Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
Mol Cell Endocrinol. Author manuscript; available in PMC Feb 5, 2011.
Published in final edited form as:
PMCID: PMC2814883
NIHMSID: NIHMS149945

The regulatory role of Dicer in folliculogenesis in mice

Abstract

Dicer is the ribonuclease III for synthesis of mature functional microRNAs (miRNAs), which play an important role in regulating cell development. In the mouse ovary, the Dicer1 protein was expressed in both oocyte and granulosa cells of the follicle. In the present study, the role of miRNAs in mouse ovarian development was explored by using Dicer1 conditional knockout (cKO) mouse ovarian tissue (Amhr2 Cre/-; Dicer flox/flox), in which Dicer1 is deleted specifically in follicular granulosa cells. The morphology and gene expression profile of cKO and wild type (WT) mouse ovaries at various stages of development (day 4, day 8, 8 weeks and 8 months) were examined. Comparative analysis of the follicle number indicated that conditional inactivation of Dicer1 in the follicular granulosa cells led to an increased primordial follicle pool endowment, accelerated early follicle recruitment and more degenerate follicles in the cKO ovaries. In addition, significant differences were noted in the expression of some follicle development-related genes between cKO and WT mouse ovaries, such as Amh, Inhba, Cyp17a1, Cyp19a1, Zps, Gdf9 and Bmp15, suggesting the function of miRNAs in regulating gene expression is time- and gene-dependent. With the Dicer1 inactivation, mmu-mir-503, a miRNA that is more abundant in mouse ovary than in other tissues, was down-regulated significantly. Meanwhile, the expression of mmu-mir-503 decreased notably with follicle development in the gonadotropin-primed mouse ovary. Up-regulation of mmu-mir-503 in primary cultured granulosa cells resulted in the decreased expression of both the target gene and non-target gene at the transcriptional level, which involve genes related to granulosa cell proliferation and luteinization. In conclusion, Dicer1 plays important roles in follicular cell development through the differential regulation of gene expression.

Keywords: Dicer, microRNA, mmu-mir-503, ovary, follicle, mouse

Introduction

MicroRNAs (miRNAs) are endogenous, short non-coding RNAs (~22 nt) that have been identified in a variety of organisms from plants to mammals, and play important roles in development, cancer, stress responses, and viral infections through regulating the function of eukaryotic messenger RNAs (mRNAs) (Yajaira et al., 2007; Buchan and Parker, 2007). Central to the RNA interference (RNAi) machinery is the RNase III-containing enzyme, Dicer (Bernstein et al., 2001). Dicers (Dicer1 and Dicer2) are required to process microRNA precursors or long double-stranded RNA (dsRNA) into mature effector interference RNA molecules for, miRNA and small interference RNA (siRNA) pathways, respectively (Carmell and Hannon, 2004; Jin and Xie, 2007). Dicer1 is required for miRNA production in mammals (Kanellopoulou et al., 2005).

The miRNA regulatory pathway was previously found to be essential for mammalian development. Disruption of the Dicer1 gene in mice results in lethality at embryonic day 7.5 due to a loss of pluripotent stem cells (Bernstein et al., 2003). A different Dicer1 knockout caused lethality much later in development, with impaired angiogenesis (Yang et al., 2005). Similarly, Dicer1 mutant germline stem cells (GSCs) cannot be maintained and are lost rapidly from the niche without discernable features of cell death (Jin and Xie, 2007). In follow-up studies, which used the conditional knockout mouse model that silences Dicer1 expression in a tissue- or cell-specific manner, Dicer1 was found to play an important role in T-cell differentiation (Muljo et al., 2005), limb morphogenesis (Harfe et al., 2005), lung epithelium morphogenesis (Harris et al., 2006), and hair follicle development (Andl et al., 2006).

The role of Dicer1 in mammalian reproduction has been explored in several studies. In the germ cell-specific Dicer1 knockout mouse model, in which Cre recombinase is driven by the zona pellucida 3 (Zp3) promoter, Dicer1-deficient oocytes are unable to complete meiosis, and arrest with defects in meiotic spindle organization and chromosome congression (Murchison et al., 2007). The mouse mutant with a hypomorphic Dicer allele (Dicer d/d) resulted in Dicer1 deficiency with subsequent female infertility due in part to the insufficiency of corpus luteum (CL) function (Otsuka et al., 2008). In four recent parallel studies, anti-Müllerian hormone receptor type 2 (Amhr2) promoter is used to generate conditional Dicer1 knockout (cKO) mice.

Based on the expression of Amhr2, Dicer1 is conditionally inactivated postnatally in ovarian granulosa cells, and in the mesenchyme-derived cells of oviducts and uterus. Deletion of Dicer1 in these cell types results in multiple reproductive defects including decreased ovulation rates, compromised oocyte and embryo integrity, delayed early embryonic development, prominent bilateral paratubal (oviductal) cysts, and impaired development of the female reproductive tract (Nagaraja et al., 2008; Hong et al., 2008; Gonzalez and Behringer, 2009; Pastorelli et al., 2009). Although multiple defects are found in the reproductive tract in the Dicer1 cKO mouse ovary, impaired early embryonic development suggests that folliculogenesis/oogenesis is dysfunctional when Dicer1 is conditionally deleted in follicle granulosa cells. Notably, all the Dicer1-deficient female mice are infertile.

The regulatory effect of miRNAs on gene expression occurs at both at the transcriptional and translational levels (Buchan and Parker, 2007). The possibility that many mammalian miRNAs play important roles during development and other processes is supported by their tissue-specific or developmental stage-specific expression patterns as well as their evolutionary conservation (Lewis et al., 2003). By using miRNA amplification profiling (mRAP), Takada and colleagues identified 73 miRNAs in adult mouse ovary, and mmu-mir-503 is abundantly expressed in adult mouse ovary and placenta (Takada et al., 2006, same sequence as mmj-157 in original paper). Searching the target genes of mmu-mir-503 in miRBase (http://microrna.sanger.ac.uk/sequences/) and Targetscan (http://www.targetscan.org/), 882 target genes were found that are involved in cell communication, receptor activity, ion binding, nucleic acid binding, protein binding, cellular physiological processes, system development, metabolism, etc. Among the identified target genes, Gdf9, Fshr, Esr2, ActRIIa, Ccnd2 and ActRIIb are involved in ovarian follicle development.

