• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of pnasPNASInfo for AuthorsSubscriptionsAboutThis Article
Proc Natl Acad Sci U S A. Dec 1, 2009; 106(48): 20423–20428.
Published online Nov 16, 2009. doi:  10.1073/pnas.0910371106
PMCID: PMC2787143
Medical Sciences

Epidermal loss of JunB leads to a SLE phenotype due to hyper IL-6 signaling

Abstract

Systemic lupus erythematosus (SLE) is a complex autoimmune disease affecting various tissues. Involvement of B and T cells as well as increased cytokine levels have been associated with disease manifestation. Recently, we demonstrated that mice with epidermal loss of JunB (JunBΔep) develop a myeloproliferative syndrome (MPS) due to high levels of G-CSF which are secreted by JunB-deficient keratinocytes. In addition, we show that JunBΔep mice develop a SLE phenotype linked to increased epidermal interleukin 6 (IL-6) secretion. Intercrosses with IL-6-deficient mice could rescue the SLE phenotype. Furthermore, we show that JunB binds to the IL-6 promoter and transcriptionally suppresses IL-6. Facial skin biopsies of human SLE patients similarly revealed low JunB protein expression and high IL-6, activated Stat3, Socs-1, and Socs-3 levels within lupus lesions. Thus, keratinocyte-induced IL-6 secretion can cause SLE and systemic autoimmunity. Our results support trials to use α-IL-6 receptor antibody therapy for treatment of SLE.

Keywords: epidermis, IL-6R, systemic lupus erythematosus

Interleukin 6 (IL-6) is a multifunctional cytokine exerting diverse effects on different organs in autocrine, paracrine, and endocrine fashion (1, 2). The major sources of IL-6 are reported to be monocytes, fibroblasts, and endothelial cells (3). IL-6 is bound as a dimer within an IL-6Rα hexameric ligand-receptor complex (4) and can induce Ig production, T-cell maturation, as well as glomerulonephritis and plasmocytosis (57). SCID-IL-6 transgenic mice do not show such abnormalities (8). A role of IL-6 for different inflammatory autoimmune diseases such as rheumatoid arthritis or Crohn's Disease has been established. Increased levels of IL-6 and cytokines such as TNF-α, IL-1, and IL-18 have been observed in systemic lupus erythematosus (SLE) (9, 10). SLE is characterized by the presence of autoimmune antibodies and immune complexes, which form deposits in various tissues and can cause severe tissue damage (11).

Activator protein 1 (AP-1) is a dimeric transcription factor, consisting of variable combinations of members of the jun (jun, junB, junD), fos (fos, fosB, fra-1, and fra-2), ATF, and maf protein families (12). Jun proteins were recognized as important regulators of cytokine expression and immune response (13). The function of Jun proteins within the AP-1 complex crucially depends on the cellular context. Mice with induced epidermal deletion of c-jun and junB develop hallmarks of psoriasis (14). Keratinocytes JunBΔep mice secrete high levels of G-CSF, which leads to a myeloproliferative syndrome (MPS) phenotype (15). In addition, JunBΔep mice develop SLE with increased epidermal IL-6 levels, skin lesions, and systemic disease including nephritis. The glomerulonephritis and skin disease in JunBΔep mice is attenuated by crossing to IL-6-deficient mice. In addition, JunB binds to the IL-6 promoter and transcriptionally downregulates IL-6 expression. Within lupus lesions of facial skin biopsies from human SLE patients, we measured reduced JunB and elevated IL-6 protein expression levels. Therefore, keratinocyte-induced IL-6 secretion is sufficient to cause a SLE phenotype. Our data provide a mechanism for the development of SLE and emphasize the use of antibodies directed against the IL-6 receptor for the treatment of SLE.

Results

SLE Phenotype by JunBΔep and Rescue by IL-6 Depletion.

