Logo of wtpaEurope PMCEurope PMC Funders GroupSubmit a Manuscript
Oncogene. Author manuscript; available in PMC May 19, 2010.
Published in final edited form as:
PMCID: PMC2789334
EMSID: UKMS27838

The NRG1 gene is frequently silenced by methylation in breast cancers and is a strong candidate for the 8p tumour suppressor gene

Abstract

Neuregulin-1 (NRG1) is both a candidate oncogene and candidate tumour suppressor gene. It encodes the heregulins and other mitogenic ligands for the ERBB family, but it also causes apoptosis in NRG1-expressing cells. We found that most breast cancer cell lines had reduced or undetectable expression of NRG1. This included cell lines that had translocation breaks in the gene. Similarly, expression in cancers was generally comparable to or less than various normal breast samples. Many non-expressing cell lines had extensive methylation of the CpG island at the principal transcription start site at exon 2 of NRG1. Expression was reactivated by demethylation. Many tumours also showed methylation, while normal mammary epithelial fragments had none. Lower NRG1 expression correlated with higher methylation. siRNA-mediated depletion of NRG1 increased net proliferation, in a normal breast cell line and a breast cancer cell line that expressed NRG1. The short arm of chromosome 8 is frequently lost in epithelial cancers, and NRG1 is the most centromeric gene that is always affected. NRG1 may therefore be the major tumour suppressor gene postulated to be on 8p: it is in the correct location, is anti-proliferative, and is silenced in many breast cancers.

Keywords: breast cancer, NRG1, heregulins, DNA methylation, tumour suppressor gene, chromosome rearrangement

Introduction

The NRG1 (neuregulin-1) gene has been proposed both as a candidate oncogene and a candidate tumour suppressor gene. It seems likely to play a role in epithelial cancers, since it encodes ligands that bind to the ERBB/HER/EGFR family of receptors. These ligands, originally known as the heregulins alpha and beta, neu differentiation factor/NDF, SMDF and glial growth factor II, are made by alternative splicing, and include forms that are transmembrane, externally membrane-bound, shed, secreted or intracellular (Falls, 2003; Hayes & Gullick, 2008). They bind to ERBB3 or ERBB4, which probably signal as heterodimers with ERBB2 (HER2).

Although the NRG1-encoded proteins are usually thought of as mitogens, they can also be powerfully pro-apoptotic: in particular, expressing NRG1 in cells can cause apoptosis of the expressing cell (Weinstein et al., 1998).

The NRG1 gene has been identified as a potential cancer-critical gene in two, apparently contradictory, contexts. Firstly, it is the prime candidate for the major tumour suppressor gene thought to be on 8p, the short arm of chromosome 8. Loss of 8p is one of the most frequent genomic events in epithelial cancers, including breast, colon, bladder and prostate. This has been shown successively by loss of heterozygosity (LOH), comparative genomic hybridization (CGH) and array-CGH studies (for references see Birnbaum et al., 2003; Pole et al., 2006). The classical interpretation of this loss of 8p would be that there is a tumour suppressor gene there. We previously mapped the 8p losses in carcinoma cell lines by fluorescence-in situ hybridization (FISH) and array-comparative genomic hybridization (array-CGH) and found that almost all breaks were proximal to, or actually within NRG1, making NRG1 and genes immediately telomeric to NRG1 the prime candidates for such a tumour suppressor (Pole et al., 2006; Cooke et al., 2008).

Secondly, NRG1 could be an oncogene because it appears to be the target of chromosome translocations in breast cancer. In the breast cancer cell line MDAMB-175, a translocation has fused the 3′ end of NRG1, including the receptor-binding domain, downstream of ODZ4/DOC4, creating a secreted protein with biological activity (Schaefer et al., 1997; Wang et al., 1999; Liu et al., 1999). We and others showed that there are breakpoints within NRG1 in a number of other breast cancer cell lines and in around 6% of breast tumours, all preserving the 3′ end of the gene (Adélaïde et al., 2003; Huang et al., 2004; Prentice et al., 2005). One interpretation of this is that NRG1 is activated by fusion or promoter insertion. However, other explanations have been suggested (see Discussion; Weinstein & Leder, 2000; Birnbaum et al., 2003; Prentice et al., 2005).

We set out to investigate the role of NRG1 in breast cancer, beginning by measuring expression of NRG1 in normal breast and breast cancers.

Results

NRG1 transcription start sites and exon usage in breast

To quantitate expression of NRG1, which has many alternative splice forms (Figure 1a; Falls, 2003), preliminary RT-PCR experiments (not shown) were carried out, to find which of the three main transcription start sites were used in the cell lines, and whether there were major variations in exon usage. These experiments showed that, generally, where a cell line expressed any NRG1, all exons tested were expressed, except exon 1. This implied that the exon 1 transcription start site was not used in these samples and transcription was from the start sites in exon 2 and exon 7 (Figure 1a). Also, the pattern of exon usage was rather similar across the samples. This allowed us to broadly quantitate NRG1 expression using a single PCR primer pair that spanned exons 4 to 6, which are in almost all transcripts initiated in exon 2.

Figure 1
Expression and CpG methylation of NRG1 in cell lines.

One exception requires comment. In MDA-MB-175, expression of all exons except exons 1 and 2 was detected. This line expresses a fusion of NRG1 that splices in at exon 3. Although the fusion cDNA that was originally described lacked the transmembrane and cytoplasmic domains (Schaefer et al., 1997), we detected all the 3′ exons that we tested for, so the fusion gene expresses alternative isoforms including the intracellular domains, as also found by Adélaïde et al. (2003).