In the present study, the role of Dicer1 in mouse ovarian follicle development was explored. Follicular development and its related gene expression were analyzed comparatively between wild type (WT) and Dicer1 cKO mouse ovaries. Dicer was found to play an important role in primordial follicle endowment, follicle initiation, follicle atresia, and CL formation.

Materials and Methods

Genomic DNA PCR

The Dicer1 conditional null mice were generated and maintained as described (Gonzalez and Behringer, 2009). To verify the deletion of Dicer1 driven by the Amhr2 promoter in the mouse ovary, wild-type (WT: Amhr2 +/+; Dicer flox/flox) and Dicer1 conditional knockout (cKO: Amhr2 Cre/+; Dicer flox/flox) mouse ovaries were collected for genomic DNA isolation using the DNeasy Blood & Tissue Kit (Qiagen, Valencia, CA). The PCR strategy is described in Figure 1D and in a previous study (Gonzalez and Behringer, 2009). The primers used for PCR are as follows: fw (CCTGACAGTGACGGTCCAAAG), rv (CATGACTCTTCAACTCAAACT), and null (CCTGAGCAAGGCAAGTCATTC).

Figure 1
The expression of Dicer1 protein in mouse ovaries measured by immunohistochemistry and verification of Dicer knock out in mouse ovaries with genomic DNA PCR. (A) The expression of Dicer1 could be detected in follicle oocytes, granulosa cells, luteal cells ...

Histology and follicle counts

Ovaries of WT and cKO mice were fixed in 4% paraformaldehyde and embedded in paraffin. Serial sections (5 µm) of each ovary were stained with hematoxylin and eosin (H & E) for follicle counting and morphological analysis. For each ovary, the middle sections of all ovarian sections were chosen for imaging. The follicles of different developing stages: primordial follicle, primary follicle, two-layer secondary follicle (2-secondary), tertiary follicle, and antral follicle were counted as described previously (Bristol-Gould et al., 2006). Follicles between two-layered secondary to antral stage follicles and with degenerated oocyte structures were tallied as degenerate follicles (Myers et al., 2004). Based on the average follicle diameter (150 µm), the degenerate follicles were counted every 30 sections and summed to obtain the total number or degenerate follicles for each ovary. Using the average CL size of 400 µm, every 80 sections were counted and the numbers were summed to obtain the total CL number in one ovary (Numazawa and Kawashima, 1982).

Immunohistochemisty and TUNEL

The expression of Dicer in WT mouse ovaries was examined by immunohistochemistry using the M.O.M. kit (Vector, Laboratories, Inc., Burlingame, CA). The primary antibody used for detection of Dicer1 is mouse monoclonal (13D6) to Dicer-chip grade at 1:200 dilution in PBS (ab14601, Abcam Inc., Cambridge, MA). Mouse IgG1 monoclonal antibody [NCM1] – isotype control (ab27479, Abcam Inc.) was used as negative control at the same dilution. For the detection of inhibin alpha-subunit, the primary antibody was rabbit polyclonal anti-alpha subunit antibody at the dilution of 1:100 in PBS (provided by Dr. W. Vale, The Salk Institute, La Jolla, CA). Rabbit sera at the same dilution were used as the negative control. The secondary antibody was biotinylated goat anti-rabbit at 1:500 dilution in PBS (Vector Laboratories, Inc.). DAB substrate was applied followed by hematoxylin counterstaining. TUNEL staining was performed using the TACS-XL In Situ Apoptosis Detection Kit (R&D, Minneapolis, MN) following the manufacturer’s protocol. Sections were then counterstained with hematoxylin.

GRMO2 granulosa cell line culture and siRNA transfection

GRMO2 cells are derived from a mouse granulosa cell line (provided by N.V. Innogenetics, Ghent, Belgium) and were cultured as described (Burkart et al., 2006) in HDTIS (1:1 mixture of DMEM and Ham’s F12 medium, 10 µg/ml insulin, 5 nM sodium selenite, 5 µg/ml transferrin) supplemented with 2% fetal bovine serum and sodium pyruvate (100 mg/liter) in a humidified incubator at 37°C and 5% CO2. Cells were transfected with siPORT™ NeoFX™ according to the manufacturer’s protocol (Ambion, Inc., Austin, TX). To knockdown Dicer1 levels in the GRMO2 cell line, On-TARGET plus SMART pool L-040892-00-0005, Mouse DICER1, NM_148948 (DHARMACON, Inc., US) was used at 10 nM concentration for transfection. siGENOME Non-Targeting siRNA Pool #2 (D-001206-14-05, DHARMACON, Inc., US) was used as the negative control at 10 nM. After cells were incubated in transfection solution for 24 h, media was changed to fresh HDTIS. At 96 h after transfection, when Dicer1 was proven to be knocked down by immunoblotting, both siDicer transfected cells and control transfected cells were collected for gene expression assay by real-time PCR.

RNA isolation and real-time PCR

For gene expression analysis, total RNA was isolated from the ovaries (WT and cKO) and from the GRMO2 cell line using a Qiagen mini prep RNA isolation kit (Qiagen, Valencia, CA). On column DNase digestion was performed using RNase-free DNase (Qiagen) to eliminate DNA contamination. 1 µg of total RNA of each sample was reverse transcribed with MMV reverse transcriptase (Promega, Madison, WI). The expression of follicular development-related genes (Table 1) was examined by real-time PCR using the Taqman gene expression assay according to the manufacturer’s protocol (Applied Biosystems Inc., Foster City, CA). The expression of Gapdh was used as an internal control. For the examination of mmu-mir-503, total RNA (including small RNAs) was isolated from ovaries and primary cultured granulosa cells with the miRNeasy Mini RNA isolation kit (Qiagen). 10 ng of total RNA was reverse transcribed with the TaqMan® MicroRNA Reverse Transcription Kit (Applied Biosystems Inc.). The level of mmu-mir-503 was examined by real-time PCR with the Taqman microRNA assay (mmu-mir-503) using the manufacturer’s protocol (Applied Biosystems Inc.).