We here demonstrate that JunBΔep mice develop a SLE phenotype dependent on increased epidermal IL-6 secretion (Fig. 1 B and H). Therefore, we crossed JunBΔep mice to IL-6−/− mice (16) to investigate the effect of IL-6 on the phenotype resulting from the loss of JunB. The cutaneous affection of JunBΔep mice was characterized by spontaneous dermatitis of ears, snouts, upper thorax region and paws starting at the age of 3 months post-partum (Fig. 1B). JunBΔepIL-6−/− mice had a milder thickening of the skin than JunBΔep mice, with only mild hyperkeratosis and inflammatory infiltrates (Fig. 1 A–C and Fig. S1 A–C) (15). Microscopic screening of internal organs revealed plasmocytosis in JunBΔep mice, however, the lymph nodes of controls and JunBΔepIL-6−/− mice showed normal architecture without increased plasma cell count (Fig. S1 D–F). JunBΔep mice developed linear α-IgG-immunofluorescence at the dermo-epidermal junction, referred to as “lupus band,” which was not observed in JunBΔepIL-6−/− mice and controls (Fig. 1 D–F). IL-6 protein expression was elevated in JunBΔep mice, whereas in controls and JunBΔepIL-6−/− mice, IL-6 expression was not detectable (Fig. 1 G–I). JunBΔep mice developed an immunocomplex glomerulonephritis (IC-GN), which was characterized by mesangial hypercellularity, lobulation of the glomerular tuft with basement membrane thickening, endocapillary hypercellularity, and luminal obstruction by immuno complex deposits. JunBΔepIL-6−/− and control mice had no such immune complexes, shown by acid fuchsin orange G-stain (AFOG) staining (Fig. 1 J–L). Electron microscopy (ELMI) revealed electron-dense immune deposits in mesangial and subendothelial regions concomitantly to podocyte foot process effacement in the majority of glomerular capillary loops. This was not observed in JunBΔepIL-6−/− and control mice (Fig. S1 J–L). Heterogeneity and immune complex composition resembled renal lesions as observed in human SLE nephritis (Fig. S1 M–P). Macroscopically, the small and atrophic appearance of JunBΔep kidneys was rescued to normal size in JunBΔepIL-6−/− mice (Fig. 1M). JunBΔep mice showed increased albuminuria of up to 170 ng/dL albumin in the urine compared to controls and JunBΔepIL-6−/− mice (Fig. 1N).

Fig. 1.
SLE-like skin and kidney affections in JunBΔep mice. A 3-month-old wild-type mouse with normal skin was compared to a JunBΔep littermate control (A) with ulcerative skin lesions in the face region (B) and rescue of the skin phenotype after ...

Antinuclear autoantibodies (ANA) are a hallmark of human SLE (17). Most SLE patients develop autoantibodies (AutoABs) against chromatin components directed either against a single component or the complete nucleosome itself. ANAs are detected in the serum of JunBΔep mice, but not in sera of controls and JunBΔepIL-6−/− mice (Fig. S1 G–I). AutoABs to histones display typical features of a T-cell-dependent antigene (AG)-driven immune response like Ig class switching (18). Histones are considered as the main source for T cell AGs in human SLE as well as murine SLE models (19, 20). Histological features of the SLE observed in JunBΔep mice were accompanied by high autoantibody levels against histones (H1, H2A, H2B, H3, and H4) and SmD (Fig. 1O). JunBΔepIL-6−/− mice neither showed any α-histone- nor α-SmD-antibodies as opposed to JunBΔep mice. Anti-histone ABs first occurred at 4–5 months and peaked around 6–12 months of age in JunBΔep mice. Antinuclear SmD Abs, which are also typical for murine and human SLE (21, 22), were detected after 5 months. Ablation of IL-6 in JunBΔepIL-6−/− mice could eliminate the systemic autoimmune disease observed in JunBΔep mice and the early mortality observed in JunBΔepIL-6−/− mice (Fig. 1P).

Since SLE is commonly exacerbated by sun exposure, we challenged JunBΔep mice with UV-irradiation. UV-irradiation enhanced severity of lupus-like skin lesions on histomorphological and immunohistochemical levels compared to controls (Fig. 2 A–D). Epidermal thickness of JunBΔep was not significantly affected compared to controls (Fig. S2 A–E). The IC-GN in JunBΔep mice was accompanied by a tubulo-interstitial nephritis, dominated by perivascular CD3+ T-cell-rich infiltrates compared to controls (Fig. 2 E and F and Fig. S2 F and G). Examination of the liver and lung revealed inflammatory perivascular infiltrates that also contained abundant CD3+ T-lymphocytes (Fig. 2 G–J and Fig. S2 H–K). Furthermore, JunBΔep mice developed swelling of paws with functional articular impairment, synovial proliferation, and incipient inflammatory infiltration of the synovial membrane.

