• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
Protein Expr Purif. Author manuscript; available in PMC Dec 11, 2009.
Published in final edited form as:
PMCID: PMC2792030
NIHMSID: NIHMS143363

An expression vector tailored for large-scale, high-throughput purification of recombinant proteins [star]

Abstract

Production of milligram quantities of numerous proteins for structural and functional studies requires an efficient purification pipeline. We found that the dual tag, his6-tag–maltose-binding protein (MBP), intended to facilitate purification and enhance proteins’ solubility, disrupted such a pipeline, requiring additional screening and purification steps. Not all proteins rendered soluble by fusion to MBP remained soluble after its proteolytic removal, and in those cases where the protein remained soluble, standard purification protocols failed to remove completely the stoichiometric amount of his6-tagged MBP generated by proteolysis. Both liabilities were alleviated by construction of a vector that produces fusion proteins in which MBP, the his6-tag and the target protein are separated by highly specific protease cleavage sites in the configuration MBP-site-his6-site-protein. In vivo cleavage at the first site by co-expressed protease generated untagged MBP and his6-tagged target protein. Proteins not truly rendered soluble by transient association with MBP precipitated, and untagged MBP was easily separated from the his-tagged target protein by conventional protocols. The second protease cleavage site allowed removal of the his6-tag.

Keywords: High-throughput, Structural genomics, Maltose-binding protein, TVMV protease, Ligation-independent cloning

The burgeoning genomic information now available makes vast numbers of proteins accessible for structural and functional studies, and many large-scale projects have developed automated protocols for amplifying, cloning, and expressing genes, and for screening proteins for desirable properties [15]. Similar strides have been made in streamlining protein purification, but production of sufficient material for detailed structural and functional characterization remains labor-intensive and time-consuming [3,4,6,7]. Typically, purification is facilitated by fusing proteins to affinity tags, most commonly a his-tag, which allows purification by immobilized metal-ion affinity chromatography (IMAC, [8]). Additional tags are often attached to improve proteins’ solubility, such as maltose-binding protein (MBP) [24,9,10]. In typical protein production pipelines, the resulting fusion proteins are first screened for solubility, then purified by semi-robotic protocols in which the tags are removed by a specific protease such as the tobacco etch virus (TEV) protease [4,6,11,12]. A second step, such as subtractive IMAC, then removes contaminating host proteins. When standard protocols of this design, as implemented by the Midwest Center for Structural Genomics (MCSG) [6], were applied to targets appended with N-terminal his6–MBP tags, complications arose because of false positives (proteins scored as soluble in screens of fusion proteins but insoluble after removal of MBP) and by failure of the secondary IMAC step to remove completely the his6–MBP generated by TEV cleavage. Here we describe a new vector that alleviates these problems without modification of established screening and purification protocols.

Vector pMCSG19 (Fig. 1, Table 1) is derived from the simple his6-tag–TEV-site vector, pMCSG7 [13], which has been used routinely for the production of proteins within the MCSG. The new vector applies strategies developed by Waugh and colleagues [14,15] to the problems outlined above. It encodes a leader sequence of MBP–TVMV-site–his6-tag–TEV-site, where TVMV-site refers to the recognition sequence of tobacco vein mottling virus (TVMV) protease, another highly specific plant viral protease similar to TEV protease but with distinct specificity [16]. This configuration is distinct from the conventional arrangement used in most MBP fusions where the his-tag is not separated from MBP by a cleavage site, as occurs in vector pMCSG9 (Fig. 1B), which encodes the leader his6–MBP–TEV-site. Expression of proteins from pMCSG19 with co-expression of TVMV protease resulted in efficient removal of MBP and eliminated false positives that occurred from pMCSG9. Separation of the his6-tag from MBP allowed established robotic purification protocols to purify the soluble proteins successfully without modification or addition of steps.