Table 1
Fold change in gene expression changes in Dicer1 cKO mouse ovaries relative to WT mouse ovaries.

mmu-mir-503 in situ hybridization

All the solutions and manipulations used for mmu-mir-503 in situ detection were performed under RNase-free conditions. Ovaries from 21-day-old (C57 × BCA) mice were fixed in 4% paraformaldehyde and embedded in paraffin. Tissue sections (8 µm) were placed on Tissue Path Superfrost* Plus Gold Slides (Fisher Scientific, Pittsburgh, PA) and dried in a 37 °C incubator overnight. The protocol for non-radioactive in situ hybridization on paraffin sections using DIG-labeled miRCURY™ detection probes used for microRNA detection was obtained from Exiqon (Denmark). After sections were deparaffinized, deproteinated, and pre-hybridized for 2 h, the sections were incubated with the miNeasy™ LNA Detection probe for mmu-miR-503 (Exiqon) at a concentration of 20 nM in a humidified 56 °C chamber overnight. The miRCURY™ LNA Detection probe for U6 (Exiqon) was used as a negative control, and sections were incubated at a concentration of 20 nM in a humidified 54 °C chamber overnight. The next day, after rinsing with a 2×saline-sodium citrate buffer (SSC) at hybridization temperature, the slides were washed in wash buffer (50% formamide, 2×SSC) at hybridization temperature with 3 times for 30 min, followed by 5 times for 5 min in PBST at room temperature. All sections were then incubated with blocking buffer for 1 h, followed by overnight incubation with anti-DIG-AP fragments in blocking buffer at a 1:2000 dilution. On the third day, sections were incubated with NBT/BCIP for color development for about 5–8 h. To delineate ovarian structures, sections with a positive signal were counterstained with nuclear fast red. After dehydration briefly in ethanol, sections were covered with coverslips for microscopic examination.

Primary granulosa cell culture and mmu-mir-503 overexpression

Granulosa cells were collected using the method modified from Briers and colleagues (Briers et al., 1993). Day 21 mouse ovaries (C57 × BCA) were collected 46 h after priming with 5 IU equine chorionic gonadotropin (eCG, Sigma Aldrich, St. Louis, MO). Granulosa cells were released by puncturing large antral follicles with insulin-gauge needles in DMEM/F12 media supplemented with 3 mg/ml BSA. A single-cell suspension was acquired by gently pipetting up and down several times. Granulosa cells were cultured for 8 h in growth media: DMEM/F12 with 10 µg/ml insulin, 5 nM sodium selenite, 5 µg/ml transferrin and 5% FBS prior to transfection.

Transfection was performed with siPORT™ NeoFX™ according the manufacturer’s protocol (Ambion, Inc.). First, the Silencer® Cy™3-labled Negative Control #1 was used to test the efficiency of the small RNA transfection in primary cultured granulosa cells. Primary cultured granulosa cells were transfected with Pre-miR™ miRNA Precursor for mmu-miR-503 (Ambion, Inc.) at 30 nM in the growth media but without FBS. After a 24 h incubation, the transfected primary granulosa cells were cultured in growth media. As a transfection control, Pre-miR™ Precursor Molecules-Negative Control #1 was transfected at the same concentration and incubation time. Both mmu-mir-503 overexpressing cells and control transfected cells were collected 48 h after transfection for gene expression analysis by real-time PCR.

Results

The expression of Dicer1 in mouse ovary

The expression of Dicer1 protein in mouse ovary was examined by immunohistochemistry in 8-week mouse ovaries. As shown in Figure 1, Dicer was detected in the oocytes of primordial follicles, and in both granulosa cells and oocytes of the follicles from primary to antral stage in WT ovaries. Dicer1 expression was also noted in the CL and some stromal cells. To verify the Dicer1 deletion driven by Amhr2 promoter in the mouse ovary, we employed the same PCR strategy (Figure 1D) as previously described, which identifies the loss of Dicer1 exon 23 mediated by Amhr2-cre in the reproductive tract of Dicer1 cKO mice (Gonzalez and Behringer, 2009). As shown in Figure 1E, PCR amplification of cKO (Amhr2 Cre/+; Dicer flox/flox) ovarian DNA with Dicer1 deletion-specific primers (fw and null) generated a ~600-bp band (Lane 1), confirming that exon 23 of Dicer1 had been deleted in the cells within the cKO ovary (i.e., granulosa cells). cKO ovarian DNA was then PCR amplified using the fw and rv Dicer1-specific primers, which resulted in a 420-bp band from ovarian cells with intact Dicer1 (i.e., oocytes and stromal cells; Lane 2). As controls, the same PCR amplifications were carried out using DNA from the WT mouse ovary (Dicer flox/flox females that did not inherit the Cre allele: Amhr2 +/+; Dicer flox/flox); amplification with the Dicer1-specific primers (fw and rv; Lane 4) generated a 420-bp band and amplification with the Dicer1 deletion-specific primers (fw and null, Lane 3) generated no detectable bands.

Histological analysis of the Dicer1 cKO ovary

Changes in ovarian histology due to Dicer1 deletion were monitored at three developmental stages by H & E staining (Figure 2). At day 8, WT ovaries contained mainly primordial follicles, primary follicles, and a few secondary follicles (Figure 2A), whereas the Dicer1 cKO ovaries had more tertiary follicles, which developed beyond the two-layer secondary stage with obvious antrum-like spaces (Figure 2B). The ovaries from 8-week old Dicer1 cKO animals had follicles representing all developmental stages and CL resulting from ovulation (Figure 2D). More degenerate follicles were found in cKO ovaries as compared to WT ovaries (Figure 2C). Degenerate follicles were characterized by their developmental stage between two-layer secondary to tertiary follicles, with one layer of flattened granulosa cells close to degenerated oocytes (Figure 3A and B). These early degenerate follicles were TUNEL negative but had inhibin alpha-subunit expression in granulosa cells (Supplementary Figure 1). In addition, there were obvious cysts in the center of the 8-week Dicer1 cKO ovaries (Figure 2D). By 8 months in the WT mouse ovaries, there were only a few developing follicles and the ovaries showed a large area of stromal cells in the center (Figure 2E). In ovaries from 8-month-old cKO mice, more developing follicles could still be observed, and similar to cKO 8-week old ovaries, more obvious cysts were found in cKO ovaries than those of WT mice (Figure 2F). The structure of cyst was characterized by a single layer of epithelial cells (Figure 2F). Differences in the histological structures of CL were observed in WT and cKO 8-month-old ovaries (Figure 3C–F). In cKO mouse ovaries, there was obvious abnormal vascularization confirmed by the presence of more red blood cells in the CL, and luteal cells in the cKO ovaries had larger cytoplasmic areas. Compared with cKO, the WT ovaries had less vascularization in the CL, with little or no large cytoplasmic areas in the luteal cells.

