dependent survival. In cultured cortical neurons, NFATc3 and c4 were regulated at least in part by the NR2B NMDAR. Conversely, knockdown of NFATc4 but not NFATc3 induced cortical neuron apoptosis. Likewise, NFATc4 inhibition prevented anti-apoptotic neuroprotection in response to exogenous NMDA. Expression of the Brain-Derived Neurotrophic Factor (BDNF) was reduced by NFATc4 inhibition. NFATc4 regulated transcription by the NMDAR-responsive bdnf promoter IV. In addition, NMDAR blockers including NR2B-selective once reduced BDNF expression in P7 cortex and cultured cortical neurons. Finally, exogenous BDNF rescued from the pro-apoptotic effects of NFATc4 inhibition. These results identify bdnf as one of the target genes for the anti-apoptotic signaling by NMDAR-NFATc4. Thus, the previously unrecognized NMDAR-NFATc4-BDNF pathway contributes to the survival signaling network that supports cortical development.

Keywords: calcium, apoptosis, development, cortex, BDNF, neurotrophins

Introduction

In the developing nervous system, neuronal survival requires extracellular signals (Oppenheim, 1991; Snider, 1994). In the cortex, those include the excitatory neurotransmitter glutamate and the neurotrophin Brain-Derived Neurotrophic Factor (BDNF). The glutamate NMDA receptors (NMDAR) are calcium-permeable ion channels which are critical for glutamate-mediated survival (for review see (Hardingham, 2006; Hetman and Kharebava, 2006)). Thus, NMDAR antagonists induced cortical neuron apoptosis when administered to rodent pups at postnatal day 7 (P7) but not P1 or P21 (Ikonomidou et al., 1999). The NMDAR are formed by two molecules of the constant NR1 subunit and 2 molecules of the variable NR2 subunits (Cull-Candy and Leszkiewicz, 2004). In developing forebrain neurons, NR2B is the predominant NR2 subunit and thus, a major mediator of glutamate-dependent survival of cortical or hippocampal neurons (Cull-Candy and Leszkiewicz, 2004; Habas et al., 2006; Papadia et al., 2008).

Influx of calcium is critical for the neuronal responses to NMDAR stimulation including survival (Nakanishi, 1992). In addition, NMDAR-mediated protection has been proposed to involve transcriptional regulation of gene expression (Marini and Paul, 1992; Gonzalez-Zulueta et al., 2000; Hardingham et al., 2002; Lee et al., 2005; Papadia et al., 2005; Papadia et al., 2008). The identified transcriptional regulatory events that contribute to NMDAR-dependent anti-apoptotic response include CREB/NFκB-mediated upregulation of the neurotrophin BDNF, c/EBP- or AP1-mediated upregulation of anti-oxidant enzymes Sesn2 or Srxn1, and suppression of the pro-oxidant protein Txbp1 by inhibiting Foxo (Lipsky et al., 2001; Hardingham et al., 2002; Papadia et al., 2008). While NR2B has been implicated in regulation of Sesn2, Srxn1 and Txbp1 (Papadia et al., 2008), its contribution to regulation of other NMDAR-dependent survival genes including bdnf has not been yet reported. As BDNF and NR2B provide major survival signals during forebrain development, their mutual regulation offers a possibility for a pro-survival positive feedback loop. Such regulatory interaction is predicted by modeling studies of extracellular signal-dependent survival of developing neurons (Deppmann et al., 2008).

The nuclear factors of activated T-cells (NFATs) represent a family of at least five transcription factors which all but one are regulated by the Ca2+-activated protein phosphatase-2B/calcineurin (PP2B, (Crabtree and Olson, 2002; Hogan et al., 2003)). The PP2B-regulated NFAT isoforms including the neuron-expressed NFATc4/NFAT3 establish partially redundant pathways coupling calcium signaling to the nuclear transcription (Graef et al., 1999; Benedito et al., 2005; Bradley et al., 2005; Seybold et al., 2006; Nguyen et al., 2009). In cultured cortical or hippocampal neurons, NFAT-driven transcription is regulated by the L-type voltage-gated calcium channels, basal NMDAR activity and BDNF (Graef et al., 1999; Groth and Mermelstein, 2003). In cultured rat cerebellar granule neurons (CGNs), NFATc4 has been implicated in anti-apoptotic effects of depolarizing concentrations of KCl (Benedito et al., 2005). However, NFAT role in NMDAR-mediated neuronal responses including survival of developing cortical neurons has not been reported prior to this study. Therefore, we set out to (i) determine the mediators of the NMDAR-stimulated NFAT-driven transcription, (ii) evaluate its role in NMDAR-mediated neuronal survival, (iii) identify which of NMDAR-regulated survival genes are targeted by NFAT.

Materials and Methods

Materials

The following plasmids have been previously described: pON260 (Cherrington and Mocarski, 1989); hemagglutinin (HA) or green fluorescent protein (GFP) -tagged expression vectors for wild type (wt) NFATc4 cloned in pBJ5 or EGFP mammalian expression vectors, respectively (Graef et al., 1999); expression vector for wtNFATc1 cloned in pBJ5 plasmid (Beals et al., 1997); NFAT-luciferase reporter plasmid (Graef et al., 1999); the flag-tagged wt and R474A/N475A/T541G NFATc4 expression plasmids (Yang and Chow, 2003); EF1αLacZ β-galactosidase (β-gal) expression vector and CRE-luciferase reporter plasmid (Impey et al., 1998); rBDNF IV 4.5-CAT containing a fragment of the rat BDNF promoter IV (from −4100 through 285 relative to the transcription start) cloned 5’ to a chloramphenicol acetyltransferase reporter gene in pBLCAT2 (Shieh et al., 1998); dominant-negative p53 expression vector CMV-p53-DD (Shaulian et al., 1992); pSUPER vector (Brummelkamp et al., 2002); pSuper-based small interfering hairpin RNA (shRNA) constructs targeting GFP and MKL1 (Kalita et al., 2006). The 5xSRF-luciferase reporter was purchased from Stratagene. The pcDNA3-based expression vector for green fluorescent protein (GFP)-tagged wild type (wt) NFATc3 was kindly provided by Dr. Yuriy Usachev (University of Iowa). The following antibodies and reagents were obtained from commercial sources: rabbit polyclonal anti-GFP (MBL, Woburn, MA); rabbit polyclonal anti-β-gal (MP Biomedicals, Aurora, OH); the Texas-Red- or HRP-conjugated goat antibodies to rabbit IgG (Calbiochem, San Diego, CA); BDNF (Alomone, Haifa, Israel), tacrolimus (FK506, A.G. Scientific, San Diego, CA); tetrodotoxin (TTX, Ascent Scientific, Princeton, NJ);N-methyl-D-aspartate (NMDA), dizocilpine maleate (MK-801), ifenprodil, Ro-25-6981, DL-amino-5-phosphonovalerate (APV), LY294002, U0126, Hoechst 33258 (Sigma, St.Louis, MO or Calbiochem, San Diego, CA).