Fig. 1
Organization of pMCSG vectors. Vectors are based on the pET system of vectors (Novagen). All vectors contain the same LIC region and accept the same PCR products. (A) Expression region of pMCSG7. Following the T7 promoter, lac operator, and ribosome binding ...
Table 1
Properties of vectors

Materials and methods

Construction of pMCSG9 and pMCSG19

The vector pMCSG9 was constructed by inserting the gene encoding MBP into the KpnI site of vector pMCSG7 [13]. The MBP encoding region was generated by PCR using plasmid pRK793 [17] as template (a generous gift from David Waugh) and the primers 5′-TTTTAGATCTGATGTCCCCTATACTAGGTTATTGG and 5′-TTTTGGTACCTGGGATATCGTAATCATCCGATTTTGGAGGATGGT (purchased from the Howard Hughes Medical Institute-Keck Laboratory of Yale University, New Haven, CT). The vector was digested with KpnI and dephosphorylated with calf intestinal phosphatase (Promega, Madison, WI), and ligated to the KpnI-treated PCR product. The resulting plasmids were screened for orientation and the expression region of a positive candidate was sequenced to verify that the sequence of MBP matched that encoded by pRK793. Vector pMCSG19 was constructed by replacing the region encoding the his6-tag in pMCSG7 (between NdeI and BglII, Fig. 1A) with a sequence encoding MBP–TVMV-site–his6-tag. The MBP–TVMV-site portion of this region was amplified from vector pRK1035 [15] (Science Reagents, Inc.) by PCR using Platinum Pfx polymerase (Invitrogen) and the primers TTAAACATATGAAAATCGAAGAAGG and TTATAGGATCCACGCCAGAAGAGTGATGATGATGGTG (encoding the his6-tag on its complement) in 2× strength reaction buffer with 1 mM Mg2+ for 25 cycles. The PCR product was cleaved with NdeI and BamHI and ligated into pMCSG7 which had been treated with NdeI and BglII followed by calf intestinal phosphatase and gel purification. The amplified and flanking sequences of the resulting construct were verified by DNA sequencing.

Ligation-independent cloning into pMCSG vectors

Vectors were prepared for LIC by cleavage with SspI endonuclease, purification by agarose gel electrophoresis, and treatment with T4 DNA polymerase in the presence of dGTP. Fifteen micrograms of vector DNA, purified with a Qiagen Plasmid Midi kit (Qiagen, Valencia, CA), were incubated with 75 U high concentration SspI (New England Biolabs) at 37 °C for 2 h in a reaction volume of 60 μl, then purified following agarose gel electrophoresis using a QiaEx II gel extraction kit. The material was then treated with 40 U LIC-qualified T4 DNA polymerase (Novagen, Madison, WI) and 2.5 mM dGTP in a volume of 40 μl in 1× commercial buffer supplemented with 5 mM DTT. Genes were amplified by PCR with primers encoding the LIC overhang [13] (sense: TACTTCCAATCCAATGCX followed by the genes’ N-terminal sequences; antisense: TTATCCACTTCCAATG followed by the complement of a stop codon and of the C-terminus of the gene), purified with a QIAQuick PCR purification kit (Qiagen), and treated with T4 polymerase as described above except in the presence of dCTP. Following annealing of 30–50 ng of this material with 15 ng LIC-prepared vector, the resulting plasmids were transformed into DH5α, and plasmids prepared from these transformants were introduced into BL21(DE3) containing the plasmid pRK1037 [15] (Science Reagents, Inc.). Transformants were isolated on LB plates containing 100 μg/ml ampicillin and 30 μg/ml kanamycin.

Expression and analysis of solubility

Cultures were grown at 37° in LB containing ampicillin and kanamycin (100 μg/μl and 30 μg/μl, respectively) to an OD600 of 0.5 at which time the temperature was dropped to 20 °C and protein synthesis was induced by addition of 1 mM IPTG. Cells were harvested the next morning, suspended in 0.1 M Tris/HCl, pH 8.0, incubated with lysozyme and DNase (rLysonase and Benzonase, respectively, Promega) for 30 min at room temperature, frozen briefly, then sonicated. Following centrifugation at 6000g for 15 min, the soluble and insoluble fractions were analyzed for protein by denaturing gel electrophoresis.

