Logo of pnasPNASInfo for AuthorsSubscriptionsAboutThis Article
Proc Natl Acad Sci U S A. 2010 Jan 12; 107(2): 775–780.
Published online 2009 Dec 22. doi:  10.1073/pnas.0911591107
PMCID: PMC2818943

Long-range gene regulation links genomic type 2 diabetes and obesity risk regions to HHEX, SOX4, and IRX3


Genome-wide association studies identified noncoding SNPs associated with type 2 diabetes and obesity in linkage disequilibrium (LD) blocks encompassing HHEX-IDE and introns of CDKAL1 and FTO [Sladek R, et al. (2007) Nature 445:881–885; Steinthorsdottir V, et al. (2007) Nat. Genet 39:770–775; Frayling TM, et al. (2007) Science 316:889–894]. We show that these LD blocks contain highly conserved noncoding elements and overlap with the genomic regulatory blocks of the transcription factor genes HHEX, SOX4, and IRX3. We report that human highly conserved noncoding elements in LD with the risk SNPs drive expression in endoderm or pancreas in transgenic mice and zebrafish. Both HHEX and SOX4 have recently been implicated in pancreas development and the regulation of insulin secretion, but IRX3 had no prior association with pancreatic function or development. Knockdown of its orthologue in zebrafish, irx3a, increased the number of pancreatic ghrelin-producing epsilon cells and decreased the number of insulin-producing β-cells and glucagon-producing α-cells, thereby suggesting a direct link of pancreatic IRX3 function to both obesity and type 2 diabetes.

Keywords: hb9, hlxb9, nkx2.2, pancreatic islet development, pancreatic peptides

Genome-wide association studies of SNPs are a powerful tool in the genetic analysis of common diseases. Several studies have shown significant associations of individual SNPs and haplotypes with type 2 diabetes (T2D) (15) and obesity (6, 7). With few exceptions, the identified SNPs fall into noncoding regions, either intronic or intergenic, suggesting a regulatory effect of the disease-associated haplotypes. Regulatory elements controlling developmental expression of transcription factors often coincide with highly conserved noncoding elements (HCNEs) (810).

We have recently shown that vertebrate genomes contain functional segments termed genomic regulatory blocks (GRBs), which are chromosomal domains that control the expression of developmental regulator genes, here termed target genes (11). GRBs often include unrelated genes termed bystander genes and can frequently be recognized through the conservation of synteny among all sequenced vertebrate genomes. Conserved synteny of bystander and target genes is maintained by the presence of enhancers within introns of the bystander genes that are specifically required for the regulation of the target gene (11, 12). A consequence of this type of arrangement is that intronic variants in one gene can affect a target gene further away, potentially leading to erroneous disease–gene association. To assess whether GRBs play a role in human genetic disease, and whether GRB analysis can help to link genomic regions that contain disease-causing variants to target genes, we used computational analysis on three regions, namely the HHEX-IDE, CDKAL1, and FTO LD blocks, which harbor SNPs recently demonstrated by genome-wide association studies to be significantly associated with risk for T2D and obesity (Table 1). We demonstrate that comparative genomic analysis of risk regions can quickly confirm or disqualify a candidate disease gene by showing that it is HHEX, SOX4, and IRX3 that likely underlie T2D and obesity in the three loci analyzed in this study. We show that expression patterns driven by HCNEs within the risk regions can rapidly be assessed through transgenesis in the zebrafish or in the mouse to identify the organ system or cell type affected by a common disease. We further demonstrate by knockdown of the zebrafish orthologue of IRX3, irx3a, that this transcription factor is involved in a conserved pathway that specifies pancreatic islet cell identities.

Table 1.
T2D/obesity risk SNPs fall into GRBs


Risk SNPs Identify Regions Regulating HHEX and SOX4.