Expression of NRG1 is low in breast cancers

Quantitative PCR using the primer pair spanning exons 4 to 6 showed that many breast cancer cell lines expressed little or no NRG1 (Figure 1b), while normal mammary epithelium, both as cell lines (Figure 1) and cells (see below), did express NRG1. Similar results were obtained with a primer pair in exon 8, which encodes the receptor-binding domain and is included in almost all isoforms, but is short and a poor target for PCR (Supplementary Figure 1a).

Western blotting was consistent with the mRNA expression data: a single major band of ~75 kDa was seen in the normal breast cell line HB4a and cancer lines that showed substantial mRNA expression (Supplementary Figure 1b), while no band was detected in T-47D, a representative line that expressed no mRNA. 75 KDa is the expected size for intact heregulins (see e.g. Deadwyler et al., 2000), all of which are expressed from exon 2.

A similar pattern was seen when NRG1 mRNA expression was measured in breast tumour samples, and cells and tissue from normal breast (Figure 2a). The highest expression was seen in purified myoepithelial cells and normal breast epithelial ‘organoids’, i.e. intact, uncultured epithelial fragments made up of both myoepithelial and luminal epithelial cells, isolated by collagenase digestion of breast tissue (Edwards et al., 1986). Purified luminal cells and commercial RNA from long-term primary cultures expressed less. Among the tumours, three of six samples of purified tumour cells from pleural or ascitic effusions showed essentially no expression. Tumour tissue samples showed a range of expression, mostly equal to or less than the normal samples, with 25% of the 58 samples expressing less than any of the normal samples. Some of this expression may well be from stromal cells, which are typically 30% or more of the cells present, so it is possible that many of the tumours have lost expression of NRG1, as for the cell lines.

Figure 2
NRG1 expression and DNA methylation in tumour and normal breast.

The CpG Island in NRG1 is methylated in breast cancer cell lines

We therefore investigated whether NRG1 expression might be silenced by DNA methylation. Bisulphite sequencing analysis of the CpG island around the exon 2 transcription start site (Figure 1a) showed that it was heavily methylated in 10 of 19 (53%) breast cancer cell lines tested, while the remaining lines and the non-cancer breast cell lines HB4A and HMT-3552 showed little methylation (Figure 1c).

Methylation correlated closely with an absence of NRG1 transcripts (Figure 1b, c). The ten breast cancer cell lines with methylation showed no expression, while the lines that have NRG1 transcripts had low DNA methylation. A further small group of breast cancer cell lines, MDA-MB-157, UACC 812, HCC 1187 and SUM52, lacked NRG1 transcripts and had low DNA methylation at the CpG island, suggesting that NRG1 can also be inactivated by mechanisms other than DNA methylation.

Azacytidine treatment

Two cell lines that had heavy CpG island methylation, HCC 1500 and MDA-MB-361, were treated with the demethylating agent 5-aza-2′-deoxycytidine. Treatment activated transcription of NRG1 (Supplementary Figure 2).

NRG1 is methylated in tumours but not in normal breast tissue

To quantitate methylation in a panel of tissue samples, we used pyrosequencing of bisulphite-treated DNA (Yang et al., 2004). A 29-bp sequence was selected from the CpG island (Figure 1a) that included six CpGs that were always methylated in breast cancer cell lines that showed methylation, but were unmethylated in non-cancer breast lines (Figure 1c).

No DNA methylation at NRG1 was detected in uncultured, normal breast epithelium (Figure 2b), obtained in the form of ‘organoids’.

In contrast, many tumours showed substantial DNA methylation of the 29-bp sequence, half the 59 tumour tissue samples averaging 24% or more methylation (Figure 2b). Average methylation ranged from 0 to 60%, the upper limit of 60% presumably reflecting the presence of normal cells in the samples. To attempt to address this, purified tumour cells from six pleural or ascitic effusions were also analysed (Figure 2b). One pleural effusion sample showed substantial methylation, averaging about 40% over the pyrosequenced CpGs.

When methylation of this six-CpG sequence was compared with expression of NRG1, there was a trend to decrease in NRG1 expression with increase in DNA methylation (Figure 2c). More precisely, Figure 2c suggests that, as for the cell lines, some tumours have NRG1 expression reduced by methylation, while others have NRG1 silenced by other mechanisms. The latter group would be those with low expression but little or no methylation (circled in Figure 2c). If these cases were set aside, the correlation between lower expression and increasing methylation was clear and highly significant.

Since NRG1 may be a tumour suppressor that is inactivated by a two-hit mechanism, with one hit often being loss of distal 8p, it was interesting to divide the tumours according to whether they had lost 8p, using existing array-CGH data (Chin et al., 2007). There was no profound difference in expression and methylation between the tumours with and without 8p loss, but the 18 tumours with 8p loss showed a tighter correlation between expression and methylation, provided the outlier group were excluded (Figure 2c).

Knockdown of NRG1 can increase net cell proliferation

These observations suggested that down-regulating NRG1 expression in mammary epithelial cells might give cells a survival advantage. We reduced NRG1 expression by stable expression of siRNA constructs in the normal breast luminal epithelial cell line HB4a and in HCC1806, a breast cancer cell line that expresses a relatively high level of NRG1, comparable to HB4a (Figure 1b). Multiple siRNA constructs were designed, giving three independent siRNA treatments for HB4a and two treatments for HCC1806.