Fig. 2.
UV irradiation experiments of JunBf/f and JunBΔep mice (A–D). (Scale bar, 50 μm.) JunBf/f show no α-IgG immunofluorescence with or without UV (A and C). JunBΔep mice show linear α-IgG-immunofluorescence ...

Systemic occurrence of immune complexes was paralleled by a marked increase of activated CD138+ plasma cells in lymph nodes and spleen, and increased serum levels of IgE Abs and Fc receptor for IgE (FcεRI) antisera, which were reported to be elevated in SLE patients (Fig. S3 A–C) (23). All other Ig levels were in normal range (Fig. S3D). To screen for mediators between JunBΔep keratinocytes and the immune system, we performed serum ELISA of major Th1- and Th2-specific cytokines and in vitro expression analysis of isolated JunBΔep keratinocytes. FACS-ELISA revealed a significant increase of IL-6 protein expression compared to controls, while other major cytokines such as IL-1α, IL-2, IL-5, IL-10, INF-γ, TNF-α, GM-CSF, IL-4, and IL-17 were in normal range (Fig. S4A). Serum concentration of IL-6 was 4-fold increased, and G-CSF was more than 10-fold increased, which are secreted by JunB-deficient keratinocytes (15). IL-6 can induce T- or B-cell differentiation (1, 24), and IL-6 knockout mice show reduced antigen-specific IgG1, IgG2a, and IgG3 levels upon immunization (25). Thus, we generated compound mouse models lacking JunB proteins in the epidermis and systemically IL-6 or G-CSF. JunBΔepG-CSF−/− still show the SLE phenotype (Fig. S4 I and E), indicating that G-CSF is not responsible for the autoimmune phenotype. IL-6-Jak1-Stat3 activation promotes plasma B-cell differentiation either directly (26) or indirectly through CD4+ T helper cells (27). To investigate the role of lymphocytes in the development of local and systemic autoimmune alterations, JunBΔep mice were crossed with Rag2−/− mice. Rag2 deficiency in mice leads to a loss of T- and B-lymphocytes, and JunBΔepRag2−/− mice had no symptoms of systemic autoimmunity. The glomerula of JunBΔepRag2−/− kidneys appeared normal. Of note, these mice displayed mild epidermal thickening with local granulocyte infiltration of the skin (Fig. S4 D and H). These data confirm the important role of lymphocytes in SLE-like disease in JunBΔep mice. In addition, we performed Socs-1 and Socs-3 immunohistochemistry stainings on wild-type and JunBΔep skin sections (Fig. S4 J–M) to investigate the role of IL-6/pStat3 target gene induction more closely. JunBΔep and human SLE patients skin displayed strong Socs-1 and Socs-3 protein expression compared to epidermis of wild-type mice and human controls. This finding indicates involvement of Socs-1 and Socs-3 in SLE pathology.

IL-6 Expression Is Directly Regulated by JunB.

Since JunB is a tumor suppressor antagonizing for example c-Jun/Fos heterodimers, we suspected that overexpression of IL-6 by JunBΔep keratinocytes resulted from loss of IL-6 promoter repression by JunB containing AP-1 complexes. The IL-6 gene promoter contains a functional AP-1 binding site (28). We performed chromatin immunoprecipitation (ChIP) with an antibody against JunB in keratinocytes isolated from control and JunBΔep mice. The conserved AP-1 binding site is located in the IL-6 promoter (−296 bp to −290 bp; sequence: tgagtca) (Fig. 3A). A 4-fold stronger ChIP signal was observed using skin from control mice as opposed to JunBΔep mice using primers that amplify a product with the AP-1 binding site (Fig. 3B). Control Ab ChIP assays did not result in significant enrichment. Next, we cloned a murine IL-6 promoter fragment containing the AP-1 binding site in front of a luciferase gene. Since B cells are difficult to be transiently transfected, we used human HeLa cervix carcinoma cells, which contain significant amounts of AP-1 complexes and transfected them with pIL-6. HeLa cells were either cotransfected with or without a JunB expression plasmid. Interestingly, a JunB-dependent repression of the IL-6 promoter activity in presence of inflammatory IL-6 cytokine conditions was observed (Fig. 3C). Our data suggest that JunB acts as a repressor on the IL-6 promoter in presence of high IL-6 concentrations.