Cell Culture and Transfection

Cortical neurons were prepared from newborn Sprague-Dawley rats at postnatal day 0 as described (Habas et al., 2006). The same methodology was used to culture mouse cortical neurons isolated from the previously reported NFAT-Luciferase transgenic mice that were bred on the FVBN background (Wilkins et al., 2004). Briefly, culture medium was Basal Medium Eagle (BME) supplemented with 10% heat-inactivated bovine calf serum (Hyclone, Logan, UT), 35 mM glucose, 1 mM L-glutamine, 100 U/mL of penicillin and 0.1 mg/mL streptomycin. Cytosine arabinoside (2.5 µM) was added to cultures on the second day after seeding (day in vitro 2, DIV2) to inhibit the proliferation of non-neuronal cells. Cells were used for experiments on DIV6-7 unless indicated otherwise. Transient transfections were performed on DIV3-4 using the Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA) as described previously (Hetman et al., 2002). Electroporation of freshly dissociated newborn rat cortical neurons was conducted using a rat neuron nucleofection reagent kit (Amaxa, Köln, Germany).

Animal treatment

Sprague Dawley rats were housed with their siblings under a 12 hr light/dark cycle and with ad libitum access to water and food. All animals were treated in accordance with the guidelines of the NIH and the University of Louisville Guidelines for the Care and Use of Laboratory Animals. MK801 and ifenprodil were dissolved in sterile saline and administered as a single s.c. injection at P7. To collect the tissues for RNA extraction, rats were euthanized with CO2.

Cultured neuron treatments

LY294002, MK-801, ifenprodil, Ro-25-6981, FK506, and U0126 were dissolved in dimethyl sulfoxide (DMSO). Bicuculine/4-AP, APV, NMDA and TTX were dissolved in culture media and saline, respectively. BDNF was diluted in PBS containing 0.1% bovine serum albumin. BDNF or NMDA were added 30 min before LY294002. NMDAR blockers or FK506 or U0126 or TTX were added 30 min prior to NMDAR or synaptic activity stimulations. Drug treatments were performed in regular culture media containing 10% BCS. The final concentration of DMSO in the medium was 0.2–0.4%.

Design and cloning of shRNA and reporter plasmids

To generate NFATc4 shRNA constructs, we selected two sequences corresponding to nucleotides 564–582 (shNFATc4-N) and 2306–2324 (shNFATc4-C) of rat NFATc4 which both were previously validated as suitable siRNA targets (Benedito et al., 2005). Comparison of mouse, rat and human mRNA sequences demonstrated that the NFATc4-N target sequence was completely conserved between these species while the NFATc4-C target sequence was unique for rodents. Oligonucleotides were designed (shNFATc4-N, gatccccgggacggctctcctagagattttcaagagaaatc-tctaggagagccgtccctttttggaaa; NFATc4-C gatccccggcggaggaagcgcagtccttcaagagaggactgcg-cttcctccgcctttttggaaa) together with their complementary counterparts followed by annealing and subcloning into pSUPER vector digested with BglII and HindIII (Oligoengine). Also, the NFATc3 shRNAs (shNFATc3) constructs were prepared in similar way after selecting the target regions using the shRNA design freeware (http://sonnhammer.cgb.ki.SE/). The shNFATc3-1 targets nucleotide sequence 113–131 of rat NFATc3: AGATGATTGTGCATCCATT which is rodent/human-conserved; shNFATc3-2 targets nucleotide sequence 1243–1261 of rat NFATc3: CATCTTCATTACCTCCATT which is rodent specific. The shNFATc3 consisted of an equimolar mix of shNFATc3-1 and shNFATc3-2. The hBDNF IV-LUC plasmid was constructed by placing a fragment of the human BDNF promoter IV 5’ from a luciferase reporter gene in pGL4.15 vector (Promega, Madison, WI). The fragment included position −205 through 337 relative to the major transcription start site (Pruunsild et al., 2007). Site directed mutagenesis was used to introduce base substitutions in the composite NFAT/MEF2 consensus site at positions 140-1 5 6 ; wild type: 5’ATTTCCACTATCAAATA3’, mutant: 5’ATTggCACgcTCAAATA3’; base substitutions in the NFAT/MEF2 binding element are in lower case.

Reporter gene assays

Luciferase, and β-gal activities were assayed using commercial assay kits (Promega, Madison, WI); CAT protein levels were determined using ELISA (Roche Diagnostics, Indianapolis, IN). For experiments with transiently transfected reporter plasmids, neurons were cultured on 24-well plates (5×105/well) and transfected with Lipofectamine 2000; transcriptional activity was determined as a luciferase activity or CAT expression normalized to β-gal activity and compared to unstimulated controls. In experiments with neurons from the NFAT-Luciferase reporter mouse line, luciferase activity was normalized against the total protein concentration.

RNA analysis

RNA was isolated from 2–5×106 cells or from newborn rat tissues using TRI Reagent (Sigma). The remaining DNA was removed by digestion with DNase I (Promega) and RNA was reverse transcribed with AMV First-Strand cDNA Synthesis Kit (Invitrogen) in the presence of random hexamers. For quantitative Real Time- PCR (qRT-PCR), RT2 Real-Time™ SYBR Green mix (SuperArray Bioscience Corporation, Frederick, MD) and the ΔΔct method of quantification were applied. The reference RNA was 18S rRNA. The qRT-PCR primers were as follows: 18S (sense-gttggttttcggaactgaggc; antisense-gtcggcatcgtttatggtcg), NFATc1 (sense-agatggtgctgtctggccataact; antisense-tgcggaaaggtggtatctcaacca), NFATc2 (sense-tcacagctgagtccaaggttgtgt; antisense-agcatgttaggctggctcttgtct), NFATc3 (sense-tggcatcaacagtatggacctgga; antisense-tttaccacaaggagaagtgggcct), NFATc4 (sense-atcactggcaagatggtggctaca; antisense-agcttcaggattccagcacagtca), BDNF (sense-gagaaagtcccggtatcaaa; antisense-ccagccaattctcttttt), alivin (sense-aaacctgtctaaggtgcctgggaa; antisense-gttgttgtggcgaacaatcagggt), L1 (sense-tctgcttcatcaaacgcagcaagg; antisense-attgtcactgtactcgccgaaggt). For Reverse-Transcriptase-PCR (RT-PCR) the qRT-PCR primers for NFATc1-4 were applied together with GAPDH primers (sense-catcaccatcttccaggagc; antisense-ctaagcagttggtggtgc).

Immunofluorescence and western blot analysis

Transfected cells were detected by immunostaining with the rabbit antibody against β-gal using standard immunofluorescence methodology. For western analysis, cortical neurons were washed twice with PBS and lysed in SDS-PAGE sample buffer. SDS-PAGE electrophoresis and blotting with the anti-GFP antibody were performed according to standard procedures.