Net proliferation was modestly but consistently increased, independent of the siRNA construct used, even though only a modest reduction of expression was seen (Figure 3). This result together with the methylation data suggests that NRG1 acts as a tumour suppressor.

Figure 3
Net cell proliferation is enhanced by knockdown of NRG1. Two cell lines that express NRG1 were stably transfected with various siRNA constructs, resulting in a modest reduction in mRNA, typically around 50%. a downregulation of NRG1 expression monitored ...

Expression of receptors for NRG1

To aid interpretation of our NRG1 data, we also measured expression of ERBB2, ERBB3 and ERBB4 in our cell line panel (Supplementary Figure 3). There was a strong negative association between NRG1 expression and high ERBB-family expression (Figure 4): the few breast cell lines with near-normal or raised NRG1 expression had low or negligible expression of ERBB2, ERBB3 and ERBB4, while the lines that showed high expression of any ERBB gene expressed little or no NRG1. The lines that did express some NRG1 together with raised ERBB2, ERBB3 and/or ERBB4 were HCC1806, MDA-MB-175, HCC1937 and ZR-75-1, all of which have breaks in NRG1, and CAMA-1, for which the genomic structure of NRG1 is not known.

Figure 4
Expression of ERBB2, ERBB3 and ERBB4 compared to expression of NRG1. As in Figure 1, expression levels were measured by real-time RT-PCR and are shown on a linear scale relative to expression in normal breast line HB4a, except for ERBB3, where expression ...

Discussion

Our findings suggest that NRG1 is frequently inactivated in breast cancer and behaves as a tumour suppressor. NRG1 was expressed in normal human breast, by both luminal and myoepithelial cells, while in many breast cancer cell lines there was little or no expression. Absence of expression was often associated with DNA methylation of the CpG island at the principal transcription start site for NRG1 in cell lines, and most tumours also showed DNA methylation. Reducing NRG1 expression in cell lines increased net cell proliferation. Others have shown that expressing NRG1 in a breast cancer cell line by transfection causes apoptosis (Weinstein et al., 1998).

NRG1 in normal breast

We found that both luminal and basal/myoepithelial cells in non-pregnant human breast epithelium express NRG1. Previous data on NRG1 expression in normal mammary gland do not give a clear picture. In mouse, Yang et al. (1995) reported that the NRG1 isoform heregulin-alpha was expressed by the stroma in late pregnancy, implying that there was little expression in the epithelium, particularly in non-pregnant epithelium. However, Schaefer et al. (1997) reported expression from normal human breast tissue (and absence in several breast cancer cell lines), and Aguilar et al. (1999) and Adélaïde et al. (2003) reported expression of NRG1 mRNA in cultured normal human mammary epithelial cells, which are likely to be predominantly basal/myoepithelial cells (Clarke et al., 2005).

In vivo experiments on the role of NRG1 in mouse mammary gland seem to have neglected the resting mammary gland (Britsch, 2007). Attention has been focussed on heregulin alpha’s critical role in late pregnancy and lactation, already mentioned (Yang et al., 1995). This is supported by several findings: the activated rat ERBB2, neuT, when introduced into mammary epithelium caused development of clusters of alveolar-like structures (Bradbury et al., 1993); heregulin implants in the gland stimulated duct branching (Jones et al., 1996), and a knockout mouse with a stop codon in exon 9 of NRG1, preventing translation of alpha isoforms, had retarded lactational development (Li et al., 2002).

One proposed role for NRG1 in epithelia in general, consistent with it being implicated in cancer development, is as a mediator of wound-healing (Vermeer et al., 2003). At least in human airway epithelium, NRG1 protein is produced at the apical face of the polarised epithelium while its receptor(s) are basolateral, so that NRG1 signalling would indicate breaching of the epithelium (Vermeer et al., 2003). Histology shows that malignant epithelium is often, perhaps always, defective in the ability to restore a single, intact epithelial surface, implying a defect in wound-healing.

The significance of translocation breakpoints in NRG1

One postulated role for NRG1 was as an oncogene activated by chromosome translocation in breast cancers. Our data do not in general support this. As noted in the Introduction, about 6% of breast tumours have translocations or other genome rearrangements with breakpoints within NRG1, retaining the 3′ end of the gene (Huang et al., 2004), and in one cell line, MDA-MB-175, the translocation produces a fusion protein ODZ4-NRG1. This raised the possibility that NRG1 expression was activated in breast tumours by translocation. However, seven of the cell lines used here have a translocation breakpoint within NRG1 (Table 1), and they did not show increased expression: two had equivalent expression to the normals, two had substantially less, and three had no detectable expression (Table 1). The one cell line in our whole set that showed slightly increased expression compared to normal epithelium, MDA-MB-415, is not known to have a rearrangement of the NRG1 region, and no rearrangement was detected by FISH with BAC probes (not shown) or by array CGH (Pole et al., 2006). Similarly in the tumours, there was no population with dramatically increased expression.

Table 1
Summary of NRG1 status in breast cell lines

The breakpoints in NRG1 may therefore in most cases inactivate one copy of the gene. The gene is extremely large, so the prevalence of breaks within the gene is not particularly surprising (Birnbaum et al., 2003; Prentice et al., 2005).

There may of course be cases where translocation creates an abnormal, or abnormally-regulated NRG1 product. To date the MDA-MB-175 cell line is the only case with a translocation that is known to result in a fusion gene. It is not known whether the fusion product has modified activity. Weinstein & Leder (2000) suggested that it might not have the pro-apoptotic activities of wild-type NRG1, since the original cDNA clone of the fusion transcript lacked the cytoplasmic, pro-apoptotic exons. However, we and Adélaïde et al. (2003) detected expression of the cytoplasmic exons, so this specific mechanism seems unlikely.