Production of selenomethionyl proteins in non-sterile enriched minimal medium in 2-liter plastic bottles

Selenomethionyl proteins were produced in BL21(DE3)—a strain not auxotrophic for methionine—using feedback inhibition of methionine biosynthesis [18,19]. Cultures were grown in 2-liter polyethylene terephthalate beverage bottles [20,21] containing one liter of non-sterile M9 salts supplemented with glucose, glycerol, amino acids, trace metals and vitamins to increase the cell yield [2225]. Amendments were, per liter: glycerol, 5 g; glucose, 4.4 g; non-inhibitory amino acids (L-glutamate, L-aspartate, L-arginine, L-histidine, L-alanine, L-proline, L-glycine, L-serine, L-glutamine, L-asparagine, and L-trypto-phan), 200 mg each; trace metal mixture (EDTA, 5 mg; MgCl·6H2O, 430 mg; MnSO4 · H2O, 5 mg; NaCl, 10 mg; FeSO4 · 7H2O, 1 mg; Co(NO3)2 · 6H2O, 1 mg; CaCl2, 11 mg; ZnSO4 · 7H2O, 1 mg; CuSO4 · 5H2O, 0.1 mg; AlK(SO4)2, 0.1 mg; H3BO3, 0.1 mg; Na2MoO4 · 2H2O, 0.1 mg; Na2SeO3, 0.01 mg; Na2WO4 · 2H2O, 0.1 mg; NiCl2 · 6H2O, 0.2 mg); ampicillin, 50 mg; kanamycin, 30 mg; thiamine 1 μg; and vitamin B12, 2.7 μg. Media components other than glycerol were supplied as aliquots of mixed solids in foil packets or as concentrated stock solutions by Medicillin, Chicago, IL (catalog numbers MD045004A, MD045004B, MD045004C, and MD045004E). Cultures were grown at 37 °C to an OD600 1 – 2, when inhibitory amino acids (25 mg each of L-valine, L-isoleucine, L-leucine, L-lysine, L-threonine, L-phenylalanine, and 15 mg of selenomethionine; Medicillin, Catalog No. MD045004D) and 1 mM isopropylthio-β-D-galactoside (IPTG) were added, and the temperature dropped to 20 °C. Cultures were incubated overnight, harvested the next morning, suspended in lysis buffer (50 mM Hepes, pH 7.8, containing 500 mM NaCl, 10 mM imidazole, 10 mM β-mercaptoethanol, and 5% glycerol), and lysed by sonication. Proteins were purified by established protocols [6].

Results

Salvaging poorly soluble proteins through MBP fusions—pMCSG9

Insertion of the gene encoding MBP, amplified by PCR from the vector pRK739 [17], into the leader sequence encoding region of pMCSG7 gave pMCSG9 (Fig. 1, Materials and methods). Resulting plasmids were screened for orientation and expression of a protein of the expected molecular weight of his-tagged MBP (the product of the vector before introduction of a target gene), and the sequence of the MBP gene and surrounding expression region was verified by DNA sequencing. During restriction analysis, we also discovered that a portion of the vector near the ApR gene was larger than anticipated, both in pMCSG9 and its parent, pMCSG7. Sequencing of this region revealed that a mutation in one of the SspI sites that were removed from the parent of pMCSG7, pET21a, during its construction resulted in retention of 129 additional bases of the parental vector. The mutation and retained bases appear not to affect expression of cloned genes: over 2000 proteins have been produced in good yield from pMCSG7, leading to the deposition of over 200 structures in the Protein Data Bank. Vector sequences are available at http://www.bio.anl.gov/terrestrialr/microbiology1.html.

As expected [9,10], fusion to MBP effectively enhanced the solubility of poorly soluble bacterial proteins. PCR products encoding 134 S. typhimurium proteins that were poorly soluble when produced from pMCSG7 were introduced into pMCSG9 and reevaluated (Table 2). These proteins were originally scored as poorly soluble (Solubility Score 1) when screened by robotic protocols [26]. Proteins in this category are visible on gels but only at an abundance similar to host proteins, and normally are not carried forward to purification in the structure determination pipeline. Fusion to MBP effectively redistributed these proteins in the spectrum of solubility scores, some appearing to become less soluble, but more improving in solubility (Table 2). Sixty-four of the proteins (46%) were improved to Solubility Score 2 or 3 (soluble or highly soluble, respectively) by fusion to MBP. Proteins of Solubility Score 2 are clearly visible on gels in amounts greater than host proteins, and those of Solubility Score 3 are abundant, at far higher amounts than host proteins. Proteins in these categories routinely proceed to purification. These results substantiate, with a large data set, the anticipated effectiveness of MBP in salvaging poorly soluble proteins and allowing them to reenter the purification pipeline. However, we found that proteins produced from pMCSG9 failed to give target protein of sufficient purity to proceed to crystallization trials after purification by semi-automated protocols that were highly effective for soluble his6-tagged proteins [6]. In general, a minimum of 10 mg of protein of at least 95% purity is required. None of 38 poorly soluble proteins that were made soluble by fusion to MBP satisfied these criteria, either due to precipitation after removal of MBP or failure of the second subtractive IMAC to remove completely the stoichiometric amount of his6-tagged MBP generated by TEV protease cleavage.