For the HHEX-IDE region, the associated SNPs lie in a 295-kb block of LD that includes three genes, HHEX, KIF1 and IDE, encoding a transcriptional regulator involved in pancreatic development (13), a kinesin interacting factor, and an insulin-degrading enzyme, respectively (14). The risk allele has been associated with decreased pancreatic β-cell function (15). Throughout vertebrates, HHEX is in conserved synteny with the neighboring EXOC6 gene. The HHEX conserved synteny block overlaps with a small part of the risk allele–containing LD block. This part of the LD block contains the SNPs with the highest association scores, as well as the HHEX gene (Fig. 1A and Table 1). In contrast, KIF1 and IDE are located outside the conserved synteny block, strongly suggesting that any cis-regulatory elements within this part of the LD block regulate HHEX, and not KIF1 or IDE. The second risk region is a 200-kb LD block that includes the proximal promoter and exons and introns 1 to 5 of the gene CDKAL1. The SNP rs10946398 in this block is associated with decreased insulin secretion (15) but, in contrast to HHEX, CDKAL1 had no prior connection to either pancreatic development or β-cell function. Comparative genomic analysis revealed CDKAL1 to lie within a mammal:zebrafish synteny block containing CDKAL1 and SOX4 in tetrapods and cdkal1 and sox4b in zebrafish (Fig. 1B). Of these genes, SOX4/sox4b has been linked to both pancreatic development (16, 17) and insulin secretion in the mouse (18), and as such represents a plausible candidate for T2D, whereas cdkal1 in zebrafish is expressed ubiquitously and at low levels (Fig. S1). The other teleost fish with sequenced genomes (e.g., stickleback, medaka, fugu) retained only one copy of sox4 after whole-genome duplication, and the conserved synteny is larger, including the loci of E2F3 and MBOAT1. E2F3, a cell cycle regulator, is not expressed in pancreas (19), and its fate after whole-genome duplication in zebrafish indicates that it is not a GRB target gene. The third risk region, an LD block of 49 kb encompassing a large part of the first intron of FTO (fat mass- and obesity-associated gene), also contains numerous HCNEs and lies within an extended region of conserved synteny with the IRX3/5/6 cluster, the closest gene of which is the transcription factor–encoding IRX3 (Fig. 1). Although our computational analysis and GRB visualization suggested that the target gene of the HCNEs within FTO is IRX3, no connection of IRX3 to pancreatic development or insulin secretion was apparent in the literature. To evaluate both genes as candidates, we performed in situ hybridization for both fto and irx3a in zebrafish larvae, revealing barely detectable activity for fto (Fig. S1) and expression in endoderm, colocalized with insulin transcripts, for irx3a (Fig. S2).

Fig. 1.
Disease-associated SNPs (Top) and tested elements (elements 1–6) in the context of vertebrate GRBs around HHEX (A), SOX4 (B), and IRX3 (C). GRBs were defined by minimal synteny blocks to zebrafish (tan shading) or stickleback (light blue shading). ...

To provide further functional evidence for our hypothesis that the aforementioned T2D-associated SNPs are in genomic regions devoted to long-range regulation of HHEX, SOX4, and IRX3 (the GRB targets), we examined the general landscape in the LD blocks containing reported SNPs and tested HCNEs within these LD blocks for the ability to drive expression consistent with that of the GRB target gene. Enhancer activity of human HCNEs from healthy, lean subjects was tested experimentally using a GFP reporter assay in zebrafish, whose validity in one case was confirmed by mouse transgenic reporter assays. A summary of tested elements is given in Table 2.

Table 2.
Summary of tested elements

Reporter Assays in Mouse and Zebrafish Support Long-Range Regulation of HHEX and SOX4.

Patients carrying the risk-associated C-allele of rs1111875 in the LD block overlapping with the HHEX GRB show lower acute insulin response (15). This highly associated SNP maps to a conserved region that, when tested in enhancer reporter assays in mouse or zebrafish, shows pancreatic islet expression (tested element 1; Fig. 2 AC). Although this does not prove that rs1111875 is the variant conferring disease risk, our finding that the normal version of the HCNE containing rs1111875 directs reporter expression to the islet is highly suggestive of an effect on β-cell function.