Figure 2
The morphology of the WT and Dicer1 cKO mouse ovaries at different developmental stages. Representative sections of ovaries of WT mice at day 8 (A), 8 weeks (C), and 8 months (E), and ovaries of Dicer1 cKO mice at day 8 (B), 8 weeks (D) and 8 months (F) ...
Figure 3
The morphology of degenerate follicles and CL in Dicer1 cKO mouse ovaries. (A, B) The histological structure of 8-week-old mouse ovaries shows healthy developing follicles with intact oocytes (arrowhead), and degenerate follicles with fragmented (degenerated) ...

Folliculogenesis in the Dicer1 cKO mouse ovary

To further evaluate the differences in follicular development between WT and cKO mouse ovaries, the follicle number at different developmental stages was counted in the ovaries of day 4, day 8, day 28, 8-week and 8-month-old animals, with the time points chosen based on previous mouse ovarian development studies (Halpin et al., 1986; Eppig and Wigglesworth, 2000; Reddy et al., 2008). As shown in Figure 4, at day 4, when the primordial follicle pool is established in the neonatal ovary, a significant difference was found in the number of primordial follicles between WT and cKO mouse ovaries, suggesting that cKO ovaries were endowed with a bigger primordial follicle pool. Although more primary follicles were found in the cKO mouse ovaries, the difference was not statistically significant. By day 8, with the initiation of follicle development, significantly more primary follicles were found in Dicer1 cKO mouse ovaries as compared to WT. Most importantly, although there was a comparable level of secondary follicles in WT and cKO mouse ovaries, more tertiary follicles with three layers of granulosa cells and obvious small antrums were detected in the cKO mouse ovaries. There were 142 ± 40 tertiary follicles in cKO ovaries vs. 40 ±25 in WT ovaries (P<0.05). By puberty (day 28), the follicle numbers in different stages were comparable between WT and cKO mouse ovaries. Significantly more degenerate follicles were observed in the Dicer1 cKO ovaries. By 8 weeks, the time of reproductive maturity with regular estrous cycles in mice, as well as the number of primary, two-layer secondary and tertiary follicles, were comparable between WT and cKO mice. Significantly lower numbers (P<0.05) of antral follicles suggest that more antral follicles underwent atresia in cKO mouse ovaries before they were able to ovulate. By 8 months, the equivalent of advanced reproductive age for mice, the total follicle number was relatively higher in cKO ovaries; however, this difference did not reach statistical significance (Danilovoch and Sairam, 2006). Similar to the ovaries from younger animals, more degenerate follicles were found in 8-month-old cKO mouse ovaries compared to WT.

Figure 4
Comparative analysis of follicle numbers at the different stages of development (day 4, day 8, day 28, 8 weeks, and 8 months) in WT and Dicer1 cKO mouse ovaries.

Although the Dicer1 cKO mice were endowed with a larger number of primordial follicles at day 4, the rapid initiation of follicle development and accompanying follicle degeneration during pre-puberty resulted in a comparable total follicle number between WT and cKO by day 28. From day 4 to day 28, the average total follicle number decreased from 6984 to 4066 (41.78% loss) in cKO mice. In WT mouse ovaries, the total follicle number only decreased from 5020 to 3937 (21.57% loss). After puberty, from day 28 to 8 months, with comparable follicle numbers, a similar trend in follicle loss was observed in cKO and WT mouse ovaries, although in the cKO ovaries there were more follicles present than in WT ovaries.

Gene expression in Dicer1 cKO mouse ovary

As Dicer1 is involved in the synthesis of miRNAs, which in turn regulate ovarian gene expression, genes involved in folliculogenesis in the WT and Dicer1 cKO ovaries were examined by real-time PCR (Table 1). Three stages of ovaries were examined: day 4, day 8, and 8 weeks, based on the observed differences in folliculogenesis between the WT and cKO mouse ovary (Figure 4). In the day 4 ovaries, expression levels of four genes were significantly different between WT and cKO mouse ovaries: Bcl2, Bax, Nobox, and Inhba. In the day 8 ovaries, genes involved in primordial follicle recruitment, inhibin/activin-related genes and hormone-related genes showed obvious differences between the cKO and WT mouse ovaries. Two genes involved in oocyte development, Zp2 and Bmp15, had significantly lower expression levels in cKO ovaries than in WT ovaries. By 8 weeks, most genes examined had significantly lower expression in cKO vs. WT ovaries, particularly the genes involved in activin/inhibin (Inhba) assembly, hormone synthesis (Cyp11a1, Cyp17a1 and Cyp19a1), granulosa cell development (Casp3, Ccnd2 and Cdkn1b), and oocyte-specific genes (Zp2, Zp3, Gdf9 and Bmp15).

The effect of Dicer1 knockdown on granulosa cell development

In the Dicer1 cKO mouse ovary, Dicer1 is deleted starting from the fetal stage of development, the time when Amhr2 is active in the mouse ovary (Jorgez et al., 2004). Although Dicer1 was knocked out specifically in follicular granulosa cells, the interaction between the oocyte and granulosa cells plays an important role in regulating granulosa cell development. To demonstrate the function of miRNAs in granulosa cell development, Dicer1 was knocked down in growing granulosa cells by transfecting siDicer into the GRMO2 mouse granulosa cell line. The knockdown efficiency was first examined by real-time PCR and immunoblot. After 96 h of transfection, the level of Dicer1 was down-regulated significantly in the GRMO2 cells at both the mRNA level and the protein level (Figure 5A and B). GRMO2 cells with down-regulated Dicer1 were collected to examine gene expression by real-time PCR. As shown in Figure 5C, similar to the gene expression seen in the 8-week ovaries, Inha, Inhba, Cyp19a1, and Casp3 showed significant differences between control and Dicer1 knockdown groups. Notably, changes in expression of these four genes in the Dicer1 knockdown GRMO2 cells showed similar trends to those seen in the 8-week cKO mouse ovaries. Unlike the cKO ovaries, Inhbb was up-regulated in the Dicer1 knockdown GRMO2 cells, and there was no difference in the expression of Cdkn1b and Ccnd2 in Dicer1 knockdown GRMO2 cells.