Table 2
Effect of fusion to MBP on the solubility of 134 proteins in robotic screening

In vivo cleavage to release untagged MBP from fusion proteins—pMCSG19

Rather than adapt screening and purification protocols to accommodate these limitations of MBP fusion proteins produced from pMCSG9, we modified the expression vector to bypass them. Strategies developed by Waugh and colleagues [14,15] were adapted to design pMCSG19 (Fig. 1, Table 1). To construct the vector, we replaced the region of pMCSG7 encoding the N-terminal his6-tag with a region encoding MBP, a protease site, and a his6-tag (Materials and methods). Sequencing of the resulting construct verified the sequence of the amplified fragment and surrounding components of the expression region. Expression of genes introduced into pMCSG19 by LIC generates target proteins fused to an N-terminal leader of untagged MBP followed, in order, by a TVMV protease recognition sequence, a his-tag, and a TEV protease recognition sequence. Cleavage of these proteins with TVMV protease generates untagged MBP and a target protein with a his6–TEV-site leader identical to that produced from pMCSG7 except with an N-terminal serine instead of methionine preceding the his6-tag. If produced in cells co-expressing TVMV protease, cleavage will occur in vivo [15].

Sixteen proteins, picked at random from the original set of 38, whose solubility was improved by fusion to MBP but which failed to give pure protein after standard purification (Table 3), were used to evaluate pMCSG19. The available PCR products encoding the proteins were introduced into pMCSG19 by LIC and transformed into BL21(DE3) cells containing vector pRK1037[15]. This plasmid encodes TVMV protease under control of the PL-tetO promoter. In hosts that do not produce the Tet repressor, such as BL21(DE3), the plasmid produces TVMV protease constitutively, and proteins produced from pMCSG19 are cleaved at the TVMV site in vivo. Following induction, cells were lysed, fractionated by centrifugation, and the soluble and insoluble fractions analyzed by polyacrylamide gel electrophoresis (Fig. 2).

Fig. 2
Elimination of false positives by in vivo cleavage by TVMV protease. Soluble (A) and insoluble (B) fractions prepared from cells producing proteins from pMCSG19 in the presence of pRK1037. Genes encoding 16 poorly soluble proteins that were rendered soluble ...
Table 3
Proteins expressed in pMCSG19

The predominant protein present in all lanes of the soluble fraction (Fig. 2A) is MBP released by TVMV cleavage. The other predominant band below the MBP band in some of the lanes is target protein that remained soluble after cleavage from MBP. Analysis of the insoluble fraction (Fig. 2B) confirmed the expression of the target protein in those cases where little or no soluble target was observed in the soluble fraction. Based only on abundance in the soluble fraction, 11 of the 16 proteins (lanes 1–4, 6, 8, 10, and 12–15) would be scored as sufficiently soluble to proceed to purification. However, the large amount of insoluble protein for the targets in lanes 6 and 8 (Fig. 2B) would disqualify them, as would the doublet for the soluble target protein in lane 10. The remaining eight proteins were produced on a large scale and purified (see below). In summary, only half of these target proteins were deemed satisfactory for purification; the others represent false positives that were previously scored as satisfactory based on analysis of the his6–MBP fusion proteins generated from pMCSG9. The MBP–his6-target fusion proteins generated by pMCSG19 were also soluble (data not shown). Thus, in vivo cleavage of proteins produced from pMCSG19 effectively eliminated false positives without addition of a protease cleavage step to the screening protocols.