Fig. 2.
Reporter expression patterns directed by noncoding elements from T2D risk regions. (A and B) Live dorsal image (A) and cryosection (B) of a 72-hpf transgenic zebrafish showing GFP-reporter expression driven by the Xenopus element equivalent to the rs1111875-containing ...

Even though many functional enhancers are not conserved beyond mammalian genomes (20), the enhancer-containing regions are often recognizable through conserved gene order in all vertebrate genomes. We found CDKAL1 to be within the GRB of SOX4 and in conserved synteny with it across vertebrate genomes. The risk-associated SNPs, rs7754840 and rs7756992 (2, 3, 5), fall into its large fifth intron, and the corresponding LD block contains noncoding elements conserved from human to frog genomes. The density pattern of HCNEs and the conservation of synteny between CDKAL1/SOX4 and zebrafish cdkal1/sox4b suggest that noncoding elements in this region likely regulate SOX4 transcription. When tested in zebrafish, the enhancer activity of the HCNE (element 2) closest to rs7754840 showed a complex hindbrain expression pattern, which corresponds to a subdomain of sox4 expression (Fig. 2D) unrelated to that of the broadly expressed cdkal1 (Fig. S1). In addition, the human element directed expression to the primordium of the swim bladder, an endodermal derivative adjacent to the pancreas in fish that also expresses the islet marker hlxb9 (21). These findings suggests that the tested element, which lies within the risk LD block, indeed regulates SOX4 and is, together with prior findings implicating mouse and zebrafish Sox4/sox4b in pancreatic development/insulin secretion, highly suggestive of SOX4 being the gene underlying the disease, rather than CDKAL1. Further work will be necessary to identify the functional SNP underlying disease susceptibility.

Fig. 3.
Pancreatic buds of 48-hpf zebrafish embryos showing a reduction in the number of insulin-expressing cells and an increase of ghrelin-expressing cells in irx3a morphants. In situ hybridization with insulin (red) and ghrelin (blue) probes on control (A ...

SNPs in FTO Are Within a Region Regulating IRX3.

Variants rs8050136, rs9939609, rs1421085, and rs17817449 were found to be highly associated with T2D and obesity and lie in an LD block of 49 kb in the FTO gene (4, 6, 7). FTO contains numerous conserved noncoding elements in its introns and is located adjacent to a gene desert next to IRX3, a transcriptional regulator expressed in the kidney, notochord, forebrain, hypothalamus, and endodermal derivatives (22). We tested the expression driven by the 2 most deeply conserved HCNEs from the obesity-associated LD block: in both cases, we obtained expression patterns consistent with that of the IRX3 gene (Fig. 2 E and F). Element 3 drove GFP expression in pronephric duct: Irx3 is expressed in the developing kidney (22) and directs nephron segment identity (23). Element 4 drove reporter expression in the notochord, also a subdomain of the Irx3 expression pattern (22). These results show that HCNEs located within the FTO obesity-risk LD block are most likely acting on IRX3, whereas zebrafish fto is at these stages not significantly expressed in the embryo. Neither of these subdomains, however, suggested a link to obesity, and no disease-associated SNPs map to those HCNEs. Upon testing the elements that overlap with risk SNPs rs1421085 and rs9939609, we noted that the majority of transgenes of the former (5 of 8) and a single transgenic line of the latter directed reporter expression to the pancreas (Fig. 2 G and H), suggesting that these HCNEs might regulate IRX3 expression in pancreas, and that its effect upon T2D might act through changes in glucose homeostasis. As we detected transcripts of the zebrafish IRX3 orthologue irx3a in the embryonic area with the earliest insulin expression (Fig. S2), we next tested whether irx3a affects cell identity in the pancreas, akin to the transcriptional regulator Nkx2.2, which has been shown to regulate the number of ghrelin- and insulin- producing cells in the pancreatic islet in both mouse and zebrafish (24, 25).

Zebrafish irx3a Affects the Ratios of Insulin-, Ghrelin-, and Glucagon-Producing Islet Cells.