Figure 5
The role of Dicer in granulosa cell development demonstrated by Dicer1 knockdown in GRMO2 mouse granulosa cell line. The down-regulation of Dicer1 in the GRMO2 cell line at the mRNA level (A) and protein level (B) after 96 h siDicer transfection. (C) ...

The expression of mmu-mir-503 in WT mouse ovaries

The expression of the miRNA mmu-mir-503 in the mouse ovary was examined by in situ hybridization. Expression of mmu-mir-503 was found in the cytoplasm of both granulosa cells and oocytes (Figure 6A, B), but was absent in the CL of 8-week-old mouse ovaries (data not shown). To examine the changes of mmu-mir-503 levels during follicle development, 21-day-old mice were injected with eCG to stimulate follicle development to the large antral stage, followed by hCG-induced ovulation and the formation of CL in the mouse ovary. As shown in Figure 6D, the mmu-mir-503 levels in 21-day-old mouse ovaries were used as controls. After ovaries were primed with eCG for 24 h to stimulate growth of FSH-responsive follicles, the mmu-mir-503 level was down-regulated significantly. After 48 h of eCG injection, at which point many pre-antral follicles in the ovary reach the large antral stage, the expression of mmu-mir-503 increased, but only to about half of the level of mmu-mir-503 in 21-day-old mouse ovaries. The granulosa cells in ovulated follicles luteinized 48 h following hCG injection. The level of mmu-mir-503 was down regulated significantly further to about 1/10 of the level in 21-day-old mouse ovaries (control ovaries). The significant down-regulation of mmu-mir-503 expression during follicle granulosa cell luteinization was consistent with the absence of mmu-mir-503 expression in CL in 8-week-old ovaries.

Figure 6
The expression of mmu-mir-503 during follicle development in the mouse ovary. (A, B) In situ hybridization of mmu-mir-503 in day 28 mouse ovaries. mmu-mir-503 could be detected in the cytoplasm of both oocytes and granulosa cells. (C) Negative control ...

The effect of mmu-mir-503 over-expression on granulosa cell gene expression

The level of mmu-mir-503 in Dicer1 cKO mouse ovary was examined by real-time PCR. Because of the Dicer1 deletion, the levels of mmu-mir-503 in cKO ovaries were significantly lower than that in WT mouse ovaries (Figure 7A). Since the mmu-mir-503 levels decreased with follicle development in the mouse ovaries, mRNA duplex (pre-mir 503) was transfected in primary cultured mouse granulosa cells isolated from antral follicles to up-regulate mmu-mir-503 levels. Transfection efficiency of small RNA in primary cultured granulosa cells was verified by the expression of cy3-labled small RNA in the cells (Supplementary Figure 2). After 48 h of mRNA duplex transfection, the level of mmu-mir-503 increased significantly (Figure 7B). Granulosa cells with mmu-mir-503 over-expression were collected to examine follicular development-related gene expression. As shown in Figure 7C, high levels of mmu-mir-503 in transfected granulosa cells resulted in significant down-regulation of both target and non-target genes that are involved in granulosa cell proliferation and luteinization.

Figure 7
The regulatory role of mmu-mir-503 in granulosa cell development. (A) Down-regulation of mmu-mir-503 in Dicer1 cKO mouse ovaries. (B) The transfection of duplex mRNA led to the up-regulation of mmu-mir-503 levels in primary cultured mouse granulosa cells ...

Discussion

Dicer is the critical enzyme in small RNA-regulated cell development. Recent research revealed that small RNAs play important regulatory roles in cell proliferation, differentiation, and apoptosis. During ovarian development, both oocytes and granulosa cells undergo differentiation, and at the same time acquire responsiveness to hormones and growth factors. The proliferation of follicular granulosa cells is critical to provide support to the oocytes (Erickson and Sorensen, 2005). Through different pathways, the apoptosis of both oocytes and granulosa cells leads to follicle loss at different developmental stages (Kaipia and Hsueh, 1997; Tingen et al., 2009). In the present study, the role of miRNAs in ovarian follicle development was examined in Dicer1 cKO mouse ovaries to extend the work of previous studies and specifically examine follicle development and gene expression.

In mice, Amhr2 is expressed in the fetal and postnatal gonads, the coelomic epithelium of the mesonephros, and the mesenchyme surrounding the Müllerian ducts (Arango et al., 2008). In the adult ovary, Amhr2 is expressed specifically in the granulosa cells of preantral and small antral follicles (Baarends et al., 1995). By using a knock-in line in which Cre recombinase is driven by the Amhr2 promoter, this gene could be conditionally inactivated in follicular granulosa cells of the mouse ovary, providing a means to study this gene’s function specifically during ovarian development (Jorgez et al., 2004; Jeyasuria et al., 2004; Pangas et al., 2008). Although in the present and previous studies Dicer1 deletion was verified by genomic DNA PCR without quantification, the infertility associated with phenotypes present in the Dicer1 cKO mouse ovary and oocyte suggested that granulosa cell expressed Dicer plays important roles in mouse ovarian follicle development (Gonzalez and Behringer, 2009).