In those cases where fusion to MBP truly improved a protein’s solubility, the his6–MBP leader attached by production from pMCSG9 compromised purification by protocols that were highly effective for simple his6-tagged proteins. Proteolytic cleavage with TEV generated a stoichiometric amount of his6–MBP, which consistently failed to bind well to the second, subtractive IMAC of standard protocols, as illustrated in the purification of a representative target protein (Fig. 3A). For proteins produced from pMCSG9, the first IMAC yields the partially purified his6–MBP-target fusion protein (Fig. 3A, lanes 1–4). Hydrolysis of this protein by TEV protease generates his6–MBP (larger protein in Fig. 3A, lane 5) and the target protein (lower band). When this material is passed through the subtractive IMAC column, his-tagged MBP fails to bind well under the standard conditions, resulting in severe contamination of the target protein in the final eluted fraction (Fig. 3A, lanes 5–7). In contrast, when proteins are produced from pMCSG19 in a host expressing TVMV protease (Fig. 3B), MBP is cleaved away from the target protein in vivo (Fig. 3B, lane 1). Because of the design of the vector, this MBP is not his-tagged, and passes through the first IMAC column (Fig. 3B, lane 2). The target protein, which is directly his-tagged, is retained, and elutes in partially purified form (Fig. 3B, lane 4). Hydroylsis of this protein with TEV protease and subtractive IMAC chromatography generates target protein of sufficient purity to initiate crystallization trials (Fig. 3B, lanes 5–7). Production of proteins from pMCSG19 with in vivo co-expression of TVMV protease thereby resolved the purification problem without modification of protocols or addition of tertiary steps.

Fig. 3
Purification of target proteins produced from pMCSG9 and pMCSG19. A representative purification by standardized purification protocols [6] of APC25420 produced from (A) pMCSG9, and (B) pMCSG19. In both cases, numbered lanes contain (1) cell extract, (2–4) ...

Production of selenomethionyl proteins from pMCSG19

Selenomethionyl derivatives of soluble proteins were produced by culturing cells in 2-liter polyethylene terephthalate beverage bottles [20] in 1 liter of non-sterile M9 salts supplemented with additional nutrients (Materials and methods). The medium and conditions were identical to those described previously [21] but with the addition of glycerol, non-inhibitory amino acids, trace metals and vitamins [18,2225] to improve the yield of cells. Under these conditions, cell yields were two- to three-fold higher compared to those attained in unsupplemented medium, typically generating OD600 values of 4–12, depending on the protein expressed, with no detriment to expression or in vivo cleavage. Fig. 4 shows the partial purification of three proteins through the first IMAC step and is representative of the strong expression, efficient cleavage by co-expressed TVMV protease, and complete removal of MBP typically obtained. The three proteins were further purified by subtractive IMAC to remove trace Escherichia coli proteins [6], and analyzed for selenomethionine incorporation. Amino acid analysis failed to detect methionine in any of the three proteins, consistent with selenomethionine incorporation of 90% or more [21]. Yields per liter of purified target proteins produced in the amended medium were consistently two-fold or more higher than those obtained from unamended medium, allowing production of sufficient protein for crystallization trials from a single bottle, halving the number of cultures required to produce each protein. The eight soluble target proteins were produced on a large scale as their selenomethionyl derivatives and purified. Six generated greater than 10 mg of protein of greater than 95% purity (average yield for these 6 was 39 mg per liter of culture, range 14–84 mg). These were carried forward to crystallization trials; two gave crystals, and one was solved.

Fig. 4
Expression and partial purification of selenomethionyl proteins. Partial purification by Ni-IMAC of selenomethionyl proteins produced from pMCSG19 in enriched medium supplemented with selenomethionine (see Materials and methods) with in vivo cleavage ...

Discussion

Because many studies support the effectiveness of fusion to MBP for improving the solubility of proteins [24,9,10], we assessed the potential of using MBP fusions as a salvage pathway for poorly soluble proteins in a high-throughput protein production pipeline. A large set of S. typhimurium proteins that were poorly soluble when expressed with a simple his6-tag was re-evaluated as MBP fusions (Table 2). Fusion to MBP in effect redistributed the proteins in the spectrum of solubility, generating a spread from completely insoluble to highly soluble fusion proteins, but with a strong bias toward improved solubility. Of the 134 proteins, only 28 (20%) became less soluble as MBP fusions, whereas the solubility of 62 (45%) improved upon fusion to MBP. Twenty-six proteins (19%) were deemed highly soluble and 36 (26%), moderately soluble based on the intensity of bands in protein gels of the soluble fraction of lysates. purification of proteins in these two categories by standard protocols is considered likely to produce greater than 10 mg of pure protein (the amount needed for crystallization screening trials) and they, therefore, are passed forward into the labor-intensive large-scale purification phase of the pipeline. The results obtained from these 134 proteins justify incorporation of MBP fusions into high-throughput screening and purification pipelines for salvaging poorly soluble proteins.