Fig. 3.
Schematic overview of known transcription factor binding sites in the IL-6 promoter, indicating the location of the putative AP-1 site (filled circle) and the transcription start site (+1) (A). Arrows indicate the position of the primers used for ChIP. ...

Loss of JunB Correlates with Human SLE.

To compare our findings in JunBΔep mice, we performed histological analyses of SLE patient's skin biopsies and controls (Fig. 4 A and B). The morphological alterations were very similar to those found in JunBΔep mice (Fig. 4 C and D). Immunhistochemical (IHC) analysis of JunB, IL-6, and IL-6Rα chain and py-Stat3 were performed from human skin biopsy specimens. Protein expression was measured by defining the epidermis as region of interest (ROI), thereby excluding inflammatory cells found in the dermis, using automated cell acquisition and quantification software (Histoquest). Strong nuclear JunB immunoreaction was found in normal human facial skin (Fig. 4E). Skin specimens of SLE patients revealed a reduced JunB expression in the nuclei of keratinocytes in seven of eight cases (Fig. 4 F and G). Staining for IL-6 was severely reduced in the epidermis of SLE patients compared to normal controls (Fig. 4 H–J). IL-6Rα was expressed at very low levels in the epidermis of controls. IL-6Rα staining of SLE patients revealed a strong cytoplasmatic expression, which was strongest in basal and subbasal keratinocytes as compared to controls (Fig. 4 K–M). A weak cytoplasmic py-Stat3 immunoreaction was found in the keratinocytes (Fig. 4N) of controls, whereas SLE patients had a strong immunostaining for py-Stat3 predominantly in the basal layer of the epidermis (Fig. 4 O–P). Quantification of the expression data for JunB, IL-6, IL-6Rα, and py-Stat3 revealed statistically a high and significant expression in SLE patients compared to normal controls.

Fig. 4.
Normal human facial skin (A) compared to SLE patient's skin (B). SLE combines systemic with cutaneous lesions such as the “butterfly” facial lesion, resembling the cardinal feature of human SLE. Compared to normal human skin (C), histology ...

Discussion

Our data provide a link between loss of epidermal JunB and the development of SLE both in human patients and in an animal model, which can be helpful for further studies of SLE. The direct regulation of IL-6 by JunB emphasizes IL-6 as a target for anti-cytokine therapy in human SLE patients. IL-6 has been suggested to play a role in the development of SLE (21), and especially in patients with Lupus-nephritis, IL-6 levels are significantly increased (29, 30). In addition it was shown that IL-6 can experimentally deteriorate lupus nephritis (7) and that IL-6R blockage can improve it (31). In contrast, we did not find evidence for involvement of other Stat3-activating cytokine or growth factor receptor systems. We looked in detail for gp130 family members (13) such as the receptor chains for oncostatin M (OSMR) or leukemia inhibitory factor receptor (LIFR), since these are not restricted to specific organs such as caliotrophin (heart) or ciliary neurotrophic factor (neuronal tissue). In contrast to the strong upregulation of the IL-6Rα chain with strong IL-6 expression in the epidermis, we did not find significant expression levels of the OSMR and LIFR. We exclude also a role for epidermal G-CSF production through the use of G-CSF knockout mice, which did not complement the SLE phenotype upon epidermal JunB loss.

Activated Stat3 can cause an autocrine upregulation of the IL-6R-pYStat3 axis (32), and also IL-6 production was traced to the epidermis causing states of chronic inflammation with skin disease. Moreover, IL-6 is a immunomodulatory cytokine that was systemically high in the serum. It controls plasma B-cell differentiation, and it influences also T helper cell cytokine production through Stat3-dependent signaling (1, 2527). Stat3 isoforms are known to cooperate with c-Jun or JunD proteins specifically (33). In addition, Stat3 response elements are often found close to AP-1 response elements and the c-fos oncogene or the junB tumor suppressor protein were identified as transcriptional targets of activated Stat3 (23). Here, we show that less JunB proteins are expressed upon strong Stat3 activity in human skin biopsies. This finding could indicate a difference in Stat3 isoform expression, which needs further investigation, since the pY-Stat3 antibody staining cannot distinguish between isoforms. Overall, our data suggest that IL-6 activates Stat3 strongly via tyrosine (Fig. 4) phosphorylation, which pinpoints to a high expression and activation of Stat3α. Interestingly, we found increased SOCS-1 and SOCS-3 protein expression (Fig. S4 K and M) in autoimmune diseased tissues, which are known target genes of IL-6 activated Stat3. The strong expression of Socs proteins change global phosphotyrosine-dependent signaling, since Socs proteins target phosphotyrosine proteins, such as kinases to the proteasome (2). If genetic deletion of Socs-1 or Socs-3 proteins would be beneficial for interfering with SLE phenotype, this could be a valuable future research direction.