Quantification of apoptosis

Cell nuclei were visualized with Hoechst 33258. The transfected, β-gal-positive cells with uniformly stained nuclei were scored as viable. The transfected cells displaying condensed or fragmented nuclei were scored as apoptotic. At least 200 cells were evaluated for each condition in each independent experiment.

Statistical Analysis

Statistical analysis of the data was performed using one-way analysis of variance (ANOVA) followed by post-hoc comparisons.

Results

To determine whether the NMDAR regulate NFAT-driven transcription, we evaluated effects of NR2B-selective or non-selective NMDAR antagonists on the transiently transfected luciferase reporter gene whose promoter contained 5 repeats of the consensus NFAT binding sites from the 5’ regulatory region of the human Il-2 gene. At DIV7, a 6 hr treatment with either NR2B-selective ifenprodil or the non-selective dizocilpine (MK801) reduced NFAT activity by 35 or 45% respectively (vehicle controls vs. ifenprodil or MK801, p<0.01 or <0.001, respectively; Fig. 1A). The effects of dizocilpine were similar to those of ifenprodil (ifenprodil vs. MK801, p>0.05; Fig. 1A). In contrast, neither ifenprodil nor dizocilpine affected CRE- or SRF-mediated transcription (Fig. 1A). In cortical neurons which were isolated from newborn NFAT-luciferase transgenic mice ifenprodil or dizocilpine also lowered NFAT-mediated transcription (vehicle controls vs. ifenprodil or MK801, p<0.001, respectively; Fig. 1A). Either drug induced similar decrease of NFAT activity (ifenprodil vs. MK801, p>0.05; Fig. 1A). Thus, NR2B-mediated regulation of NFAT-driven transcription occurred at the levels of episomal plasmid- or chromatin-integrated NFAT reporter genes.

Figure 1
Regulation of NFAT-driven transcription by NMDAR

While in some experiments, low pro-survival concentrations (1–15 µM) of NMDA moderately increased endogenous NFAT activity, increasing synaptic activity with the 16 hr bicuculine+4AP treatment consistently stimulated NFAT-driven transcription (data not shown and Fig. 1B). Moreover, that effect was sensitive to NR2B-selective or non-selective NMDAR blockade (Fig. 1B). Therefore, our results indicate that at least in cultured rat cortical neurons NFAT-driven transcription is regulated by the NR2B NMDAR.

To determine which NFATc isoforms may be regulated by NMDAR and contribute to NMDAR-mediated neuronal survival, we studied their expression in cultured rat cortical neurons and in developing rat cortex. In DIV7 cultures, mRNAs for NFATc1, NFATc2, NFATc3 and NFATc4 were detected (Fig. 2A). However, significant temporal differences were observed in relative abundance of those mRNAs during cortical development in vivo. Expression of NFATc1 mRNA increased 3.5-fold at postnatal day 7 (P7) as compared to P1 (p<0.001; Fig. 2B). It remained elevated at P21 (P21 vs. P1, p<0.05; P21 vs. P7, P>0.05; Fig. 2B). NFATc2 mRNA levels were 6- or 11-fold higher at P7 or P21 than at P1, respectively (P7 or P21 vs. P1, p<0.001; P21 vs. P7, p<0.001; Fig. 2B) NFATc3 mRNA levels were similar at P1 and P7 but declined by half at P21 (P1 vs. P7, p>0.05; P21 vs. P7, p<0.05; Fig. 2C). At P7, cortical NFATc4 mRNA levels were at least two fold higher than at P1 or P21 (p<0.05, Fig. 2C). Thus, the relatively higher expression of NFATc3 and c4 at P7 than P21 overlaps with the period of the pre-dominant cortical presence of NR2B NMDAR and the NMDAR-dependent cortical neuron survival (Ikonomidou et al., 1999; Cull-Candy and Leszkiewicz, 2004). Consequently, we focused our further studies on these two members of the NFAT family.

Figure 2
NFAT isoform expression in cultured rat cortical neurons and in developing rat cortex

To determine NFATc3/c4 responsiveness to NMDAR stimulation, DIV4 neurons were co-transfected with an expression plasmid for either NFAT together with the NFAT-Luc reporter plasmid. After 48 hr, cells were stimulated with 10 µM NMDA for 6 hr. The transcriptional activity of the overexpressed NFATs increased in response to NMDA treatment (9.2- or 5.8-fold of unstimulated controls for NFATc3 or NFATc4, respectively, Fig. 3A). In addition, the NMDA-mediated NFATc3/c4 activation was disrupted by the NMDAR antagonists including the NR2B-selective ifenprodil and Ro-25-6981 as well as the non-selective MK801 and APV (Fig. 3A). NMDA stimulation induced nuclear translocation of the EGFP-tagged NFATc3/c4 (Fig. 3B and data not shown). This translocation was abolished by the PP2B inhibitor FK506 but not by the MKK1/2 inhibitor U0126 (Fig. 3B and data not shown). However, either inhibitor reduced the NMDAR-mediated transcriptional activation of the overexpressed NFATc3/c4 (Fig. 3C). Also, NMDA failed to activate the R474A/N475A/T541G mutant form of NFATc4 that is deficient in interactions with the transcription factors AP1 and C/EBP (Yang and Chow, 2003). For instance, in cortical neurons stimulated with 10 µM NMDA for 6 hr, activities of the overexpressed wt- or the RNT mutant NFATc4 were 3.35±0.32- or 1.2±0.11-fold of the unstimulated controls, respectively. Thus, as in the case of other NFATc3/c4-activating stimuli, NMDAR-mediated activation of NFATc3/4 required PP2B-dependent nuclear translocation, ERK1/2 activation and interactions with other partner transcription factor(s) (Crabtree and Olson, 2002; Hogan et al., 2003).

Figure 3
Regulation of NFATc3/c4 by the NR2B NMDAR

To further determine the NFATc3/c4 contributions to NFAT-driven transcription in cortical neurons, we used shRNA plasmids targeting these NFAT isoforms. The shNFATc4-N plasmid targeted a sequence in the 5’ coding region of the NFATc4 mRNA that was used before for a successful knockdown of rat NFATc4 (Benedito et al., 2005). The shNFATc3 consisted of a pool of two shRNAs that were designed to target rat NFATc3. The shNFATc3/c4 disrupted activity of their respective targets in NMDAR-stimulated cortical neurons (Fig. 4A, B). Additional validation experiments using NMDAR-stimulated neurons and evaluating effects of (i) shNFATc3 on activation of the overexpressed NFATc4, (ii) shNFATc4-N on activation of the overexpressed NFATc1, and (iii) shNFATc4-N on activation of the endogenous CRE-driven transcription, demonstrated that neither shRNA reduced NMDAR activity (Supplementary Figure 1). Also, shNFATc4-N reduced levels of the overexpressed NFATc4 (Supplementary Figure 1D). Therefore, these results indicate efficient knockdown of NFATc3 or NFATc4 using shNFATc3 or shNFATc4-N, respectively.