The risk allele mapping to the LD block in FTO is linked to the development of T2D in obese subjects and a deregulation of the relative numbers of β- (i.e., insulin-producing) and ε-(i.e., ghrelin-producing) cells would be a plausible explanation for the co-occurrence of obesity and T2D. We therefore reasoned that IRX3 might serve a role related to that of Nkx2.2 during pancreas development.

To test this hypothesis, we generated morpholinos against the translation start site and the first splice junction of irx3a in zebrafish. The knockdown efficiency was tested by RT-PCR for skipping of the second exon of irx3a and at optimal conditions reached >99% (Fig. S3). Subsequent in situ hybridization for ghrelin and insulin revealed a significant increase for the former and a large decrease for the latter (Fig. 3 and Table 3 and Table 4), establishing the involvement of zebrafish irx3a in regulating the ratio of β- to ε-cells. In addition, knockdown of irx3a also diminished the number of α-cells producing glucagon, but not of those producing somatostatin (Fig. 3 and Table 4).

Table 3.
irx3a knockdown affects the numbers of pancreatic ε-, β-, and α-cells
Table 4.
irx3a knockdown affects the numbers of pancreatic ε-, β-, and α-cells

Neither IRX3 nor any of its vertebrate orthologues had any prior association with pancreatic development, but mouse Irx3, together with Nkx2.2, acts as a potent repressor of Hlxb9 during the development of spinal cord interneurons (26). Hlxb9 encodes a transcriptional regulator whose loss of function also affects pancreas development (27, 28). We therefore tested how knockdown of irx3a combined with that of nkx2.2a would affect expression of hlxb9 in a hlxb9:GFP transgenic zebrafish line (29). Knockdown of irx3a and nkx2.2a resulted in reduction of the numbers of hlxb9:GFP–expressing cells in the islet (Fig. S4A), whereas in the spinal cord, the expression domain of hlxb9 predictably expanded dorsally in irx3a knockdowns and ventrally in nkx2.2a knockdowns (Fig. S4B and Table S1). This indicates that, although irx3a, nkx2.2a and hlxb9 are involved in regulating the development of both spinal cord neurons and pancreatic islet cells, the interaction of irx3a and nkx2.2a with hlxb9 appears to be different in these tissues.

Both the conservation of the genic neighborhood of FTO/IRX3 across vertebrates and the finding that the strongest genome-wide signals for obesity map to an LD block containing HCNEs driving reporter expression in the pancreas strongly suggest that FTO is a bystander gene harboring HCNEs that drive IRX3 expression. In the case of lower IRX3 expression, the number of ghrelin-producing epsilon cells may increase at the expense of the pancreatic β- and α-cells, suggesting that a deregulation of pancreatic peptide hormones can underlie obesity and T2D with regard to the FTO association variants.


Our analysis of 3 LD blocks containing T2D and obesity risk variants identified regulatory regions highly likely to belong to GRBs targeting developmental transcriptional regulators. This led us to link the regions containing the disease-associated SNPs to candidate genes that had a prior association with pancreatic development. None of our observations represents an unequivocal identification of a functional disease-causing SNP, but this was not our aim: instead, our results provide strong evidence that the enclosing LD blocks are within evolutionary conserved GRBs devoted to the regulation of particular developmental genes (HHEX, SOX4, and IRX3). Although, for both HHEX and SOX4, evidence was already available for their involvement in pancreas development and/or regulation of insulin secretion, the case of IRX3 elucidates the power of GRB analysis of the results of GWA studies for the identification of hitherto unsuspected players in vertebrate development and human disorders. Although IRX3 had no prior association with pancreatic development, we found among possible clues in the literature that mouse Irx3, together with Nkx2.2, acts as a potent repressor of Hlxb9 during the development of spinal cord neurons (26). Hlxb9 encodes a transcriptional regulator whose loss of function also affects pancreas development (27, 28). In the mouse, Hlxb9 is necessary for early dorsal pancreas development as well as for β-cell development (27), whereas in zebrafish, hlxb9 deficiency affects only β-cells (21). As extension of the early expression window of Hlxb9 is also detrimental for murine pancreas development (30), one might speculate that Hlxb9 repression during this period is also dependent upon Irx3 and Nkx2.2, but this could not be ascertained in the zebrafish. Additionally, a direct effect of irx3a/nkx2.2a in the pancreas on hlxb9 would not explain the effect of their knockdown upon α-cells, which, in the mouse, do not express Hlxb9 (27). Any interaction of nkx2.2a and irx3a with hlxb9 in pancreatic development therefore remains speculative at this point and will be the subject of future studies.