Methylation of the NRG1 CpG island in breast cancers

Our data suggests that many breast tumours have silenced NRG1 by aberrant methylation of the CpG island. Many breast cell lines had large numbers of methylated CpGs in the CpG island at the major transcription start of NRG1. Partially removing methylation in two cell lines that expressed no NRG1 restored some expression. Breast tumours, because they contain 30% or more normal cells, give less clear data, but half showed 24% or more methylation averaged over 6 CpGs. No methylation was detected in purified, uncultured epithelium from normal breast, so no substantial population of breast epithelial cells is normally DNA-methylated at NRG1. This is consistent with a genome-wide survey of CpG island methylation in 13 normal tissues (including several epithelia but not mammary gland), which found little methylation of this CpG island except light methylation in peripheral blood cells (Rakyan et al., 2008).

An alternative interpretation might be that NRG1 is silenced by normal differentiation-specific methylation (e.g. Takizawa et al., 2001; Ching et al., 2005), in a small population of epithelial cells in mammary gland that gives rise to tumours. Mammary epithelium comprises several cell types: the outer basal/myoepithelial cells and the inner luminal cells, and there are subpopulations of luminal cell (Kalirai & Clarke, 2006). However, this would not explain why some of the breast tumour cell samples showed low NRG1 expression without any methylation. We prefer the interpretation that methylation is abnormal and is one of various ways of silencing the gene.

Breast cancer cell lines have been tentatively classified by gene expression into the subsets recognised for breast cancers: luminal-like, basal-like, etc. (Charafe-Jauffret et al, 2006; Neve et al, 2006). Most of our lines are luminal-like, but there was no obvious relationship between this classification and NRG1 expression, breakpoints within NRG1, or methylation (Table 1).

NRG1 has antiproliferative activity

Although proteins encoded by NRG1 such as the heregulins are thought of as mitogenic, they can also be strongly pro-apoptotic, particularly to the cell that expresses the gene. Leder and coworkers showed that forced expression of NRG1 causes apoptosis in various cell lines, including MCF7, a breast cancer cell line that does not express NRG1 (Weinstein et al., 1998). This is a potent activity, since they had discovered it in an unbiased screen for pro-apoptotic cDNAs in HEK293 cells, in which NRG1 was the only hit (in an incomplete screen) (Grimm & Leder, 1997). Pro-apoptotic activity was independent of ERBB-family receptors and required the C-terminus of NRG1, emphasizing that the action was on the expressing cell (Grimm et al., 1998; Weinstein et al., 1998). Exogenous NRG1 proteins can also be anti-proliferative under certain conditions (e.g. Amin et al., 2005; Muraoka-Cook et al., 2006).

Our siRNA experiments suggest a net anti-proliferative effect of NRG1 expression in our system: down-regulating NRG1 expression in two cell lines, HB4a and HCC1806, enhanced net cell proliferation. These siRNA results were likely to have been a specific effect, since it is unlikely that off-target effects would increase proliferation, and independent constructs gave similar results.

At least some of this antiproliferative signalling may be extracellular (autocrine or cell-to-cell), since there was a strong negative association between NRG1 expression and expression of ERBB2, ERBB3 and ERBB4 (Figure 4).

NRG1 could be the major tumour suppressor on 8p

The provocative interpretation of our results is that NRG1 is the long-sought tumour suppressor gene on 8p. Loss of, and/or homozygosity for, distal 8p is one of the most common genomic changes in carcinomas (see Introduction). This suggests that there is a major tumour suppressor gene on 8p, but no convincing candidate has been found (Birnbaum et al., 2003; Cooke et al., 2008). We have previously shown that the breakpoints leading to 8p loss are almost all within or proximal to NRG1, consistent with NRG1, or a gene immediately telomeric to NRG1, being a tumour suppressor gene that drives these losses (Pole et al., 2006; Cooke et al., 2008). The next most telomeric gene, WRN, is not a good candidate, although it has been reported to be methylated (Agrelo et al., 2006), since loss of WRN compromises telomere replication (Crabbe et al., 2007).

Conclusion

In conclusion, we suggest that NRG1 may be the principal tumour suppressor gene that leads to loss of 8p in many breast and other epithelial cancers. NRG1 expression seems to be silenced in most breast cancers compared to the main types of mammary epithelial cell—this could be because tumours arise from a specialised population in which NRG1 is normally silenced, but we prefer the interpretation that NRG1 is silenced by aberrant methylation or other—as yet unknown—events such as promoter mutation. Expression of NRG1 in mammary cells is anti-proliferative to the cells that express it. And array-CGH identifies NRG1 as the gene most likely to be a principal 8p tumour suppressor.

Materials and methods

Cell lines, tumours and normal breast tissue

Cancer cell lines were as described (Pole et al., 2006). The non-cancer lines were from the originators: HB4a is a line immortalised from purified breast luminal epithelial cells (Stamps et al., 1994) and the HMT3522 line was from fibrocystic (non-cancer) breast (Briand et al., 1987).

The breast tumors were 63 primary operable invasive breast cancers from the Nottingham City Hospital Tumor Bank, which we have extensively profiled (e.g. Garcia et al., 2005; Chin et al., 2007; Naderi et al., 2007). Both cDNA and genomic DNA were available for 54 tumours; a further 4 had cDNA alone, 5 had genomic DNA alone.