Figure 4
The shRNA-mediated inhibition of NFATc3/c4 reduces activation of NFAT-driven transcription in synaptically-stimulated cortical neurons

To assess contributions by NFATc3/c4 to the NMDAR-mediated increase of NFAT-driven transcription, we selected bicuculine/4AP synaptic stimulation protocol that resulted in NR2B NMDAR-dependent activation of NFAT (Fig. 1B). Cortical neurons that received shNFATc3 or c4 displayed reduced activation of NFAT-driven transcription in response to an 8 hr bicuculine/4AP treatment. In neurons receiving control shRNA (shGFP), there was a 3.5-fold activation of NFAT-driven transcription which declined to 2- or 2.4-fold of unstimulated controls following NFATc3- or NFATc4 knockdown, respectively (shGFP vs. shNFATc3 or shNFATc4, p<0.01 or <0.001, respectively; Fig. 4C). Hence, NMDAR regulates activity of endogenous NFATc3/c4.

As the NR2B NMDAR-regulated NFATc3/4 are expressed in the cortex during the period when NMDAR antagonists induce cortical neuron apoptosis (Fig. 2C, (Ikonomidou et al., 1999)), NFATc3/c4 may promote neuronal survival by suppressing apoptosis. Indeed, in cultured cortical neurons, inhibition of NFATc4 induced apoptosis as indicated by nuclear chromatin condensation (Fig. 5A). Thus, in neurons transfected with a control shRNA that targeted GFP 15, 24, and 30% apoptosis were present at 48, 72 and 96 hr post-transfection, respectively (Fig. 5B). At each of these time points, neurons that were transfected with shNFATc4-N displayed significantly more apoptosis (20, 45 and 52%, respectively, Fig. 5B). To ensure that this pro-apoptotic effect is not caused by off-target effects of the shNFATc4-N, we also tested another shRNA construct that targeted a 3’ coding region of the rodent NFATc4 mRNA (shNFATc4-C). The shNFATc4-C induced cortical neuron apoptosis whose extent and kinetics were similar to those in shNFATc4-N-receiving cells (Fig. 5 B, C). Conversely, knockdown of NFATc3 did not induce neuronal apoptosis (Fig. 5 B, C). Therefore, at least under culture conditions, NFATc4 but not NFATc3 is required for cortical neuron survival.

Figure 5
Cortical neuron apoptosis in response to NFATc4 knock-down

To determine whether NFATc4 contributes to NMDAR-dependent survival, DIV4 cortical neurons were transfected with shNFATc4-N or shGFP. At 48 hr post-transfection, cells were exposed for 24 hr to 30 µM LY294002 that is a drug inhibitor of the phosphatidylinositol-3-kinase (PI3K). We have previously reported that such treatment induces cortical neuron apoptosis that can be suppressed by NR2B stimulation with moderate concentrations of exogenous NMDA (Habas et al., 2006). In concert with our published results, in shGFP- or shNFATc4-transfected neurons, LY294002 increased apoptosis from 21 to 45% or 30 to 65%, respectively (p<0.01, Fig. 6). In shGFP-receiving neurons, co-treatment with LY294002 and 10 µM NMDA reduced apoptosis from 45 to 25% (p<0.05, Fig. 6). In contrast, shNFATc4-N prevented the NMDA neuroprotection against LY294002 (65 or 54% apoptosis with 0 or 10 µM NMDA, respectively, p>0.05, Fig. 6). We also performed similar experiments to evaluate whether shNFATc3 affected NMDAR-dependent neuroprotection of PI3K-inhibited neurons. Unexpectedly, we observed a neuroprotective effect of shNFATc3 (A. Vashishta and M.Hetman, unpublished observation). While analysis of NFATc3 contribution to NMDAR-dependent survival was not possible due to the shNFATc3-mediated rescue of LY294002-treated neurons, the latter activity suggests that at least upon PI3K inhibition, NFATc3 induces rather than prevents apoptosis. While the pro-apoptotic activity of NFATc3 is under current investigation (A.Vashishta and M.Hetman, manuscript in preparation), our results indicate specific requirement of NFATc4 for moderate NMDAR activity to protect against neuronal apoptosis.

Figure 6
Requirement of NFATc4 for the NMDA-induced neuroprotection

Since the major function of NFATs is regulation of gene transcription, it is likely that NFATc4 provides anti-apoptotic neuroprotection by mediating the NMDAR-induced increases in survival gene expression. Thus, we analyzed the 5’ regulatory regions of several previously identified NMDAR-regulated anti-apoptotic survival genes for the presence of the NFAT consensus binding site core 5’WGGAAAW3’ with W being A or T (Hogan et al., 2003). The search included genomic sequences from human, mouse and rat (if available) to verify the evolutionary conservation of the NFAT regulatory elements. Several putative NFAT binding sites were found in the 5’ regulatory regions of alivin, l1, and bdnf genes. Six out of 8 alternative bdnf promoters contain evolutionary conserved NFAT elements. Therefore, alivin, L1 and BDNF may be regulated by the NR2B-responsive NFATc4.

To further evaluate this possibility we determined the effects of NFATc4 knockdown on the basal mRNA levels of alivin, L1 and BDNF. Four days after electroporating shNFATc4-N, mRNA levels of endogenous NFATc4 or BDNF declined to 20% or 60% of those in neurons receiving the control shRNA, respectively (p<0.01, Fig. 7). In contrast, mRNAs of alivin or L1 were unaffected by shNFATc4. Consistently with NFAT contribution to regulation of BDNF expression, a 24 hour treatment with the 0.2 µg/ml PP2B inhibitor FK506 reduced BDNF mRNA levels to 58±2.7% untreated controls (p<0.01). These results indicate that in cultured rat cortical neurons, NFATc4 regulates BDNF mRNA levels.

Figure 7
NFATc4 as a regulator of BDNF expression

At least in rodents, transcriptional regulation of BDNF promoter IV provides a major coupling between BDNF expression and neuronal activity/NMDAR (Hong et al., 2008). Therefore, we tested a possibility that NFATc4 regulates promoter IV. As compared to its wild type counterpart, the mutant promoter IV with disruption of the conserved NFAT/MEF2 composite site at position 140–156 (relative to the major transcription start site of human bdnf exon IV) had greatly reduced basal transcriptional activity and diminished responsiveness to NMDAR stimulation (Fig. 8A). We also evaluated effects of manipulating NFATc4 on the NMDAR-mediated activation of the promoter IV. In neurons that were stimulated with 10 µM NMDA for 20 hr, overexpression of NFATc4 increased promoter IV activation while shNFATc4-N-mediated knockdown of NFATc4 reduced promoter IV activation (Fig. 8B). Analysis of 5 independent experiments revealed that the NMDAR-mediated activation of promoter IV was enhanced by 40±9.5% or reduced by 25±3.65% in NFATc4- or shNFATc4-transfected neurons, respectively (p<0.001). These results indicate that NFATc4 contributes to activation of BDNF promoter IV.