It is of note in this regard that 3 genes encoding transcriptional regulators, namely Nkx2.2, Pax4, and Pax6, were already identified as regulators of β- versus ε-cell fate (24, 31), with Nkx2.2 and Pax6 acting in the same pathway. It will be interesting to see whether any of these genes are also involved in the development of obesity, and how IRX3 will fit into these pathways. We note that the principal site of ghrelin production in the mouse is the gastrointestinal tract, where there is no expression in zebrafish at the stages of our assay. However, loss of function of Nkx2.2 also affects the identity of peptide hormone producing cells in the mouse gut (32), suggesting that Irx3 may serve a related role in mammals. Interestingly, mouse Irx1 and Irx2 are also expressed in the pancreatic islets and in glucagon-producing cells, and act downstream of Ngn3 (33). Together with our finding that glucagon-producing cells are also affected in the zebrafish irx3a morphant, these results suggest the elucidation of the regulation of islet cell identity as a promising avenue for future research in human metabolic disorders.

Although additional evidence will be required for any of the SNPs associated to disease to be functional, we note that the expression patterns driven in transgenic zebrafish by human HCNEs can yield useful clues whether they could be functional in a given expression context, in addition to ascertaining their regulatory function through potential changes in transcription factor–binding sites (7). It is of interest that the tested human elements are not conserved in the zebrafish genome, but still can be interpreted by the zebrafish embryo, similar to what was previously reported by Fisher and colleagues (34). While the present work was under consideration, a knockout of the mouse Fto gene was described, reporting postnatal growth retardation and increased energy expenditure (35). Notably, the targeted deletion removed exons 2 and 3, and thus did not touch upon the interaction of HCNEs in Fto intron 1 with the Irx3 target gene. This knockout therefore did not test the function of the risk LD block, nor do these results contradict our findings. A second publication reported human FTO to be a gene causing recessive multiple malformations and lethality in early childhood, also accompanied by growth retardation (36). Interestingly, the authors noted the absence of obesity in the heterozygous parents.

It is striking that the risk sequence variants fall within GRBs of regulatory genes associated with multiple phenotypes (i.e., pleiotropic genes), which is not the case for T2D-associated SNPs that affect the coding region of genes, such as that of SLC30A8 (14). In the former case, the affected genes we have suggested have complex spatiotemporal expression and multiple roles in development and differentiation, so different SNPs within large regions can affect different roles of the same gene, whereas the latter represents an islet-specific gene whose coding mutation is not expected to affect other tissues. Elucidation of the functional relationship between HCNEs and their target genes may hold a key to understanding the disease mechanism behind the T2D- and obesity-associated genomic variation. As the risk SNPs in FTO are common variants, it is tempting to speculate that they confer a selective advantage under specific environmental conditions. Such an advantage may be the “thrifty genotype” postulated by Neel (37), whereby natural selection during famine may enrich human populations for variants decreasing energy expenditure and increasing adiposity in times of plenty (38).

Materials and Methods

HCNE Selection for Experimental Testing.

We identified human-zebrafish nonexonic (i.e., noncoding and non-UTR) evolutionary conserved sequences using the HCNE identification procedure described later, complemented with the Vertebrate Multiz Alignment and PhastCons Conservation and Chained Alignments tracks in the UCSC Genome Browser (39) for the human March 2006 assembly. Sequences were extracted from the UCSC Genome Browser for the human March 2006 assembly (hg18) or the Xenopus tropicalis August 2005 assembly (xenTro2).