Six samples of pure breast tumour cells were from one ascitic and five pleural effusions collected at University College Hospital, London. They were chosen for their high tumour-cell content and treated with red blood cell lysis buffer if heavily contaminated with blood. To purify the tumour cells, macrophages and reactive mesothelial cells were removed by exploiting their rapid adhesion to tissue culture plastic. Cells were incubated in L-15 medium/ 5% FCS for 2 hours at 37°C in large flasks, then the unattached tumour cells aspirated to give estimated >95% tumour cells (MJO’H and RCS, unpublished).

Normal breast from reduction mammoplasty was obtained, with informed consent, from patients aged 18 to 38 years. Epithelial fragments, ‘organoids’, were prepared by collagenase digestion of tissue without culturing (Edwards et al., 1986). Purified luminal and myoepithelial cells were prepared from primary cultures initiated from organoids that had been trypsinised and fractionated using antibodies and magnetic bead technology (Grigoriadis et al., 2006).

RT-PCR

RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, CA), treated with DNaseI (DNA-free kit, Ambion Division, Applied Biosystems, Foster City, CA) to remove genomic DNA, and was reverse-transcribed using oligo-dT primers and Superscript III (Invitrogen). Real-time RT-PCR for NRG1 exons 4 to 6 was performed using primers HrgPCRE4F1 (CATTAACAAAGCATCACTGGCT) and hrg3_6R1 (TGAAGAAGTATTTGCTCCTT); primers for exon 8 were HRGE8F1, CTACATCTACATCCACCACTGG and HRGE8R2, TTGCACAAGTATCTCGAGGGGT (chr8:32705009+32705138). SYBR Green PCR Master Mix (Applied Biosystems) was used in an ABI 7900 (Applied Biosystems). GAPDH was used as reference transcript, using the primers GAPDH_1F (GCAAATTCCATGGCACCGT) and GAPDH_1R (TCGCCCCACTTGATTTTGG). Primers for ERBB2, ERBB3 and isoform-specific primers for ERBB4 are given in Supplementary Figure 3. In preliminary experiments, by conventional RT-PCR, primer pairs were designed within all 17 exons except exons 4-6, 11 and 15.

Western blotting

Monoclonal antibody MAB377 (R&D Systems, Abingdon, UK) was used at 1:200. It had been obtained by immunisation with recombinant human neuregulin1 isoform beta 1 extracellular domain (amino acids 2 - 246, exons 2 to 6, 8 and part of 10), and is expected to detect most isoforms except SMDF and perhaps GGF2. Cell lysates were prepared in the presence of protease inhibitors according to Iyer et al. (2004) and analyzed on 10% polyacrylamide gels. Monoclonal binding was detected with anti-mouse peroxidase conjugate (Dako, California, US) at 1:1000 using the Amersham ECL system (Amersham Biosciences, Uppsala, Sweden). Re-probing for GAPDH used rabbit anti-GAPDH antibody AB9485 (Abcam, Cambridge, UK) at 1:1000.

Bisulphite sequencing

DNA was bisulphite treated using EZ DNA methylation Gold kit (Zymo Research, Orange, CA) according to the manufacturer’s protocol. Two overlapping sections of the NRG1 CpG island were amplified by PCR from bisulphite-modified DNA. Primers designed for bisulphite-modified DNA (MethPrimer at http://www.urogene.org/methprimer/) were MetHrgF5 (GGGGIAATTGAAAAAGAG) and MeHrgR1 (ACCCACCTAAACTCTAACTACC), located −452 and +106 from the translation start site, and MeHrgF3 (GAGGGATAAATTTTTTTTAAAT) and MeHrgR2 (CTATCCCTTACCCTAAACTCTAAAC), located −94 and +329 from the translation start site (Figure 1a). The PCR products were cloned by TOPO TA Cloning kit (Invitrogen), and 10 clones were sequenced.

For pyrosequencing the target sequence GCGGCGGCGGCTGCCGGACGATGGGAGCG was selected, 32525414 to 32525442 bp on reference sequence NCBI Builds 35 and 36. It was amplified by PCR using MetHrgF5 (used above) and MetHrgF4_Bio primer (5′ biotinylated-ATTTAAAAAAAATTTATCCCTC). The biotinylated PCR product was bound to Streptavidin Sepharose HP (GE Healthcare Amersham, UK), denatured using a 0.2 M NaOH solution, washed with 10mM Tris-Acetate (pH 7.6) and then 70% ethanol using Vacuum Prep Tool (Biotage, Uppsala, Sweden). The purified single-stranded PCR products were released at 80°C in annealing buffer (20mM Tris-Acetate, 2mM Mg-Acetate; pH7.6), mixed with pyrosequencing primer MeHrgSeq_Pur1 (GAGGAGGTTAGGAGTTGA) and sequenced using the PSQ HS 96 Pyrosequencing System and PyroMark MD System (Biotage) with the sequencing reagents Pyro Gold Reagents (Biotage). DNA methylation was quantified using PSQ HS 96A SNP Software and Pyro Q-CpG Software (Biotage). Pyrosequencing agreed with conventional bisulphite sequencing when six representative cell lines were reanalysed, the largest difference in average methylation over the 29-bp fragment being 12%.

Azacytidine treatment

Cell lines were treated with 1 to 5 μM 5-aza-2′-deoxycytidine for 96h (MDA-MB-361) or 76h (HCC1500).