Recently, with the rise of biotherapies, IL-6R antibodies have turned into the center of interest to block B-cell activity in autoimmune diseases (34). A variety of anti-IL-6R antibodies have already been applied for the treatment of autoimmune diseases (35) such as rheumatoid arthritis, systemic onset juvenile idiopathic arthritis (JIA) adult Still's disease, Castleman's disease, and Crohn's disease (35). We here highlight the possibility, that IL-6 overexpression can be induced by deregulation of JunB expression in the epidermis. In addition, IL-6 activation in the epidermis is sufficient to induce autoABs production and SLE-like disease. Therefore, our data provide molecular evidence for the development of SLE and bring IL-6 action to the center stage. We propose IL-6R antibodies as a promising tool for the treatment of human SLE. JunBΔep mice are a good model to go to clinical test phase with IL-6R antibodies in the future.

Materials and Methods

Mice.

Mice harboring a floxed JunB allele were generated by targeted homologous recombination as previously described. For conditional deletion of JunB in the skin, JunBf/f mice were crossed to K5-Cre2 transgenic mice (15). IL-6−/− mice were purchased from the Jackson Laboratory (16). The genetic background of JunBf/f and K5Cre2 mice was C57BL/6/129SV, while IL-6−/− and Rag2−/− mice were kept in a C57Bl6 background. Mice were genotyped by PCR, and if not otherwise stated, only 3- to 6-month-old littermates were used for the experiments. Mice were housed with alternating 12-h light and dark cycles under specific pathogen-free conditions according to the institutional guidelines of the Medical University Vienna, Austria.

Histology and Immunohistochemistry.

Murine organs were dissected and fixed overnight in 4% paraformaldehyde before paraffin embedding. For general histology analysis, 5-μm sections were stained with hematoxylin and eosin (H&E). For kidney histology, sections were stained with AFOG to demonstrate glomerular deposits. Paraffin sections (5 μm) from skin lesions of patients diagnosed according to ARA criteria with SLE and from healthy human skin samples were provided by the Dermatology Departments of the Medical Universities of Vienna or Graz with ethical permission and informed consent. For immunohistochemistry analysis, paraffin sections were stained using standard protocols with specific antibodies against JunB (sc-46, 1:300; Santa Cruz Biotechnology), IL-6 (6672, 1:400; Abcam), IL-6Rα (sc-661, 1:300; Santa Cruz Biotechnology), CD3 (SP7, 1:300; NeoMarkers), SOCS-1 (SC-9021, 1:300; Santa Cruz Biotechnology), SOCS-3 (SC-9023, 1:300; Santa Cruz Biotechnology), and Cytokeratin 5 (SMI-31R, 1:1,000; Covance).

UVB Irradiation and Immunofluorescence.

To simulate human sunlight-induced disease activity, JunBf/f and JunBΔep mice were shaved on their backs, placed 20 cm below an UV lamp (UV236B; Grubholz Medizin Technik) and irradiated with 0.03–0.30 J/cm2 dose and an intensity of 2.20 mW/cm2. The time of exposure was prolonged each day starting with 14 s up to 2 min 16 s irradiation. After 10 days of exposure, mice were sacrificed, and the skin was dissected and frozen in an optimal cutting temperature compound. Untreated Junbf/f and JunBΔep mice were used as controls. For the detection of immunocomplex deposits in the epidermal-dermal junction, direct immunofluorescence with goat anti-mouse IgG (H+L) antibody (Alexa Fluor 488, 1:1,000; Invitrogen) was performed following standard procedures.

Electron Microscopy.