Generation of Transgenic Zebrafish.

Candidate HCNEs were amplified by PCR on human and Xenopus genomic DNA using the Advantage 2 PCR Enzyme System (Clontech). The final enhancer test vector contained an HCNE in front of the zebrafish gata2 promoter coupled to the EGFP gene and an polyA signal, all flanked by Tol2 transposition sequences. Microinjection and screening were done as described (12). For description of bioinformatic methods, cloning of HCNEs, generation of transgenic mice, in situ hybridization, histology, and RT-PCR, see SI Materials and Methods.


To knock down irx3a expression, we have used the following morpholinos: MO1-irx3a (AGCTGTGGGAAAGACATTGTTGTGG) and MO2-irx3a (GTGCTCCCTTAAAAACACAGAACAT), targeting the ATG codon and the second intron–exon boundary, respectively. Solutions were prepared and microinjected into the yolk of one-cell stage embryos according as previously described (40). The morpholino for nkx2.2a (MOnk-5UTR, 5′-TGGAGCATTTGATGCAGTCAAGTTG) was the one reported by Pauls et al. (25). For the controls we used an unrelated/unspecific morpholino (GTtAATACcAGgATTAgATTgATTG).

Supplementary Material

Supporting Information:


We gratefully acknowledge imaging help by Mary Laplante, and the Sars Centre zebrafish facility for animal maintenance. We thank Dr. Koichi Kawakami for the tol2 vector, Dr. Robb Krumlauf for the lacZ vector, Dr. Dirk Meyer for the hlxb9:GFP transgenic line, and Albert V. Smith for discussion. This work was funded in part by grants from the Sars Centre (Ø.D., P.N., B.L., and T.S.B.), grants from the University of Bergen (A.M., P.R.N., and T.S.B.), a grant from the Institut du Cerveau et de la Moelle épinière, Paris, France (T.S.B.), the FUGE Program at the Research Council of Norway (A.R., A.M., P.R.N. and B.L.), Helse Vest (A.M. and P.R.N.), Innovest (A.M. and P.R.N.), The Translational Fund (A.M. and P.R.N.), the YFF Program of the Research Council of Norway and Bergen Forskningsstiftelse (B.L.), European Commission Grant LSHG-CT-2003-503469 as part of the ZF-Models integrated project in the 6th framework program (to T.S.B., F.A., and E.M.), grants BFU2007-60042/BMC, BFU2006-00349/BMC, and CSD2007-00008 from Ministerio de Educación y Ciencia of Spain (co-funded by Feder) (to J.L.G.S. and F.C.), Junta de Andalucía Grants CVI00260 and CVI 2658 (to J.L.G.S. and F.C.), Grant BFU2005-00025 from the Spanish Ministry of Education and Science (to M.E.A. and M.M.), the ProCNIC Foundation (M.E.A. and M.M.), CELDEV-CAM Grant S-SAL-0190-2006 from the Regional Government of Madrid (to M.E.A. and M.M.), CONSOLIDER-INGENIO Programme Grant 25120 (to J.L.G.S., F.C., M.E.A., and M.M.). M.J.T. was supported by Fundação para a Ciência e Tecnología, Portugal.


The authors declare no conflict of interest.

This article contains supporting information online at www.pnas.org/cgi/content/full/0911591107/DCSupplemental.