Small interfering RNA (siRNA) knockdown

siRNA constructs were designed to target exons 3 and 4, present in all transcripts that start at the exon 2 CpG island (two constructs); and exons 13, 14 and 17 which are in the cytoplasmic pro-apoptotic region. We could not design siRNAs to uniquely target the ‘universal’ exon, exon 8. Some siRNAs were not very potent in preliminary experiments and these were combined, to give three independent siRNA treatments for HB4a and two treatments for HCC1806. Constructs were generated according to Brummelkamp et al. (2002). Oligos were:

  • pSuperNRG1_13 (targetted to exon 13) 5′gatccccTCACCATCCTAACCCACCCttcaagagaGGGTGGGTTAGGATGGTGAtttttta and agcttaaaaaTCACCATCCTAACCCACCCtctcttgaaGGGTGGGTTAGGATGGTGAggg3′
  • for pSuperNRG1_94 (targetted to exon 14) 5′gatccccCCCATCACTCCACTACTGTttcaagagaACAGTAGTGGAGTGATGGGttttta3′ and 5′agcttaaaaaCCCATCACTCCACTACTGTtctcttgaaACAGTAGTGGAGTGATGGGggg3′;
  • pSuperNRG1_153 (exon 3) 5′gatccccAAACTAGTCCTTCGGTGTGttcaagagaCACACCGAAGGACTAGTTTttttta3′ and 5′agcttaaaaaAAACTAGTCCTTCGGTGTGtctcttgaaCACACCGAAGGACTAGTTTggg3′;
  • pSuperNRG1_380 (exon 4) 5′gatccccCACCATCGTGGAATCAAACttcaagagaGTTTGATTCCACGATGGTGttttta3′ and 5′agcttaaaaaCACCATCGTGGAATCAAACtctcttgaaGTTTGATTCCACGATGGTGggg3′;
  • pSuperNRG1_14 (exon 14) 5′gatccccGAGAAGCAGAGACATCCTTttcaagagaAAGGATGTCTCTGCTTCTCttttta3′ and 5′agcttaaaaaGAGAAGCAGAGACATCCTTtctcttgaaAAGGATGTCTCTGCTTCTCggg3′; and
  • pSuperNRG1_17 (exon 17) 5′gatccccGAAACGACCCAAGACTACGttcaagagaCGTACTCTTGGGTCGTTTCttttta3′ and 5′agcttaaaaaGAAACGACCCAAGACTACGtctcttgaaCGTACTCTTGGGTCGTTTCggg3′.

NRG1 target sequences are indicated in capitals, and were designed using OligoEngine Workstation 2 (http://www.oligoengine.com). Annealed oligos were ligated into BglII and HindIII sites of the pSUPER.retro.puro (Brummelkamp et al., 2002) vector and inserts sequenced.

HB4A and HCC 1806 were transfected using Lipofectamine (Invitrogen) according to the manufacturer’s protocol. Cells cultivated on a tissue culture flask (75 cm2) were incubated with 32μl Lipofectamine together with pSuperNRG1_380 (exon 2) (2μg), a mixture of pSuperNRG1_94 (1μg) and pSuperNRG1_153 (1μg) targetting exons 2 and 14, and a mixture of pSuperNRG1_14 (1μg) and pSuper NRG1_17 (1μg), targetting exons 14 and 17, in 8ml OptiMEM medium (Invitrogen) for 5 hr at 37°C in a CO2 incubator, then 8ml complete medium with serum was added. Cells were selected in 5μg/ml puromycin (Sigma, Poole, UK) for a month to select stably-transfected cells. Two independent transfections were performed for each combination of constructs. pSUPER.retro.puro was used as a control.

For growth curves, cells were plated in a 6-well tissue culture plate, at two starting densities, and were trypsinized and counted with a Beckman-Coulter ViCell XR Imaging Hemacytometer (Beckman, Fullerton, CA) in triplicate.

Supplementary Material

Acknowledgements

We thank Huai-En Huang for some exploratory expression analysis. Funded principally by the Breast Cancer Campaign and also by Cancer Research UK, Hutchison-Whampoa Ltd. and the Ludwig Institute for Cancer Research.

Work was supported by the Breast Cancer Campaign, Cancer Research UK, Hutchison-Whampoa Ltd. (who endowed the buildings in which the work was done) and the Ludwig Institute for Cancer Research.

Footnotes

Conflict of Interest The authors declare no conflict of interest.

Supplementary information is available at Oncogene’s website.