Figure 8
NFATc4 regulation of the NMDA-responsive BDNF promoter IV

The NR2B NMDAR appears as major NMDAR subtype which upon moderate stimulation activates NFATc4 (Fig. 1 and Fig. 3). Therefore, we tested the effects of selective NR2B inhibition on expression of candidate NFATc4-regulated survival genes in cortices of P7 rat pups or in cultured cortical neurons. At P7, single systemic injections of NMDAR antagonists induced apoptotic cell death of cortical neurons indicating their critical dependence on NMDAR activity (Ikonomidou et al., 1999). Three hours after administering the non-selective MK801 (10 mg/kg, s.c.) or the NR2B-selective ifenprodil (20 mg/kg, s.c.) cortical levels of BDNF mRNA reached 22 or 30% of saline-treated controls (p<0.001, Fig. 9A). In contrast, L1- or alivin mRNA levels were significantly reduced in response to MK801 but not ifenprodil (42%, p<0.05 or 34%, p<0.001, respectively; Fig. 9A). Also, in DIV7 cultured cortical neurons, either NR2B-selective or non-selective NMDAR blockade reduced BDNF mRNA levels (Fig. 9B). Although, the non-selective MK801 appeared more effective than the NR2B-selective ifenprodil or Ro-25-6981, these differences were not significant (MK801 vs. ifenprodil or Ro-25-6981, p>0.05). Thus, in P7 cortex or in cultured cortical neurons, moderate activity of NR2B NMDAR contributes to the regulation of BDNF mRNA levels. This is consistent with the role of NR2B in driving NFAT-mediated transcription and the contribution of the latter to BDNF expression.

Figure 9
Role of the NR2B in maintenance of BDNF mRNA expression

If BDNF is among the survival targets of NFATc4 one could expect that its supplementation could protect against apoptotic toxicity of the shNFATc4. Thus, cortical neurons were transfected with shNFATc4-N or shGFP used as a control. Forty eight hours post-transfection cells were treated with 0 or 10 ng/ml BDNF. After next 24 hr, apoptosis analysis revealed 15 or 28% apoptotic neurons that received shGFP or shNFATc4, respectively (p<0.01, Fig. 10A). BDNF lowered apoptosis of shNFATc4-N-transfected neurons from 28 to 12% (p<0.001, Fig. 10A). In contrast, 10 µM NMDA that similarly to BDNF protected against PI3K inhibition (Hetman et al., 2002), failed to suppress shNFATc4-induced apoptosis (data not shown). These results are consistent with the notion that BDNF maps downstream of the NMDAR-regulated anti-apoptotic transcription factor NFATc4 (Fig. 10B).

Figure 10
Rescue of shNFATc4-transfected neurons by exogenous BDNF

Discussion

In this study we demonstrated that in cortical neurons NFATc4 contributes to the NR2B NMDAR-activated anti-apoptotic gene expression program. We also identified BDNF as one of the NFATc4-regulated neuroprotective genes.

NFATc4 was expressed both in cultured rat cortical neurons and in developing rat cortex where its expression overlapped with the period of survival dependence on NMDAR activity. While NFATc1 and NFATc2 were also expressed in developing cortex, only NFATc3 demonstrated an NFATc4-like temporal overlap with NMDAR-dependent cortical neuron survival. Therefore, the NMDAR-NFATc3/c4 signaling may serve development-specific roles including regulation of neuronal survival and/or differentiation.

The NMDAR-mediated regulation of NFATc3/c4 involved calcineurin/PP2B-dependent nuclear translocation, ERK1/2 activity and interactions with a partner transcription factor of yet unknown identity. Requirement of PP2B, and ERK1/2 is consistent with the activation mechanism that regulates all calcium-dependent isoforms of NFAT in various cell types responding to diverse stimuli (Crabtree and Olson, 2002; Hogan et al., 2003). Conversely, cell type determines the nature of the NFAT partner(s) including representatives of such transcription factor families as MEF2, AP1, Foxo or ICER (Crabtree and Olson, 2002; Hogan et al., 2003). While identification of the NFATc3/c4 partner in NR2B-stimulated cortical neurons will be a subject of our future research, it is tempting to speculate that NFATc4 may synergize with the anti-apoptotic MEF2s or be antagonized by the pro-apoptotic ICER or Foxo family members (Brunet et al., 1999; Mao et al., 1999; Gaudilliere et al., 2002; Jaworski et al., 2003).

The shRNA-mediated knockdown of NFATc4 but not NFATc3 induced cortical neuron apoptosis. Also, shNFATc4 antagonized NR2B NMDAR-mediated neuroprotection. Therefore NFATc4 is required for the NR2B-dependent cortical neuron survival. While survival promoting links between glutamate signaling and the NFATc4 have not been demonstrated prior to this study, pro-apoptotic effects of NFATc4 inhibition have been reported in cultured cerebellar granule neurons (CGN) (Benedito et al., 2005). Conversely, overexpression of active NFATc2/NFAT1 protected CGNs against trophic/neuronal activity deprivation (Benedito et al., 2005). Thus, NFATc4 may underlie neuronal activity/neurotransmitter-mediated survival in various neuronal populations throughout the CNS. However, as exemplified by the joint recruitment of NFATc3/c4 during metamphetamine-induced adult neuronal death (Jayanthi et al., 2005), other NFAT isoforms may co-operate with NFATc4 to support survival of developing neurons.

While detailed analysis of forebrain development in NFATc4 knock out mice has not been reported, these animals appeared normal likely due to functional compensation by other NFAT isoforms (Graef et al., 2001). Indeed, only double inactivation of NFATc3 and c4 revealed NFAT requirement for axonal growth (Graef et al., 2003). Unfortunately, these double knock out mice can not be used to study glutamate-dependent survival in developing forebrain as they die in utero before forebrain appears (Graef et al., 2003). In concert with our results indicating that the NFATc4 mediates NMDA-dependent survival but is dispensable for the anti-apoptotic effects of BDNF (A.Habas and M.Hetman, unpublished observations), neurotrophin survival response of cultured sensory neurons was not compromised by triple knockout of NFATc4/c3/c2 (Graef et al., 2003). Therefore, the pro-survival recruitment of NFATc4 may require neuronal activity/neurotransmission, and as such, occur during synaptogenesis but not at the earlier stages of development.

In addition to its role as an anti-apoptotic transducer of physiological survival signals in developing neurons, NFAT-driven transcription may also contribute to injury-induced neuronal death (Jayanthi et al., 2005; Luoma and Zirpel, 2008; Sama et al., 2008). Therefore, NFAT-driven transcription may either support or antagonize neuronal survival. The cell type and/or the character of the NFAT activating stimulus and/or its signaling context likely determine the opposite survival outcomes of NFAT activation. Finally, different NFATc isoforms may engage in contradictory regulations of neuronal survival.