The apparent solubility of proteins attached to MBP, however, was often transitory; in these cases, proteolytic removal of MBP resulted in aggregation or precipitation of the target protein. The large, highly soluble MBP protein apparently allowed intrinsically insoluble proteins to partition into the soluble fraction as long as they remain linked to MBP. If carried forward to purification protocols designed for truly soluble proteins, such proteins will fail to give enough pure material for structural or functional characterization, resulting in considerable wasted time and effort. Evaluation of solubility after proteolysis could detect false positives of this sort, but would require an additional step in screening protocols. For target proteins expressed from pMCSG19, in vivo removal of MBP by co-expressed TVMV protease effectively eliminated these false positives (Fig. 2). Of sixteen proteins, all of which were soluble as MBP fusions, only about half remained soluble after in vivo removal of MBP (Fig. 2A). The intensity of the target protein band (seen below the predominant band of MBP in all lanes) suggested eleven were rendered sufficiently soluble by transitory fusion to MBP (Solubility Score 2 or 3, see Table 2), but analysis of the insoluble fraction (Fig. 2B) provided additional insight into the suitability of the proteins for purification. The large amount of insoluble target protein in lanes 6 and 8 suggested these proteins would be more prone to aggregation and precipitation during processing, causing them to be rejected, as was the target in lane 10 because it produced a doublet. Purification of the remaining eight proteins supported the utility of evaluating the insoluble fraction as well as the soluble. Six of these proteins yielded enough pure protein to pass on to crystallization trials, but those that failed had partitioned evenly between the soluble and insoluble fractions in the solubility analysis (lanes 3 and 4 of Fig. 2). Of the six that entered crystallization trials, two crystallized, and one was solved. Whereas this data set is clearly too small to measure the effectiveness of pMSCG19 precisely, it strongly supports the potential utility of the vector in a salvage pathway for poorly soluble target proteins.

A second complication arose during purification of his6–MBP-tagged proteins derived from pMCSG9. The stoichiometric amount of his6–MBP produced by TEV protease cleavage of the fusion proteins was not removed effectively by the second, subtractive IMAC column of standard purification protocols, resulting in contamination of the final product with his6–MBP (Fig. 3). Altered or additional purification steps, such as gradient elution, use of larger columns, or subsequent ion-exchange or gel-filtration steps, successfully separated target proteins from his-tagged MBP, but each approach seriously disrupted the general laboratory workflow and increased the effort required to purify the individual proteins. Vector pMCSG19 eliminates his-tagged MBP by placing a second highly specific protease cleavage site, the TVMV-site, between an N-terminal, untagged MBP and the his-tag, which is followed by the standard TEV protease cleavage site (Fig. 1). Combined with in vivo cleavage at the TVMV site by co-expressed TVMV protease, pMCSG19 generates untagged MBP plus a simple his6-tagged target protein identical to that produced from pMCSG7 except for the presence of an N-terminal serine instead of methionine. During standard purification, the untagged MBP passes through the initial IMAC column unretarded. The stoichiometric ‘contaminant’ is thus removed efficiently, and subsequent steps of the purification are identical to those used for simple his6-tagged targets produced from pMCSG7.

Use of pMCSG19 and in vivo cleavage with TVMV protease provides a satisfactory system for producing most target proteins via a very streamlined screening and purification pipeline. The validation experiments described here were limited to small (<40 kDa) bacterial proteins, but are sufficiently compelling to justify the use of pMCSG19 in standard production protocols. Accordingly, we have initiated routine salvaging of poorly soluble proteins by reprocessing in pMCSG19. The approach represents an additional application of in vivo cleavage by highly specific proteases [14,15], and the strategy of incorporating a second high-specificity protease cleavage site to remove an untagged chaperone component in vivo could be of value in other protein production pipelines. Time and effort that might have been spent pursuing false positives or performing additional screening or purification steps can be spent on other crucial tasks. The process is also fully compatible with production of selenomethionyl derivatives for crystallography. High yields of target proteins with very efficient incorporation of selenomethionine were obtained in enriched defined medium using a non-auxotrophic host and commercially available, premixed medium components. For the six proteins successfully purified, the average yield was 39 mg per liter of culture. Such high-yields and incorporation can be obtained as well in similar production media employing autoinduction and incorporating isotopically labeled amino acids for nuclear magnetic resonance experiments [2325]. In addition to the application described here, highly enriched defined media and vectors of the general configuration, tag1-site1-tag2-site2-protein, could be exploited for other purposes, including functional analyses of proteins.