Based on the expression of Amhr2 in mice, Dicer1 is not only conditionally knocked out in the granulosa cells of Amhr2 Cre/+; Dicer flox/flox mouse ovaries, but also in the somatic cells of the oviduct and uterus. Previous parallel studies determined that the female Dicer1 cKO mouse is infertile due to defects in ovarian function and the presence of paratubal cysts. Superovulation of immature females yields only half the number of oocytes compared with WT mice, suggesting an abnormal response to gonadotropin stimulation or defects in ovulation (Nagaraja et al., 2008). This hypothesis is consistent with our examination of the expression of hormone receptor genes: both androgen receptor (Ar) and luteinizing hormone/choriogonadotropin receptor (Lhcgr) were down-regulated significantly in 8-week-old Dicer1 cKO mouse ovaries (Table 1) Although follicles at all developmental stages were found in 8-week-old cKO ovaries, there were significant differences in gene expression of the hormone-related genes, which may be the reason for abnormal estrous cycles in cKO mice (Nagaraja et al., 2008). At the mRNA level, three key enzymes involved in hormone synthesis in the ovary showed obvious changes with Dicer1 inactivation in granulosa cells. Expression of Cyp19a1, the enzyme for estrogen synthesis, was about five-fold higher in cKO mouse ovaries compared with WT ovaries, and the estrogen levels were higher in cKO mice, but these differences were not significant (Gonzalez and Behringer, 2009). In contrast, expression of Cyp11a1, the enzyme for the synthesis of progesterone, was about two-fold lower in cKO mouse ovaries than in WT ovaries (Table 1). Progesterone levels in cKO mice were slightly higher but not significantly different in our cooperative study (Gonzalez and Behringer, 2009). Impaired progesterone synthesis, as a result of Dicer1 deficiency, was also found in the previous study. Disrupted development of the CL and low progesterone are thought to be the major reason for infertility in Dicer1-deficient mice (Otsuka et al., 2008). Notably, in addition to the abnormal luteal cell morphology in the cKO mouse ovary (Figure 3F), significant changes in luteal cell-related gene expression (i.e., Cyp11a1, Cdkn1b) also reflect the loss of normal luteal cell function due to Dicer deletion in mouse ovarian granulosa cells.

The communication between oocyte and granulosa cells plays a very important role in follicle development (Matzuk et al., 2002). As demonstrated in the present study, although Dicer1 was knocked out in follicular granulosa cells, the development of the oocyte was also seriously disrupted. Although ovulation could occur despite the deletion of Dicer1 in follicle granulosa cells, impaired egg development is one of the major reasons for the infertility of cKO mice (Nagaraja et al., 2008; Gonzalez and Behringer, 2009). In the collaborative study, from which the ovaries examined in the present study were derived, oocytes collected from the isthmus showed abnormal egg structures with dark condensed oocytes inside the zona pellucida, or empty zona pellucida (Gonzalez and Behringer, 2009). Interestingly, similar defects in early embryos were found in a parallel study using a similar mouse model (Nagaraja et al., 2008). These investigators observed that there was no embryo in the uteri of adult Dicer1 cKO female mice on 3.5 d after copulation. However, between 15 and 100 zona pellucida remnants and several embryos were found when the paratubal cysts were flushed (Nagaraja et al., 2008). Similar fragmentation and degeneration associated with Dicer1 deletion in granulosa cells were also observed in early embryonic development, even when the embryos from Dicer1 cKO mice were cultured in vitro (Hong et al., 2008). All of these studies confirm our hypothesis that in the Dicer1 cKO ovary, impaired oocyte development is the major reason for the lack of healthy eggs and infertility. In addition to impaired functional gene expression in granulosa cells of Dicer1 cKO mice, the down-regulation of oocyte-specific gene expression as the result of impaired oocyte-granulosa cell communication leads to the failure of oocyte development and maturation in the Dicer1 cKO mouse ovaries.

Based on our assessment of the follicle numbers in WT and Dicer1 cKO ovaries, Dicer1 was found to play an important role in folliculogenesis, including follicle endowment, initiation, and depletion. It was suggested by the gene expression data in various developmental stage ovaries that miRNAs has a differential regulatory effect among target genes. For instance, Kitl, which is involved in primordial follicle formation and development, did not show obvious changes during ovarian development in the absence of Dicer1 (Driancourt et al., 2000). In contrast, Inba, which encodes a subunit of Activin A/Inhibin A and hence plays a critical role in folliculogenesis, varied significantly at the three stages of Dicer1 cKO ovarian development examined (Knight and Glister, 2006).

Although the Dicer1 cKO mouse ovaries were endowed with larger primordial follicle pools at day 4, the follicles showed rapid initiation in 8-day-old cKO mouse ovaries. However, a greater number of follicles were found degenerated because of failed oocyte development. Based upon histological analysis, the degenerate follicles were characterized by obviously degenerated oocytes but functional granulosa cells showing positive staining for inhibin alpha-subunit (Supplementary Figure 1). This suggests that although it is the granulosa cells that have the defective miRNA regulatory pathway, the subsequent effect on oocyte development may be the determinative reason for early follicle degeneration. At the mRNA level, all the oocyte-specific genes were down-regulated in Dicer1 cKO mouse ovaries. Most interestingly, in both hypomorphic Dicer1 mutant mice and Zp3 conditional Dicer1 deletion in oocytes, there are no significant defects in the morphology of oocytes and early embryos. The function of Dicer1 in oocytes was determined to be the organization of spindles and congression of chromosomes (Murchison et al., 2007). The deletion of Dicer1 in granulosa cells led to degenerate oocytes with obvious morphological defects and down-regulation of oocyte-specific genes, suggesting that Dicer plays different roles in regulating oocyte and granulosa cell development and hence follicle development.

In mice, the miRNA mmu-mir-503 has been found to be more abundant in the ovary and placenta than in other tissues (Takada et al., 2006). Although the expression of mmu-mir-503 was localized to both granulosa cells and oocytes, the level of mmu-mir-503 was significantly lower when follicular development was primed by gonadotropins, suggesting a role of mmu-mir-503 in follicle granulosa cell proliferation and differentiation, and especially luteinization. Gene expression profiles in granulosa cells with over-expressed mmu-mir-503 showed that mmu-mir-503 mediated repression of target gene expression at the level of RNA accumulation, and Ccnd2, which is essential for the proliferation of follicle granulosa cells, is down-regulated significantly (Gilchrist et al., 2006). High levels of mmu-mir-503 also led to the decrease of non-target gene expression, perhaps because of the interaction of signal pathways. Cdkn1b is an important gene involved in granulosa cell luteinization (Hampl et al., 2000), and showed decreased expression with high levels of mmu-mir-503 expression in granulosa cells. The inhibitory effect of mmu-mir-503 on granulosa cell proliferation and luteinization is consistent with the down-regulation of mmu-mir-503 in gonadotropin-primed ovaries.