Small pieces of kidney tissue (3 mm diameter) were fixed in 4% paraformalehyde, 0.1% glutaraldehyde in cacodylate buffer (pH 7.3), and embedded in Epon. Ultrathin sections were stained with uranyl acetate and lead citrate and examined in a Jeol 105 electron microscope.

Detection of Autoantibodies and ELISA.

ANA were detected by indirect immunofluorescence microscopy on Hep-2 cells (Hemagen) according to the manufacturer's instructions using FITC-conjugated goat-anti-mouse IgG (Dako) as secondary Ab and human sera as positive controls.

Autoreactivities against nuclear proteins were analyzed by immunoblotting employing HeLa nuclear extracts as described (36). Nitrocellulose membranes were cut into strips and blocked (10 mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.1% Triton X-100, 3% nonfat dried milk) for 1 h at room temperature. Strips were then incubated with serum (1:50), washed, and subsequently incubated with alkaline phosphatase conjugated anti-mouse IgG secondary antibody (1:2,500; Accurate Chemical and Science Corporation). A recently established immunoblotting assay (36) was used for determination of antibodies to individual histones H1, H2A, H2B, H3, and H4 employing highly purified calf thymus histones (Roche Diagnostic GmbH). Additionally and for confirmation of immunoblotting results, sera were analyzed by line immunoassay (Innogenetics) for the presence of antibodies against the antigens SmB, SmD, U1–70K, U1-A, U1-C, Ro (60- and 52-kDa proteins), La, topoisomerase I, Jo1, centromere protein B, ribosomal P protein, and histones. Human autoimmune sera with known specificities served as positive controls as described (17).

Antibodies to nucleosomes were measured by the anti-chromatin ELISA obtained from Inova Diagnostics. Sera were diluted 1:100 and incubated with HRP-conjugated goat anti-mouse IgG (1:20,000; Jackson Immunoresearch). The cytokine serum profile of JunBΔep and JunBf/f control mice was analyzed by ELISA (R&D Systems).

Chromatin Immunoprecipitation.

Isolation of JunBf/f and JunBΔep keratinocytes was performed as described (14). Keratinocytes were cultured in Costar 12-well plates coated with collagen IV. CHIP assays of these keratinocyte cultures were performed with a CHIP kit (Upstate). Briefly, 2–3 × 107 cells were cross-linked with 1% formaldehyde, washed in PBS, and lysed in SDS lysis buffer. Chromatin was fragmented by sonication and precleaned with protein A agarose. Samples were incubated with anti JunB (E11404, 0.2 μg/μL; Springbio) or unspecific rabbit IgG antibodies (AXELL), and complexes were immunoprecipitated with protein A agarose. Protein-DNA complexes were eluted from the antibodies with 1% SDS, 0.1 M NaHCO3, and DNA-protein interactions were reversed by addition of 5 M NaCl and heating to 65 °C for 4 h. Proteins were digested with proteinase K, and the remaining DNA was purified by phenol/chloroform extraction. Site-specific PCR was carried out using a specific primer pair, amplifying the IL-6 core promoter region between bp −321 (forward primer: ttcccatcaagacatgctca) and bp −210 (reverse-primer: aggaaggggaaagtgtgctt), which contains the AP-1 binding site. Each ChIP experiment was carried out at least three times with similar results.

Plasmids.

The pIL-6 plasmid was constructed using a 303-bp PCR product amplified from murine Ba/F3 cells cDNA using the primers pIL-6fw: 5′-agcggtttctggaattgact-3′, and pIL-6re: 5′-gaagagtgctcatgcttcttagg-3′ (murine Refseq genomic IL-6) (37). A XhoI/KpnI fragment was cloned into the pGL3-basic luciferase plasmid-vector (Promega). The β-galactosidase (β-gal) expression vector used was pMIR-REPORT β-Gal expression plasmid (pβ-Gal) from Ambion. The JunB expression vector was a pCDNA4_hismax_B (pJUNB) from Invitrogen were the murine JunB coding sequence was introduced (courtesy Juliane Strauss Technical University, Graz, Austria).

Luciferase Assay.