References

  • Adélaïde J, Huang HE, Murati A, Alsop AE, Orsetti B, Mozziconacci MJ, et al. A recurrent chromosome translocation breakpoint in breast and pancreatic cancer cell lines targets the neuregulin/NRG1 gene. Gene Chromosome Canc. 2003;37:333–45. [PubMed]
  • Agrelo R, Cheng WH, Setien F, Ropero S, Espada J, Fraga MF, et al. Epigenetic inactivation of the premature aging Werner syndrome gene in human cancer. Proc Natl Acad Sci U S A. 2006;103:8822–7. [PMC free article] [PubMed]
  • Aguilar Z, Akita RW, Finn RS, Ramos BL, Pegram MD, Kabbinavar FF, et al. Biologic effects of heregulin/neu differentiation factor on normal and malignant human breast and ovarian epithelial cells. Oncogene. 1999;18:6050–62. [PubMed]
  • Amin DN, Tuck D, Stern DF. Neuregulin-regulated gene expression in mammary carcinoma cells. Exp Cell Res. 2005;309:12–23. [PubMed]
  • Birnbaum D, Adélaïde J, Popovici C, Charafe-Jauffret E, Mozziconacci MJ, Chaffanet M. Chromosome arm 8p and cancer: a fragile hypothesis. Lancet Oncol. 2003;4:639–42. [PubMed]
  • Bradbury JM, Arno J, Edwards PA. Induction of epithelial abnormalities that resemble human breast lesions by the expression of the neu/erbB-2 oncogene in reconstituted mouse mammary gland. Oncogene. 1993;8:1551–8. [PubMed]
  • Briand P, Petersen OW, Van Deurs B. A new diploid nontumorigenic human breast epithelial cell line isolated and propagated in chemically defined medium. In Vitro Cell Dev Biol. 1987;23:181–8. [PubMed]
  • Britsch S. The neuregulin-I/ErbB signaling system in development and disease. Adv Anat Embryol Cell Biol. 2007;190:1–65. [PubMed]
  • Brummelkamp TR, Bernards R, Agami R. Stable suppression of tumorigenicity by virus-mediated RNA interference. Cancer Cell. 2002;2:243–7. [PubMed]
  • Charafe-Jauffret E, Ginestier C, Monville F, Finetti P, Adelaide J, Cervera N, et al. Gene expression profiling of breast cell lines identifies potential new basal markers. Oncogene. 2006;25:2273–84. [PubMed]
  • Chin SF, Teschendorff AE, Marioni JC, Wang Y, Barbosa-Morais NL, Thorne NP, et al. High-resolution aCGH and expression profiling identifies a novel genomic subtype of ER negative breast cancer. Genome Biol. 2007;8:R215. [PMC free article] [PubMed]
  • Ching TT, Maunakea AK, Jun P, Hong C, Zardo G, Pinkel D, et al. Epigenome analyses using BAC microarrays identify evolutionary conservation of tissue-specific methylation of SHANK3. Nat Genet. 2005;37:645–51. [PubMed]
  • Clarke C, Sandle J, Lakhani SR. Myoepithelial cells: pathology, cell separation and markers of myoepithelial differentiation. J Mammary Gland Biol Neoplasia. 2005;10:273–80. [PubMed]
  • Cooke SL, Pole JCM, Chin S-F, Ellis IO, Caldas C, Edwards PAW. High-resolution array CGH clarifies events occurring on 8p in carcinogenesis. BMC Cancer. 2008;8:288. [PMC free article] [PubMed]
  • Crabbe L, Jauch A, Naeger CM, Holtgreve-Grez H, Karlseder J. Telomere dysfunction as a cause of genomic instability in Werner syndrome. Proc Natl Acad Sci U S A. 2007;104:2205–10. [PMC free article] [PubMed]
  • Deadwyler GD, Pouly S, Antel JP, Devries GH. Neuregulins and erbB receptor expression in adult human oligodendrocytes. Glia. 2000;32:304–12. [PubMed]
  • Edwards PA, Brooks IM, Bunnage HJ, Foster AV, Ellison ML, O’Hare MJ. Clonal analysis of expression of epithelial antigens in cultures of normal human breast. J Cell Sci. 1986;80:91–101. [PubMed]
  • Falls DL. Neuregulins: functions, forms, and signaling strategies. Exp Cell Res. 2003;284:14–30. [PubMed]
  • Garcia MJ, Pole JC, Chin SF, Teschendorff A, Naderi A, Ozdag H, et al. A 1 Mb minimal amplicon at 8p11-12 in breast cancer identifies new candidate oncogenes. Oncogene. 2005;24:5235–45. [PubMed]
  • Grigoriadis A, Mackay A, Reis-Filho JS, Steele D, Iseli C, Stevenson BJ, et al. Establishment of the epithelial-specific transcriptome of normal and malignant human breast cells based on MPSS and array expression data. Breast Cancer Res. 2006;8:R56. [PMC free article] [PubMed]
  • Grimm S, Leder P. An apoptosis-inducing isoform of neu differentiation factor (NDF) identified using a novel screen for dominant, apoptosis-inducing genes. J Exp Med. 1997;185:1137–42. [PMC free article] [PubMed]
  • Grimm S, Weinstein EJ, Krane IM, Leder P. Neu differentiation factor (NDF), a dominant oncogene, causes apoptosis in vitro and in vivo. J Exp Med. 1998;188:1535–9. [PMC free article] [PubMed]
  • Hayes NV, Gullick WJ. The neuregulin family of genes and their multiple splice variants in breast cancer. J Mammary Gland Biol Neoplasia. 2008;13:205–14. [PubMed]
  • Huang HE, Chin SF, Ginestier C, Bardou VJ, Adélaïde J, Iyer NG, et al. A recurrent chromosome breakpoint in breast cancer at the NRG1/neuregulin 1/heregulin gene. Cancer Res. 2004;64:6840–4. [PubMed]
  • Iyer NG, Chin SF, Ozdag H, Daigo Y, Hu DE, Cariati M. p300 regulates p53-dependent apoptosis after DNA damage in colorectal cancer cells by modulation of PUMA/p21 levels. Proc Natl Acad Sci U S A. 2004;101:7386–91. [PMC free article] [PubMed]