While anti-apoptotic effects of NFATc4 may involve regulation of multiple anti- and pro-apoptotic genes, we have identified bdnf as one of the survival-promoting targets of NFAT. Thus, inhibition of NFATc4 or NR2B NMDAR reduced BDNF expression. Moreover, disruption of the composite NFAT/MEF2 site in the NMDAR-regulated BDNF promoter IV reduced its basal activity as well as responsiveness to NMDA. Conversely, enhancement or reduction of NFATc4 levels increased or decreased NMDA activation of promoter IV, respectively. Finally, exogenous BDNF protected against NFATc4 knockdown (Fig. 10), which by itself did not affect BDNF neuroprotection against severa l pro-apoptotic stimuli (A.Habas and M.Hetman, unpublished observations). These results are in agreement with previous studies that demonstrated requirement of BDNF for neuroprotective effects of the NMDAR (Marini and Paul, 1992; Bhave et al., 1999; Chen et al., 1999). In addition, they add NFATc4 to the list of BDNF transcriptional regulators in NMDAR-stimulated cortical neurons.

Consistent with BDNF importance for brain development and adult brain plasticity, the bdnf gene structure analysis revealed complex regulation of its expression (Aid et al., 2007; Pruunsild et al., 2007). Transcription of rodent BDNF is controlled by at least 8 alternative promoters (Aid et al., 2007). In rodent cerebral cortex or in cultured rat or mouse cortical neurons, BDNF promoter IV (formerly known as promoter III) is the major target for neuronal activity modulation of BDNF transcription (Shieh et al., 1998; Tao et al., 1998; Aid et al., 2007; Hong et al., 2008). Also, its activity increases postnatally overlapping with the period of neuronal survival dependence on NMDAR (Aid et al., 2007). In the BDNF promoter IV region we identified at least one potential NFAT binding site that is conserved between rodents and primates. NFAT may also bind to NFκB sites and one of them has been suggested to activate promoter IV in NMDA-stimulated CGNs (Lipsky et al., 2001; Hogan et al., 2003). Thus NFATc4 effects on BDNF promoter IV activity may be through direct interactions with DNA and the transcription machinery. CREB binding to the promoter IV has been recently shown to underlie the major component of the NMDAR-mediated BDNF up-regulation in cortical neurons (Hong et al., 2008). While these results identified CREB as a necessary component for NMDA-induced BDNF transcription they did not rule out significant contributions by other transcription factors. In fact, it has been shown that CREB may be instrumental for promoter IV recruitment of such calcium-regulated transcriptional regulators as CBP or the NFAT partner MEF2D (Hong et al., 2008). As the consensus NFAT site at the position 140 of promoter IV partially overlaps with a consensus site for a potential NFAT partner, MEF2, it is tempting to speculate that NFATc4 and MEF2D interact to regulate BDNF transcription. The non-CREB regulators of promoter IV may be either co-required for its activation by NMDAR and/or determine the maximum levels of the activation.

Besides NMDAR and neuronal activity, BDNF expression is stimulated by the BDNF itself (Groth and Mermelstein, 2003). As BDNF induction by BDNF was sensitive to PP2B inhibition and as NFATc4 overexpression increased BDNF mRNA levels it has been proposed that NFATc4 regulates BDNF (Groth and Mermelstein, 2003). By using the NFAT-specific loss of function approach, our study adds a piece of critical evidence to support that notion.

Our results indicate that stimulation of BDNF expression plays a role in NR2B NMDAR-mediated cortical neuron survival. Similar observations have been reported for the neuronal activity- and/or NMDAR-dependent survival of cultured rat cortical neurons or CGNs (Marini and Paul, 1992; Ghosh et al., 1994; Bhave et al., 1999; Chen et al., 1999). In addition to promoting survival, BDNF contributes to other key events in the developing nervous system including morphogenesis or induction of apoptosis (Huang and Reichardt, 2001; Miller and Kaplan, 2001). It remains to be tested whether the NMDAR-NFATc4-BDNF pathway plays a role in these processes. While inhibition of NMDAR/BDNF cascade is implicated in the pathogenesis of fetal alcohol syndrome, NFATc4 hypoactivity plays a role in pathogenesis of Down syndrome (Bhave et al., 1999; Ikonomidou et al., 2000; Arron et al., 2006). Thus, disruption of the NMDAR-NFATc4 signaling may contribute to genetically- or environmentally-induced developmental brain disorders that produce mental retardation.

Interestingly, of the 3 NMDAR-regulated survival genes investigated in this study, only BDNF responded to both NR2B-selective NMDAR blockade and NFATc4 knockdown. Conversely, anti-apoptotic cell adhesion molecules alivin and L1 were sensitive to non-selective NMDAR inhibition but not to NR2B NMDAR blocker ifenprodil or shNFATc4. These results suggest specificity of NFATc4 involvement in mediating the effects of NR2B NMDAR stimulation. Likewise, CREB-mediated transcription has been proposed to be preferentially activated by the NR2A receptors (Hardingham et al., 2002). Therefore, NMDAR isoform-specific recruitment of non-overlapping transcription factors may underlie the differences in gene expression programs that were reported after activation of different NMDAR pools. Alternatively, regulation of NFATc4 may engage various subtypes of NMDAR dependent on the period of nervous system development. After the maturation-associated switch of the synaptic NMDAR from NR2B to NR2A (Cull-Candy and Leszkiewicz, 2004), the synaptic activity-regulated NFATc4 may also alter its NMDAR subtype dependence.

In summary, we identified a novel survival signaling pathway that suppresses apoptosis of developing cortical neurons. This pathway consists of the NR2B NMDAR, the transcription factor NFATc4 and the neurotrophin BDNF. Given the broad developmental impact of both NMDAR and BDNF, it is possible that NMDAR-NFATc4-BDNF signaling affects not only neuronal survival but also other key steps of neuronal differentiation including synaptogenesis.

Supplementary Material

Supp1

Acknowledgements

This work was supported by NIH (NS047341-01 and RR015576-06 to MH), The Kentucky Spinal Cord and Head Injury Research Trust (grant 3–5, MH), The Commonwealth of Kentucky Challenge for Excellence (MH), and Norton Healthcare (MH). TT and PP were supported by Estonian Ministry of Education and Research (Grant 0140143), Estonian Enterprise (Grant EU27553) and Estonian Science Foundation (Grant 7257). Drs. Gerald Crabtree, Neil Clipstone, Yuryi Usachev and Chi-Wing Chow provided reagents used in this study.