Acknowledgments

We thank David Waugh for providing plasmids pRK793, pRK1035, and pRK1037, and for an informative web site (http://mcl1.ncifcrf.gov/waugh_tech.html). We also thank Pearl Quartey, Jerzy Osipiuk, Lour Volkart, and Hui Li for feedback on purifications of proteins, and Debbie Hanson, Phil Laible, and Marianne Schiffer for comments on the manuscript. Analysis of selenomethionine incorporation was carried out by Yale University’s HHMI Keck Laboratories, and DNA sequencing by the University of Chicago Cancer Research Center’s DNA Sequencing Facility. This work was supported by the National Institutes of Health Grant GM62414-01 and by the US Department of Energy, Office of Science, Office of Biological and Environmental Research, under contract W-31-109-Eng-38.

Footnotes

[star]This manuscript has been created by the University of Chicago as operator of Argonne National Laboratory under Contract No. W-31-109-ENG-38 with the US Department of Energy. The US government retains for itself, and others acting on its behalf, a paid-up, nonexclusive, irrevocable worldwide license in said article to reproduce, prepare derivative works, distribute copies to the public, and perform publicly and display publicly, by or on behalf of the government. The US Government’s right to retain a nonexclusive royalty-free license in and to the copyright covering this paper, for governmental purposes, is acknowledged.