In conclusion, through the regulation of follicle cell proliferation, differentiation and apoptosis, the Dicer1-regulated miRNA signal pathway plays an important role in mouse follicular development.

Supplementary Material

01

Supplementary Figure 1:

Degeneration of pre-antral follicles due to oocyte failure. (A) The TUNEL assay showed positive staining in most of the granulosa cells in atretic antral follicles (black arrow). In degenerate pre-antral follicles (red arrow), degenerated oocytes lost intact structures, but only a few granulosa cells showed TUNEL-positive staining. In healthy antral follicles (arrowhead), oocytes are intact and none of the granulosa cells are TUNEL-positive. (B) The inhibin alpha-subunit could be detected in the granulosa cells of healthy antral follicles (arrowhead). In pre-antral degenerated follicles, although there is no intact connection between oocytes and granulosa cells, and oocytes have lost their normal structure, granulosa cells still had expression of the inhibin alpha-subunit. Bar=100 µm. OO: oocyte; GCs: granulosa cells.

02

Supplementary Figure 2:

Small RNA transfection efficiency in primary cultured granulosa cells demonstrated by transfecting Cy3-labeled small RNA into the cells. Red: Cy3-labeled small RNA in cell plasma; Blue: cell nuclei dyed with DAPI.

Acknowledgements

The authors gratefully acknowledge the assistance of Sarah Kiesewetter and Jen Jozevic in animal care concerns, and the PO1-funded Northwestern University Histology Core (Tyler Wellington, director) for all tissue processing.