References

  • Aid T, Kazantseva A, Piirsoo M, Palm K, Timmusk T. Mouse and rat BDNF gene structure and expression revisited. J Neurosci Res. 2007;85:525–535. [PMC free article] [PubMed]
  • Arron JR, Winslow MM, Polleri A, Chang CP, Wu H, Gao X, Neilson JR, Chen L, Heit JJ, Kim SK, Yamasaki N, Miyakawa T, Francke U, Graef IA, Crabtree GR. NFAT dysregulation by increased dosage of DSCR1 and DYRK1A on chromosome 21. Nature. 2006;441:595–600. [PubMed]
  • Beals CR, Sheridan CM, Turck CW, Gardner P, Crabtree GR. Nuclear export of NF-ATc enhanced by glycogen synthase kinase-3. Science. 1997;275:1930–1934. [PubMed]
  • Benedito AB, Lehtinen M, Massol R, Lopes UG, Kirchhausen T, Rao A, Bonni A. The transcription factor NFAT3 mediates neuronal survival. J Biol Chem. 2005;280:2818–2825. [PubMed]
  • Bhave SV, Ghoda L, Hoffman PL. Brain-derived neurotrophic factor mediates the anti-apoptotic effect of NMDA in cerebellar granule neurons: signal transduction cascades and site of ethanol action. J Neurosci. 1999;19:3277–3286. [PubMed]
  • Bradley KC, Groth RD, Mermelstein PG. Immunolocalization of NFATc4 in the adult mouse brain. J Neurosci Res. 2005;82:762–770. [PubMed]
  • Brummelkamp TR, Bernards R, Agami R. A system for stable expression of short interfering RNAs in mammalian cells. Science. 2002;296:550–553. [PubMed]
  • Brunet A, Bonni A, Zigmond MJ, Lin MZ, Juo P, Hu LS, Anderson MJ, Arden KC, Blenis J, Greenberg ME. Akt promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor. Cell. 1999;96:857–868. [PubMed]
  • Chen S, Mantei N, Dong L, Schachner M. Prevention of neuronal cell death by neural adhesion molecules L1 and CHL1. J Neurobiol. 1999;38:428–439. [PubMed]
  • Cherrington JM, Mocarski ES. Human cytomegalovirus iel transactivates the α promoter-enhancer via an 18-base-pair repeat element. J Virol. 1989;63:1435–1440. [PMC free article] [PubMed]
  • Crabtree GR, Olson EN. NFAT signaling: choreographing the social lives of cells. Cell. 2002;109:S67–S79. [PubMed]
  • Cull-Candy SG, Leszkiewicz DN. Role of distinct NMDA receptor subtypes at central synapses. Sci. 2004 STKE 2004:re16. [PubMed]
  • Deppmann CD, Mihalas S, Sharma N, Lonze BE, Niebur E, Ginty DD. A model for neuronal competition during development. Science. 2008;320:369–373. [PMC free article] [PubMed]
  • Gaudilliere B, Shi Y, Bonni A. RNA interference reveals a requirement for myocyte enhancer factor 2A in activity-dependent neuronal survival. J Biol Chem. 2002;277:46442–46446. [PubMed]
  • Ghosh A, Carnahan J, Greenberg ME. Requirement for BDNF in activity-dependent survival of cortical neurons. Science. 1994;263:1618–1623. [PubMed]
  • Gonzalez-Zulueta M, Feldman AB, Klesse LJ, Kalb RG, Dillman JF, Parada LF, Dawson TM, Dawson VL. Requirement for nitric oxide activation of p21(ras)/extracellular regulated kinase in neuronal ischemic preconditioning. Proc Natl Acad Sci U S A. 2000;97:436–441. [PMC free article] [PubMed]
  • Graef IA, Chen F, Chen L, Kuo A, Crabtree GR. Signals transduced by Ca(2+)/calcineurin and NFATc3/c4 pattern the developing vasculature. Cell. 2001;105:863–875. [PubMed]
  • Graef IA, Mermelstein PG, Stankunas K, Neilson JR, Deisseroth K, Tsien RW, Crabtree GR. L-type calcium channels and GSK-3 regulate the activity of NF-ATc4 in hippocampal neurons. Nature. 1999;401:703–708. [PubMed]
  • Graef IA, Wang F, Charron F, Chen L, Neilson J, Tessier-Lavigne M, Crabtree GR. Neurotrophins and netrins require calcineurin/NFAT signaling to stimulate outgrowth of embryonic axons. Cell. 2003;113:657–670. [PubMed]
  • Groth RD, Mermelstein PG. Brain-derived neurotrophic factor activation of NFAT (nuclear factor of activated T-cells)-dependent transcription: a role for the transcription factor NFATc4 in neurotrophin-mediated gene expression. J Neurosci. 2003;23:8125–8134. [PubMed]
  • Habas A, Kharebava G, Szatmari E, Hetman M. NMDA neuroprotection against a phosphatidylinositol-3 kinase inhibitor, LY294002 by NR2B-mediated suppression of glycogen synthase kinase-3beta-induced apoptosis. J Neurochem. 2006;96:335–348. [PubMed]
  • Hardingham GE. Pro-survival signalling from the NMDA receptor. Biochem Soc Trans. 2006;34:936–938. [PMC free article] [PubMed]
  • Hardingham GE, Fukunaga Y, Bading H. Extrasynaptic NMDARs oppose synaptic NMDARs by triggering CREB shut-off and cell death pathways. Nat Neurosci. 2002;5:405–414. [PubMed]
  • Hetman M, Kharebava G. Survival signaling pathways activated by NMDA receptors. Curr Top Med Chem. 2006;6:787–799. [PubMed]
  • Hetman M, Hsuan SL, Habas A, Higgins MJ, Xia Z. ERK1/2 Antagonizes Glycogen Synthase Kinase-3beta -induced Apoptosis in Cortical Neurons. J Biol Chem. 2002;277:49577–49584. [PubMed]
  • Hogan PG, Chen L, Nardone J, Rao A. Transcriptional regulation by calcium, calcineurin, and NFAT. Genes Dev. 2003;17:2205–2232. [PubMed]
  • Hong EJ, McCord AE, Greenberg ME. A biological function for the neuronal activity-dependent component of Bdnf transcription in the development of cortical inhibition. Neuron. 2008;60:610–624. [PMC free article] [PubMed]
  • Huang EJ, Reichardt LF. Neurotrophins: roles in neuronal development and function. Annu Rev Neurosci. 2001;24:677–736. [PMC free article] [PubMed]
  • Ikonomidou C, Bosch F, Miksa M, Bittigau P, Vockler J, Dikranian K, Tenkova TI, Stefovska V, Turski L, Olney JW. Blockade of NMDA receptors and apoptotic neurodegeneration in the developing brain. Science. 1999;283:70–74. [PubMed]
  • Ikonomidou C, Bittigau P, Ishimaru M, Wozniak D, Koch C, Genz K, Price M, Stefovska V, Horster F, Tenkova T, Dikranian K, Olney J. Ethanol-induced apoptotic neurodegeneration and fetal alcohol syndrome. Science. 2000;287:1056–1060. [PubMed]