HeLa cells were grown in 6-well plates in DMEM supplemented with 10% (vol/vol) FBS (FBS), and transfected using Lipofectamine 2000 (Invitrogen). Moreover, cells were incubated in DNA-Lipofectamine 2000 complex containing medium for no more than 1 h. The following amounts of plasmids were used for transfection per well: pJUNB or pVEC (2 μg); pIL-6 or pGL3 (1 μg); and pβ-Gal (0.1 μg). Twenty-four hours after transfection, cells were harvested by trypsinization. Twenty-five percent of the cells were subsequently used for analysis of β-gal activity, and 25% were used for analysis of luciferase activity using LUMI-STAR from BMG-LabTech and the BetaGlo kit and the OneGlo kit from Promega.

Supplementary Material

Supporting Information:

Acknowledgments.

We thank Drs. Mercedes Rincon, Christiane Thallinger, Thomas Decker, Andy Rees, and Martin Aringer for critical comments and Hannes Tkadletz for help in preparing the illustrations. This work was supported by the Banco Bilbao Vizcaya Argentaria Foundation (to E.F.W.), a Genome Austria (GEN-AU) “Inflammobiota” grant (to L.K.), and Austrian Science Fund Grants P-18478-B12 (to L.K.) and SFB F028 (to R.M.).

Footnotes

The authors declare no conflict of interest.

This article contains supporting information online at www.pnas.org/cgi/content/full/0910371106/DCSupplemental.