1. Sladek R, et al. A genome-wide association study identifies novel risk loci for type 2 diabetes. Nature. 2007;445:881–885. [PubMed]
2. Saxena R, et al. Diabetes Genetics Initiative of Broad Institute of Harvard and MIT, Lund University, and Novartis Institutes of BioMedical Research. Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels. Science. 2007;316:1331–1336. [PubMed]
3. Zeggini E, et al. Replication of genome-wide association signals in U.K. samples reveals risk loci for type 2 diabetes. Science. 2007;317:1035–1036. [PMC free article] [PubMed]
4. Scott LJ, et al. A genome-wide association study of type 2 diabetes in Finns detects multiple susceptibility variants. Science. 2007;316:1341–1345. [PMC free article] [PubMed]
5. Steinthorsdottir V, et al. A variant in CDKAL1 influences insulin response and risk of type 2 diabetes. Nat Genet. 2007;39:770–775. [PubMed]
6. Frayling TM, et al. A common variant in the FTO gene is associated with body mass index and predisposes to childhood and adult obesity. Science. 2007;316:889–894. [PMC free article] [PubMed]
7. Dina C, et al. Variation in FTO contributes to childhood obesity and severe adult obesity. Nat Genet. 2007;39:724–726. [PubMed]
8. Bejerano G, et al. Ultraconserved elements in the human genome. Science. 2004;304:1321–1325. [PubMed]
9. Sandelin A, et al. Arrays of ultraconserved non-coding regions span the loci of key developmental genes in vertebrate genomes. BMC Genomics. 2004;5:99. [PMC free article] [PubMed]
10. Woolfe A, et al. Highly conserved non-coding sequences are associated with vertebrate development. PLoS Biol. 2005;3:e7. [PMC free article] [PubMed]
11. Kikuta H, et al. Genomic regulatory blocks encompass multiple neighboring genes and maintain conserved synteny in vertebrates. Genome Res. 2007;17:545–555. [PMC free article] [PubMed]
12. Navratilova P, et al. Systematic human/zebrafish comparative identification of cis-regulatory activity around vertebrate developmental transcription factor genes. Dev Biol. 2009;327:526–540. [PubMed]
13. Bort R, Martinez-Barbera JP, Beddington RS, Zaret KS. Hex homeobox gene-dependent tissue positioning is required for organogenesis of the ventral pancreas. Development. 2004;131:797–806. [PubMed]
14. Doria A, Patti ME, Kahn CR. The emerging genetic architecture of type 2 diabetes. Cell Metab. 2008;8:186–200. [PMC free article] [PubMed]
15. Pascoe L, et al. RISC Consortium; U.K. Type 2 Diabetes Genetics Consortium. Common variants of the novel type 2 diabetes genes CDKAL1 and HHEX/IDE are associated with decreased pancreatic beta-cell function. Diabetes. 2007;56:3101–3104. [PubMed]
16. Mavropoulos A, et al. sox4b is a key player of pancreatic alpha cell differentiation in zebrafish. Dev Biol. 2005;285:211–223. [PubMed]
17. Wilson ME, et al. The HMG box transcription factor Sox4 contributes to the development of the endocrine pancreas. Diabetes. 2005;54:3402–3409. [PubMed]
18. Goldsworthy M, et al. Role of the transcription factor sox4 in insulin secretion and impaired glucose tolerance. Diabetes. 2008;57:2234–2244. [PMC free article] [PubMed]
19. Iglesias A, et al. Diabetes and exocrine pancreatic insufficiency in E2F1/E2F2 double-mutant mice. J Clin Invest. 2004;113:1398–1407. [PMC free article] [PubMed]
20. Visel A, Bristow J, Pennacchio LA. Enhancer identification through comparative genomics. Semin Cell Dev Biol. 2007;18:140–152. [PMC free article] [PubMed]
21. Wendik B, Maier E, Meyer D. Zebrafish mnx genes in endocrine and exocrine pancreas formation. Dev Biol. 2004;268:372–383. [PubMed]
22. Houweling AC, et al. Gene and cluster-specific expression of the Iroquois family members during mouse development. Mech Dev. 2001;107:169–174. [PubMed]
23. Alarcón P, Rodríguez-Seguel E, Fernández-González A, Rubio R, Gómez-Skarmeta JL. A dual requirement for Iroquois genes during Xenopus kidney development. Development. 2008;135:3197–3207. [PubMed]