  • Impey S, Smith DM, Obrietan K, Donahue R, Wade C, Storm DR. Stimulation of cAMP response element (CRE)-mediated transcription during contextual learning. Nat Neurosci. 1998;1:595–601. [PubMed]
  • Jaworski J, Mioduszewska B, Sanchez-Capelo A, Figiel I, Habas A, Gozdz A, Proszynski T, Hetman M, Mallet J, Kaczmarek L. Inducible cAMP early repressor, an endogenous antagonist of cAMP responsive element-binding protein, evokes neuronal apoptosis in vitro. J Neurosci. 2003;23:4519–4526. [PubMed]
  • Jayanthi S, Deng X, Ladenheim B, McCoy MT, Cluster A, Cai NS, Cadet JL. Calcineurin/NFAT-induced up-regulation of the Fas ligand/Fas death pathway is involved in methamphetamine-induced neuronal apoptosis. Proc Natl Acad Sci U S A. 2005;102:868–873. [PMC free article] [PubMed]
  • Kalita K, Kharebava G, Zheng JJ, Hetman M. Role of megakaryoblastic acute leukemia-1 in ERK1/2-dependent stimulation of serum response factor-driven transcription by BDNF or increased synaptic activity. J Neurosci. 2006;26:10020–10032. [PubMed]
  • Lee B, Butcher GQ, Hoyt KR, Impey S, Obrietan K. Activity-dependent neuroprotection and cAMP response element-binding protein (CREB): kinase coupling, stimulus intensity, and temporal regulation of CREB phosphorylation at serine 133. J Neurosci. 2005;25:1137–1148. [PubMed]
  • Lipsky RH, Xu K, Zhu D, Kelly C, Terhakopian A, Novelli A, Marini AM. Nuclear factor kappaB is a critical determinant in N-methyl-D-aspartate receptor-mediated neuroprotection. J Neurochem. 2001;78:254–264. [PubMed]
  • Luoma JI, Zirpel L. Deafferentation-induced activation of NFAT (nuclear factor of activated T-cells) in cochlear nucleus neurons during a developmental critical period: a role for NFATc4-dependent apoptosis in the CNS. J Neurosci. 2008;28:3159–3169. [PubMed]
  • Mao Z, Bonni A, Xia F, Nadal-Vicens M, Greenberg ME. Neuronal activity-dependent cell survival mediated by transcription factor MEF2. Science. 1999;286:785–790. [PubMed]
  • Marini AM, Paul SM. N-methyl-D-aspartate receptor-mediated neuroprotection in cerebellar granule cells requires new RNA and protein synthesis. Proc Natl Acad Sci USA. 1992;89:6555–6559. [PMC free article] [PubMed]
  • Miller FD, Kaplan DR. Neurotrophin signalling pathways regulating neuronal apoptosis. Cell Mol Life Sci. 2001;58:1045–1053. [PubMed]
  • Nakanishi S. Molecular diversity of glutamate receptors and implications for brain function. Science. 1992;258:597–603. [PubMed]
  • Nguyen T, Lindner R, Tedeschi A, Forsberg K, Green A, Wuttke A, Gaub P, Di Giovanni S. NFAT-3 is a transcriptional repressor of the growth-associated protein 43 during neuronal maturation. J Biol Chem. 2009;284:18816–18823. [PMC free article] [PubMed]
  • Oppenheim RW. Cell death during development of the nervous system. Annu Rev Neurosci. 1991;14:453–501. [PubMed]
  • Papadia S, Stevenson P, Hardingham NR, Bading H, Hardingham GE. Nuclear Ca2+ and the cAMP response element-binding protein family mediate a late phase of activity-dependent neuroprotection. J Neurosci. 2005;25:4279–4287. [PubMed]
  • Papadia S, Soriano FX, Leveille F, Martel MA, Dakin KA, Hansen HH, Kaindl A, Sifringer M, Fowler J, Stefovska V, McKenzie G, Craigon M, Corriveau R, Ghazal P, Horsburgh K, Yankner BA, Wyllie DJ, Ikonomidou C, Hardingham GE. Synaptic NMDA receptor activity boosts intrinsic antioxidant defenses. Nat Neurosci. 2008;11:476–487. [PMC free article] [PubMed]
  • Pruunsild P, Kazantseva A, Aid T, Palm K, Timmusk T. Dissecting the human BDNF locus: bidirectional transcription, complex splicing, and multiple promoters. Genomics. 2007;90:397–406. [PMC free article] [PubMed]
  • Sama MA, Mathis DM, Furman JL, Abdul HM, Artiushin IA, Kraner SD, Norris CM. Interleukin-1beta-dependent signaling between astrocytes and neurons depends critically on astrocytic calcineurin/NFAT activity. J Biol Chem. 2008;283:21953–21964. [PMC free article] [PubMed]
  • Seybold VS, Coicou LG, Groth RD, Mermelstein PG. Substance P initiates NFAT-dependent gene expression in spinal neurons. J Neurochem. 2006;97:397–407. [PubMed]
  • Shaulian E, Zauberman A, Ginsberg D, Oren M. Identification of a minimal transforming domain of p53: negative dominance through abrogation of sequence-specific DNA binding. Mol Cell Biol. 1992;12:5581–5592. [PMC free article] [PubMed]
  • Sheng M, Cummings J, Roldan LA, Jan YN, Jan LY. Changing subunit composition of heteromeric NMDA receptors during development of rat cortex. Nature. 1994;368:144–147. [PubMed]
  • Shieh PB, Hu SC, Bobb K, Timmusk T, Ghosh A. Identification of a signaling pathway involved in calcium regulation of BDNF expression. Neuron. 1998;20:727–740. [PubMed]
  • Snider WD. Functions of the neurotrophins during nervous system development: what the knockouts are teaching us. Cell. 1994;77:627–638. [PubMed]
  • Tao X, Finkbeiner S, Arnold DB, Shaywitz AJ, Greenberg ME. Ca2+ influx regulates BDNF transcription by a CREB family transcription factor-dependent mechanism. Neuron. 1998;20:709–726. [PubMed]
  • Vihma H, Pruunsild P, Timmusk T. Alternative splicing and expression of human and mouse NFAT genes. Genomics. 2008;92:279–291. [PMC free article] [PubMed]
  • Wilkins BJ, Dai YS, Bueno OF, Parsons SA, Xu J, Plank DM, Jones F, Kimball TR, Molkentin JD. Calcineurin/NFAT coupling participates in pathological, but not physiological, cardiac hypertrophy. Circ Res. 2004;94:110–118. [PubMed]
  • Yang TT, Chow CW. Transcription cooperation by NFAT.C/EBP composite enhancer complex. J Biol Chem. 2003;278:15874–15885. [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...