References

1. Kishimoto T. Interleukin-6: From basic science to medicine—40 years in immunology. Annu Rev Immunol. 2005;23:1–21. [PubMed]
2. Heinrich PC, et al. Principles of interleukin (IL)-6-type cytokine signalling and its regulation. Biochem J. 2003;374:1–20. [PMC free article] [PubMed]
3. Hirano T. Interleukin 6 and its receptor: Ten years later. Int Rev Immunol. 1998;16:249–284. [PubMed]
4. Youinou P, Jamin C. The weight of interleukin-6 in B cell-related autoimmune disorders. J Autoimmun. 2009;32:206–210. [PubMed]
5. Eitner F, et al. Role of interleukin-6 in mediating mesangial cell proliferation and matrix production in vivo. Kidney Int. 1997;51:69–78. [PubMed]
6. Naka T, Nishimoto N, Kishimoto T. The paradigm of IL-6: From basic science to medicine. Arthritis Res. 2002;4(Suppl 3):S233–S242. [PMC free article] [PubMed]
7. Ryffel B, Car BD, Gunn H, Roman D, Hiestand P, Mihatsch MJ. Interleukin-6 exacerbates glomerulonephritis in (NZB x NZW)F1 mice. Am J Pathol. 1994;144:927–937. [PMC free article] [PubMed]
8. Katsume A, et al. Interleukin-6 overexpression cannot generate serious disorders in severe combined immunodeficiency mice. Clin Immunol Immunopathol. 1997;82:117–124. [PubMed]
9. Smolen JS, Steiner G, Aringer M. Anti-cytokine therapy in systemic lupus erythematosus. Lupus. 2005;14:189–191. [PubMed]
10. Aringer M, Smolen JS. Cytokine expression in lupus kidneys. Lupus. 2005;14:13–18. [PubMed]
11. Manson JJ, Rahman A. A systemic lupus erythematosus. Orphanet J Rare Dis. 2006;1:6. [PMC free article] [PubMed]
12. Eferl R, Wagner EF. AP-1: A double-edged sword in tumorigenesis. Nat Rev Cancer. 2003;3:859–868. [PubMed]
13. Zenz R, et al. Activator protein 1 (Fos/Jun) functions in inflammatory bone and skin disease. Arthritis Res Ther. 2008;10:201. [PMC free article] [PubMed]
14. Zenz R, et al. Psoriasis-like skin disease and arthritis caused by inducible epidermal deletion of Jun proteins. Nature. 2005;437:369–375. [PubMed]
15. Meixner A, et al. Epidermal JunB represses G-CSF transcription and affects haematopoiesis and bone formation. Nat Cell Biol. 2008;10:1003–1011. [PubMed]
16. Kopf M, et al. Impaired immune and acute-phase responses in interleukin-6-deficient mice. Nature. 1994;368:339–342. [PubMed]
17. Stummvoll GH, et al. Characterisation of cellular and humoral autoimmune responses to histone H1 and core histones in human systemic lupus erythaematosus. Ann Rheum Dis. 2009;68:110–116. [PubMed]
18. van Es JH, et al. Somatic mutations in the variable regions of a human IgG anti-double-stranded DNA autoantibody suggest a role for antigen in the induction of systemic lupus erythematosus. J Exp Med. 1991;173:461–470. [PMC free article] [PubMed]
19. Kaliyaperumal A, Michaels MA, Datta SK. Naturally processed chromatin peptides reveal a major autoepitope that primes pathogenic T and B cells of lupus. J Immunol. 2002;168:2530–2537. [PubMed]
20. Deshmukh US, Gaskin F, Lewis JE, Kannapell CC, Fu SM. Mechanisms of autoantibody diversification to SLE-related autoantigens. Ann NY Acad Sci. 2003;987:91–98. [PubMed]
21. Chun HY, et al. Cytokine IL-6 and IL-10 as biomarkers in systemic lupus erythematosus. J Clin Immunol. 2007;27:461–466. [PubMed]
22. Hoffman IE, et al. Specific antinuclear antibodies are associated with clinical features in systemic lupus erythematosus. Ann Rheum Dis. 2004;63:1155–1158. [PMC free article] [PubMed]
23. Fiebiger E, Hammerschmid F, Stingl G, Maurer D. Anti-FcepsilonRIalpha autoantibodies in autoimmune-mediated disorders. Identification of a structure-function relationship. J Clin Invest. 1998;101:243–251. [PMC free article] [PubMed]
24. Suematsu S, et al. IgG1 plasmacytosis in interleukin 6 transgenic mice. Proc Natl Acad Sci USA. 1989;86:7547–7551. [PMC free article] [PubMed]
25. Kopf M, Herren S, Wiles MV, Pepys MB, Kosco-Vilbois MH. Interleukin 6 influences germinal center development and antibody production via a contribution of C3 complement component. J Exp Med. 1998;188:1895–1906. [PMC free article] [PubMed]
26. Fornek JL, et al. Critical role for Stat3 in T-dependent terminal differentiation of IgG B cells. Blood. 2006;107:1085–1091. [PMC free article] [PubMed]
27. Dienz O, et al. The induction of antibody production by IL-6 is indirectly mediated by IL-21 produced by CD4+ T cells. J Exp Med. 2009;206:69–78. [PMC free article] [PubMed]
28. Xiao W, et al. NF-kappaB activates IL-6 expression through cooperation with c-Jun and IL6-AP1 site, but is independent of its IL6-NFkappaB regulatory site in autocrine human multiple myeloma cells. Cancer Biol Ther. 2004;3:1007–1017. [PubMed]
29. Takemura T, et al. Cellular localization of inflammatory cytokines in human glomerulonephritis. Virchows Arch. 1994;424:459–464. [PubMed]
30. Malide D, Russo P, Bendayan M. Presence of tumor necrosis factor alpha and interleukin-6 in renal mesangial cells of lupus nephritis patients. Human Pathol. 1995;26:558–564. [PubMed]
31. Kiberd BA. Interleukin-6 receptor blockage ameliorates murine lupus nephritis. J Am Soc Nephrol. 1993;4:58–61. [PubMed]
32. Ichiba M, Nakajima K, Yamanaka Y, Kiuchi N, Hirano T. Autoregulation of the Stat3 gene through cooperation with a cAMP-responsive element-binding protein. J Biol Chem. 1998;273:6132–6138. [PubMed]
33. Dewilde S, Vercelli A, Chiarle R, Poli V. Of alphas and betas: Distinct and overlapping functions of STAT3 isoforms. Front Biosci. 2008;13:6501–6514. [PubMed]
34. Nishimoto N, Kishimoto T, Yoshizaki K. Anticytokine therapy in autoimmune diseases. Intern Med. 1999;38:178–182. [PubMed]
35. Connell L, McInnes IB. New cytokine targets in inflammatory rheumatic diseases. Best Pract Res Clin Rheumatol. 2006;20:865–878. [PubMed]
36. Hassfeld W, et al. Autoimmune response to the spliceosome. An immunologic link between rheumatoid arthritis, mixed connective tissue disease, and systemic lupus erythematosus. Arthritis Rheum. 1995;38:777–785. [PubMed]
37. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215:403–410. [PubMed]

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...