24. Prado CL, Pugh-Bernard AE, Elghazi L, Sosa-Pineda B, Sussel L. Ghrelin cells replace insulin-producing beta cells in two mouse models of pancreas development. Proc Natl Acad Sci USA. 2004;101:2924–2929. [PMC free article] [PubMed]
25. Pauls S, Zecchin E, Tiso N, Bortolussi M, Argenton F. Function and regulation of zebrafish nkx2.2a during development of pancreatic islet and ducts. Dev Biol. 2007;304:875–890. [PubMed]
26. Lee SK, Jurata LW, Funahashi J, Ruiz EC, Pfaff SL. Analysis of embryonic motoneuron gene regulation: derepression of general activators function in concert with enhancer factors. Development. 2004;131:3295–3306. [PubMed]
27. Li H, Arber S, Jessell TM, Edlund H. Selective agenesis of the dorsal pancreas in mice lacking homeobox gene Hlxb9. Nat Genet. 1999;23:67–70. [PubMed]
28. Harrison KA, Thaler J, Pfaff SL, Gu H, Kehrl JH. Pancreas dorsal lobe agenesis and abnormal islets of Langerhans in Hlxb9-deficient mice. Nat Genet. 1999;23:71–75. [PubMed]
29. Flanagan-Steet H, Fox MA, Meyer D, Sanes JR. Neuromuscular synapses can form in vivo by incorporation of initially aneural postsynaptic specializations. Development. 2005;132:4471–4481. [PubMed]
30. Li H, Edlund H. Persistent expression of Hlxb9 in the pancreatic epithelium impairs pancreatic development. Dev Biol. 2001;240:247–253. [PubMed]
31. Heller RS, et al. Genetic determinants of pancreatic epsilon-cell development. Dev Biol. 2005;286:217–224. [PubMed]
32. Desai S, et al. Nkx2.2 regulates cell fate choice in the enteroendocrine cell lineages of the intestine. Dev Biol. 2008;313:58–66. [PMC free article] [PubMed]
33. Petri A, et al. The effect of neurogenin3 deficiency on pancreatic gene expression in embryonic mice. J Mol Endocrinol. 2006;37:301–316. [PubMed]
34. Fisher S, Grice EA, Vinton RM, Bessling SL, McCallion AS. Conservation of RET regulatory function from human to zebrafish without sequence similarity. Science. 2006;312:276–279. [PubMed]
35. Fischer J, et al. Inactivation of the Fto gene protects from obesity. Nature. 2009;458:894–898. [PubMed]
36. Boissel S, et al. Loss-of-function mutation in the dioxygenase-encoding FTO gene causes severe growth retardation and multiple malformations. Am J Hum Genet. 2009;85:106–111. [PMC free article] [PubMed]
37. Neel JV. Diabetes mellitus: a “thrifty” genotype rendered detrimental by “progress”? Am J Hum Genet. 1962;14:353–362. [PMC free article] [PubMed]
38. Diamond J. The double puzzle of diabetes. Nature. 2003;423:599–602. [PubMed]
39. Karolchik D, et al. The UCSC Genome Browser Database: 2008 update. Nucleic Acids Res. 2008;36(Database issue, Database issue):D773–D779. [PMC free article] [PubMed]
40. Nasevicius A, Ekker SC. Effective targeted gene ‘knockdown’ in zebrafish. Nat Genet. 2000;26:216–220. [PubMed]

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences
PubReader format: click here to try


Save items

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...


  • Compound
    PubChem Compound links
  • Gene
    Gene links
  • Gene (nucleotide)
    Gene (nucleotide)
    Records in Gene identified from shared sequence links
  • GEO Profiles
    GEO Profiles
    Related GEO records
  • HomoloGene
    HomoloGene links
  • MedGen
    Related information in MedGen
  • Nucleotide
    Published Nucleotide sequences
  • Pathways + GO
    Pathways + GO
    Pathways, annotations and biological systems (BioSystems) that cite the current article.
  • Protein
    Published protein sequences
  • PubMed
    PubMed citations for these articles
  • SNP
    PMC to SNP links
  • Substance
    PubChem Substance links
  • Taxonomy
    Related taxonomy entry
  • Taxonomy Tree
    Taxonomy Tree

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...