Grant Support: The work presented in this manuscript was supported by the National Institutes of Health RL1HD058295 (The Oncofertility Consortium), HD30284, and PO1 HD21921.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • Andl T, Murchison EP, Liu F, Zhang YH, Yunta-Gonzalez M, Tobias JW, Andl CD, Seykora JT, Hannon GJ, Millar SE. The miRNA-processing enzyme dicer is essential for the morphogenesis and maintenance of hair follicles. Current Biology. 2006;16:1041–1049. [PMC free article] [PubMed]
  • Arango NA, Kobayashi A, Wang Y, Jamin SP, Lee HH, Orvis GD, Behringer RR. A mesenchymal perspective of Müllerian duct differentiation and regression in Amhr2-lacZ mice. Molecular Reproduction and Development. 2008;75:1154–1162. [PubMed]
  • Baarends WM, Uilenbroek JT, Kramer P, Hoogerbrugge JW, van Leeuwen EC, Themmen AP, Grootegoed JA. Anti-müllerian hormone and anti-müllerian hormone type II receptor messenger ribonucleic acid expression in rat ovaries during postnatal development, the estrous cycle, and gonadotropin-induced follicle growth. Endocrinology. 1995;136:4951–4962. [PubMed]
  • Bernstein E, Caudy AA, Hammond SM, Hannon GJ. Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature. 2001;409:363–366. [PubMed]
  • Bernstein E, Kim SY, Carmell MA, Murchison EP, Alcorn H, Li MZ, Mills AA, Elledge SJ, Anderson KV, Hannon GJ. Dicer is essential for mouse development. Nature Genetics. 2003;35:215–217. [PubMed]
  • Briers TW, Voorde AVD, Vanderstichele H. Characterization of immortalized mouse granulosa cell lines. In Vitro Cellular and Developmental Biology. 1993;29A:847–854. [PubMed]
  • Bristol-Gould SK, Kreeger PK, Selkirk CG, Kilen SM, Cook RW, Kipp JL, Shea LD, Mayo KE, Woodruff TK. Postnatal regulation of germ cells by activin: the establishment of the initial follicle pool. Developmental Biology. 2006;298:132–148. [PubMed]
  • Buchan JR, Parker R. The two faces of miRNA. Science. 2007;318:1877–1878. [PubMed]
  • Burkart AD, Mukherjee A, Mayo KE. Mechanism of Repression of the Inhibin alpha-Subunit Gene by Inducible 3',5'-Cyclic Adenosine Monophosphate Early Repressor. Molecular Endocrinology. 2006;20:584–597. [PubMed]
  • Carmell MA, Hannon GJ. RNase III enzymes and the initiation of gene silencing. Nature Structural & Molecular Biology. 2004;11:214–218. [PubMed]
  • Danilovoch N, Sairam MR. Targeting gonadotropin receptor genes: reproductive biology, aging, and related health implications. Endocrine. 2006;26:219–226. 2005. [PubMed]
  • Driancourt MA, Reynaud K, Cortvrindt R, Smitz J. Roles of KIT and KIT ligand in ovarian function. Reviews of Reproduction. 2000;5:143–152. [PubMed]
  • Erickson GF, Sorensen RA. In vitro maturation of mouse oocytes isolated from late, middle, and pre-antral graafian follicles. Journal of Experimental Zoology. 1974;190:123–127. [PubMed]
  • Eppig JJ, Wigglesworth K. Development of mouse and rat oocytes in chimeric reaggregated ovaries after interspecific exchange of somatic and germ cell components. Biology of Reproduction. 2000;63:1014–1023. [PubMed]
  • Gilchrist RB, Ritter LJ, Myllymaa S, Kaivo-Oja N, Dragovic RA, Hickey TE, Ritvos O, Mottershead DG. Molecular basis of oocyte-paracrine signalling that promotes granulosa cell proliferation. Journal of Cell Science. 2006;119:3811–3821. [PubMed]
  • Gonzalez G, Behringer RR. Dicer is required for female reproductive tract development and fertility in the mouse. Molecular Reproduction and Development. 2009 in press. [PMC free article] [PubMed]
  • Hampl A, Pachernik J, Dvorak P. Levels and interactions of p27, cyclin D3 and CDK4 during the formation and maintenance of the corpus luteum in mice. Biology of Reproduction. 2000;62:1393–1401. [PubMed]
  • Halpin DM, Jones A, Fink G, Charlton HM. Postnatal ovarian follicle development in hypogonadal (hpg) and normal mice and associated changes in the hypothalamic-pituitary ovarian axis. Journal of Reproduction & Fertility. 1986;77:287–296. [PubMed]
  • Harfe BD, McManus MT, Mansfield JH, Hornstein E, Tabin CJ. The RNaseIII enzyme Dicer is required for morphogenesis but not patterning of the vertebrate limb. PNAS. 2005;102:10898–10903. [PMC free article] [PubMed]
  • Harris KS, Zhang Z, McManus MT, Harfe BD, Sun X. Dicer function is essential for lung epithelium morphogenesis. Proceeding in National Academy of Sciences. 2006;103:2208–2213. [PMC free article] [PubMed]
  • Hong X, Luense LJ, McGinnis LK, Nothnick WB, Christenson LK. Dicer1 is essential for female fertility and normal development of the female reproductive system. Endocrinology. 2008;149:6207–6212. [PMC free article] [PubMed]
  • Jeyasuria P, Ikeda Y, Jamin SP, Zhao L, De Rooij DG, Themmen AP, Behringer RR, Parker KL. Cell-specific knockout of steroidogenic factor 1 reveals its essential roles in gonadal function. Molecular Endocrinology. 2004;18:1610–1619. [PubMed]
  • Jin ZG, Xie T. Dcr-1 maintains drosophila ovarian stem cells. Current Biology. 2007;17:539–544. [PubMed]
  • Jorgez CJ, Klysik M, Jamin SP, Behringer RR, Matzuk MM. Granulosa cell-specific inactivation of follistatin causes female fertility defects. Molecular Endocrinology. 2004;18:953–967. [PubMed]
  • Kaipia A, Hsueh AJW. Regulation of ovarian follicle atresia. Annual Review of Physiology. 1997;59:349–363. [PubMed]
  • Kanellopoulou C, Muljo SA, Kung AL, Ganesan S, Drapkin R, Jenuwein T, Livingston DM, Rajewsky K. Dicer-deficient mouse embryonic stem cells are defective in differentiation and centromeric silencing. Genes & Development. 2005;19:489–501. [PMC free article] [PubMed]
  • Knight PG, Glister C. TGF-beta superfamily members and ovarian follicle development. Reproduction. 2006;132:191–206. [PubMed]
  • Lewis BP, Shih IH, Jones-Rhoades MW, Bartel DP, Burgel CB. Prediction of mammalian microRNA targets. Cell. 2003;115:787–798. [PubMed]
  • Matzuk MM, Burns KH, Viveiros MM, Eppig JJ. Intercellular communication in the mammalian ovary: oocytes carry the conversation. Science. 2002;296:2178–2180. [PubMed]
  • Muljo SA, Ansel KM, Kanellopoulou C, Livingston DM, Rao A, Rajewsky K. Aberrant T cell differentiation in the absence of Dicer. The Journal of Experimental Medicine. 2005;202:261–269. [PMC free article] [PubMed]
  • Murchison EP, Stein P, Xuan ZY, Pan H, Zhang MQ, Schultz RM, Hannon GJ. Critical roles for Dicer in the female germline. Genes & Development. 2007;21:682–693. [PMC free article] [PubMed]
  • Myers M, Britt KL, Wreford NGM, Ebling FJP, Kerr JB. Methods for quantifying follicular numbers within the mouse ovary. Reproduction. 2004;127:569–580. [PubMed]
  • Nagaraja AK, Andreu-Vieyra C, Franco HL, Ma L, Chen RH, Han DY, Zhu HF, Agno JE, Gunaratne PH, DeMayo FJ, Matzuk MM. Deletion of Dicer in somatic cells of the female reproductive tract causes sterility. Molecular Endocrinology. 2008;22:2336–2352. [PMC free article] [PubMed]
  • Numazawa A, Kawashima S. Morphometric studies on ovarian follicles and corpora lutea during the oestrous cycle in the mouse. Journal of Reproduction and Fertility. 1982;64:275–283. [PubMed]
  • Otsuka M, Zheng M, Hayashi M, Lee JD, Yoshino O, Lin SC, Han JH. Impaired microRNA processing causes corpus luteum insufficiency and infertility in mice. Journal of Clinical Investigation. 2008;118:1944–1954. [PMC free article] [PubMed]
  • Pangas SA, Li X, Umans L, Zwijsen A, Huylebroeck D, Gutierrez C, Wang D, Martin JF, Jamin SP, Behringer RR, Robertson EJ, Matzuk MM. Conditional deletion of Smad1 and Smad5 in somatic cells of male and female gonads leads to metastatic tumor development in mice. Molecular and Cellular Biology. 2008;28:248–257. [PMC free article] [PubMed]
  • Pastorelli LM, Wells S, Fray M, Smith A, Hough T, Harfe BD, McManus MT, Smith L, Woolf AS, Cheeseman M, Greenfield A. Genetic analyses reveal a requirement for Dicer1 in the mouse urogenital tract. Mammalian Genome. 2009;20:140–151. [PubMed]
  • Reddy P, Liu L, Adhikari D, Jagarlamudi K, Rajareddy S, Shen Y, Du C, Tang W, Hämäläinen T, Peng S, Lan Z, Cooney A, Huhtaniemi I, Liu K. Oocyte-specific deletion of Pten causes premature activation of the primordial follicle pool. Science. 2008;319:611–613. [PubMed]
  • Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H. Mouse microRNA profiles determined with a new and sensitive cloning method. Nucleic Acids Research. 2006;34:e115. [PMC free article] [PubMed]
  • Tingen CM, Bristol-Gould SK, Kiesewetter SE, Wellington JT, Shea L, Woodruff TK. Prepubertal primordial follicle loss in mice is not due to classical apoptotic pathways. Accepted by Biology of Reproduction. 2009 [PMC free article] [PubMed]
  • Yajaira S, Carlos FH, Jordan SP, William CS. Dicer Dependent MicroRNAs Regulate Gene Expression and Functions in Human Endothelial Cells. Circulation Research. 2007;100:1164–1173. [PubMed]
  • Yang WJ, Yang DD, Na S, Sandusky GE, Zhang Q, Zhao G. Dicer is required for embryonic angiogenesis during mouse development. Journal of Biological Chemistry. 2005;280:9330–9335. [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...