  • Jones FE, Jerry DJ, Guarino BC, Andrews GC, Stern DF. Heregulin induces in vivo proliferation and differentiation of mammary epithelium into secretory lobuloalveoli. Cell Growth Differ. 1996;7:1031–8. [PubMed]
  • Kalirai H, Clarke RB. Human breast epithelial stem cells and their regulation. J Pathol. 2006;208:7–16. [PubMed]
  • Li L, Cleary S, Mandarano MA, Long W, Birchmeier C, Jones FE. The breast proto-oncogene, HRGalpha regulates epithelial proliferation and lobuloalveolar development in the mouse mammary gland. Oncogene. 2002;21:4900–7. [PubMed]
  • Liu X, Baker E, Eyre HJ, Sutherland GR, Zhou M. Gamma-heregulin: a fusion gene of DOC-4 and neuregulin-1 derived from a chromosome translocation. Oncogene. 1999;18:7110–4. [PubMed]
  • Muraoka-Cook RS, Caskey LS, Sandahl MA, Hunter DM, Husted C, Strunk KE, et al. Heregulin-dependent delay in mitotic progression requires HER4 and BRCA1. Mol Cell Biol. 2006;26:6412–24. [PMC free article] [PubMed]
  • Muraoka-Cook RS, Feng SM, Strunk KE, Earp HS. ErbB4/HER4: role in mammary gland development, differentiation and growth inhibition. J Mammary Gland Biol Neoplasia. 2008;13:235–46. [PMC free article] [PubMed]
  • Naderi A, Teschendorff AE, Beigel J, Cariati M, Ellis IO, Brenton JD, et al. BEX2 is overexpressed in a subset of primary breast cancers and mediates nerve growth factor/nuclear factor-kappaB inhibition of apoptosis in breast cancer cell lines. Cancer Res. 2007;67:6725–36. [PubMed]
  • Neve RM, Chin K, Fridlyand J, Yeh J, Baehner FL, Fevr T, et al. A collection of breast cancer cell lines for the study of functionally distinct cancer subtypes. Cancer Cell. 2006;10:515–27. [PMC free article] [PubMed]
  • Pole JC, Courtay-Cahen C, Garcia MJ, Blood KA, Cooke SL, Alsop AE, et al. High-resolution analysis of chromosome rearrangements on 8p in breast, colon and pancreatic cancer reveals a complex pattern of loss, gain and translocation. Oncogene. 2006;25:5693–706. [PubMed]
  • Prentice LM, Shadeo A, Lestou VS, Miller MA, deLeeuw RJ, Makretsov N, et al. NRG1 gene rearrangements in clinical breast cancer: identification of an adjacent novel amplicon associated with poor prognosis. Oncogene. 2005;24:7281–9. [PubMed]
  • Rakyan VK, Down TA, Thorne NP, Flicek P, Kulesha E, Gräf S, et al. An integrated resource for genome-wide identification and analysis of human tissue-specific differentially methylated regions (tDMRs) Genome Res. 2008;18:1518–29. [PMC free article] [PubMed]
  • Schaefer G, Fitzpatrick VD, Sliwkowski MX. Gamma-heregulin: a novel heregulin isoform that is an autocrine growth factor for the human breast cancer cell line, MDA-MB-175. Oncogene. 1997;15:1385–94. [PubMed]
  • Stamps AC, Davies SC, Burman J, O’Hare MJ. Analysis of proviral integration in human mammary epithelial cell lines immortalized by retroviral infection with a temperature-sensitive SV40 T-antigen construct. Int J Cancer. 1994;57:865–74. [PubMed]
  • Steinthorsdottir V, Stefansson H, Ghosh S, Birgisdottir B, Bjornsdottir S, Fasquel AC, et al. Multiple novel transcription initiation sites for NRG1. Gene. 2004;342:97–105. [PubMed]
  • Sundvall M, Iljin K, Kilpinen S, Sara H, Kallioniemi OP, Elenius K. Role of ErbB4 in breast cancer. J Mammary Gland Biol Neoplasia. 2008;13:259–68. [PubMed]
  • Takizawa T, Nakashima K, Namihira M, Ochiai W, Uemura A, Yanagisawa M, et al. DNA methylation is a critical cell-intrinsic determinant of astrocyte differentiation in the fetal brain. Dev Cell. 2001;1:749–58. [PubMed]
  • Vermeer PD, Einwalter LA, Moninger TO, Rokhlina T, Kern JA, Zabner J, et al. Segregation of receptor and ligand regulates activation of epithelial growth factor receptor. Nature. 2003;422:322–6. [PubMed]
  • Wang XZ, Jolicoeur EM, Conte N, Chaffanet M, Zhang Y, Mozziconacci MJ, et al. gamma-heregulin is the product of a chromosomal translocation fusing the DOC4 and HGL/NRG1 genes in the MDA-MB-175 breast cancer cell line. Oncogene. 1999;18:5718–21. [PubMed]
  • Weinstein EJ, Grimm S, Leder P. The oncogene heregulin induces apoptosis in breast epithelial cells and tumors. Oncogene. 1998;17:2107–13. [PubMed]
  • Weinstein EJ, Leder P. The extracellular region of heregulin is sufficient to promote mammary gland proliferation and tumorigenesis but not apoptosis. Cancer Res. 2000;60:3856–61. [PubMed]
  • Yang AS, Estécio MR, Doshi K, Kondo Y, Tajara EH, Issa JP. A simple method for estimating global DNA methylation using bisulfite PCR of repetitive DNA elements. Nucleic Acids Res. 2004;32:e38. [PMC free article] [PubMed]
  • Yang Y, Spitzer E, Meyer D, Sachs M, Niemann C, Hartmann G, et al. Sequential requirement of hepatocyte growth factor and neuregulin in the morphogenesis and differentiation of the mammary gland. J Cell Biol. 1995;131:215–26. [PMC free article] [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...