References

[1] DiDonato M, Deacon AM, Klock HE, McMullan D, Lesley SA. A scaleable and integrated crystallization pipeline applied to mining the Thermotoga maritima proteome. J. Struct. Funct. Genomics. 2004;5:133–146. [PubMed]
[2] Braun P, Hu Y, Shen B, Halleck A, Koundinya M, Harlow E, LaBaer J. Proteome-scale purification of human proteins from bacteria. Proc. Natl. Acad. Sci. USA. 2002;99:2654–2659. [PMC free article] [PubMed]
[3] Dyson MR, Shadbolt SP, Vincent KJ, Perera RL, McCafferty J. Production of soluble mammalian proteins in Escherichia coli: identification of protein features that correlate with successful expression. BMC Biotechnol. 2004;4:32. [PMC free article] [PubMed]
[4] Jeon WB, Aceti DJ, Bingman CA, Vojtik FC, Olson AC, Ellefson JM, McCombs JE, Sreenath HK, Blommel PG, Seder KD, Burns BT, Geetha HV, Harms AC, Sabat G, Sussman MR, Fox BG, Phillips GN., Jr. High-throughput purification and quality assurance of Arabidopsis thaliana proteins for eukaryotic structural genomics. J. Struct. Funct. Genomics. 2004;5 [PubMed]
[5] Yee A, Pardee K, Christendat D, Savchenko A, Edwards AM, Arrowsmith CH. Structural proteomics: toward high-throughput Structural biology as a tool in functional genomics. Acc. Chem. Res. 2003;36:183–189. [PubMed]
[6] Kim Y, Dementieva I, Zhou M, Wu R, Lezondra L, Quartey P, Joachimiak G, Korolev O, Li H, Joachimiak A. Automation of protein purification for structural genomics. J. Struct. Funct. Genomics. 2004;5:111–118. [PMC free article] [PubMed]
[7] Braun P, LaBaer J. High throughput protein production for functional proteomics. Trends Biotechnol. 2003;21:383–388. [PubMed]
[8] Porath J. Immobilized metal ion affinity chromatography. Protein Expr. Purif. 1992;3:263–281. [PubMed]
[9] Fox JD, Waugh DS. Maltose-binding protein as a solubility enhancer. Methods Mol. Biol. 2003;205:99–117. [PubMed]
[10] Kapust RB, Waugh DS. Escherichia coli maltose-binding protein is uncommonly effective at promoting the solubility of polypeptides to which it is fused. Protein Sci. 1999;8:1668–1674. [PMC free article] [PubMed]
[11] Dougherty WG, Carrington JC, Cary SM, Parks TD. Biochemical and mutational analysis of a plant virus polyprotein cleavage site. EMBO J. 1988;7:1281–1287. [PMC free article] [PubMed]
[12] Parks TD, Leuther KK, Howard ED, Johnston SA, Dougherty WG. Release of proteins and peptides from fusion proteins using a recombinant plant virus proteinase. Anal. Biochem. 1994;216:413–417. [PubMed]
[13] Stols L, Gu M, Dieckman L, Raffen R, Collart FR, Donnelly MI. A new vector for high-throughput, ligation-independent cloning encoding a tobacco etch virus protease cleavage site. Protein Expr. Purif. 2002;25:8–15. [PubMed]
[14] Kapust RB, Waugh DS. Controlled intracellular processing of fusion proteins by TEV protease. Protein Expr. Purif. 2000;19:312–318. [PubMed]
[15] Nallamsetty S, Kapust RB, Tozser J, Cherry S, Tropea JE, Copeland TD, Waugh DS. Efficient site-specific processing of fusion proteins by tobacco vein mottling virus protease in vivo and in vitro. Protein Expr. Purif. 2004;38:108–115. [PubMed]
[16] Yoon HY, Hwang DC, Choi KY, Song BD. Proteolytic processing of oligopeptides containing the target sequences by the recombinant tobacco vein mottling virus NIa proteinase. Mol. Cells. 2000;10:213–219. [PubMed]
[17] Kapust RB, Tozser J, Fox JD, Anderson DE, Cherry S, Copeland TD, Waugh DS. Tobacco etch virus protease: mechanism of autolysis and rational design of stable mutants with wild-type catalytic proficiency. Protein Eng. 2001;14:993–1000. [PubMed]
[18] Doublie S. Preparation of selenomethionyl proteins for phase determination. Methods Enzymol. 1997;276:523–530. [PubMed]
[19] Van Duyne GD, Standaert RF, Karplus PA, Schreiber SL, Clardy J. Atomic structures of the human immunophilin FKBP-12 complexes with FK506 and rapamycin. J. Mol. Biol. 1993;229:105–124. [PubMed]
[20] Millard CS, Stols L, Quartey P, Kim Y, Dementieva I, Donnelly MI. A less laborious approach to the high-throughput production of recombinant proteins in Escherichia coli using 2-liter plastic bottles. Protein Expr. Purif. 2003;29:311–320. [PubMed]
[21] Stols L, Millard CS, Dementieva I, Donnelly MI. Production of selenomethionine-labeled proteins in two-liter plastic bottles for structure determination. J. Struct. Funct. Genomics. 2004;5:95–102. [PubMed]
[22] Whitman WB, Ankwanda E, Wolfe RS. Nutrition and carbon metabolism of Methanococcus voltae. J. Bacteriol. 1982;149:852–863. [PMC free article] [PubMed]
[23] Studier FW. Protein production by auto-induction in high density shaking cultures. Protein Expr. Purif. 2005;41:207–234. [PubMed]
[24] Tyler RC, Sreenath HK, Singh S, Aceti DJ, Bingman CA, Markley JL, Fox BG. Auto-induction medium for the production of [U-15N]- and [U-13C, U-15N]-labeled proteins for NMR screening and structure determination. Protein Expr. Purif. 2005;40:268–278. [PubMed]
[25] Sreenath HK, Bingman CA, Buchan BW, Seder KD, Burns BT, Geetha HV, Jeon WB, Vojtik FC, Aceti DJ, Frederick RO, Phillips GN, Jr., Fox BG. Protocols for production of selenomethionine-labeled proteins in 2-L polyethylene terephthalate bottles using auto-induction medium. Protein Expr. Purif. 2005;40:256–267. [PubMed]
[26] Moy S, Dieckman L, Schiffer M, Maltsev N, Yu GX, Collart FR. Genome-scale expression of proteins from Bacillus subtilis. J. Struct. Funct. Genomics. 2004;5:103–109. [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...