• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of genbioBioMed CentralBiomed Central Web Sitesearchsubmit a manuscriptregisterthis articleGenome BiologyJournal Front Page
Genome Biol. 2008; 9(10): R146.
Published online Oct 1, 2008. doi:  10.1186/gb-2008-9-10-r146
PMCID: PMC2760873

A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection



Telomeres prevent the ends of eukaryotic chromosomes from being recognized as damaged DNA and protect against cancer and ageing. When telomere structure is perturbed, a co-ordinated series of events promote arrest of the cell cycle so that cells carrying damaged telomeres do not divide. In order to better understand the eukaryotic response to telomere damage, budding yeast strains harboring a temperature sensitive allele of an essential telomere capping gene (cdc13-1) were subjected to a transcriptomic study.


The genome-wide response to uncapped telomeres in yeast cdc13-1 strains, which have telomere capping defects at temperatures above approximately 27°C, was determined. Telomere uncapping in cdc13-1 strains is associated with the differential expression of over 600 transcripts. Transcripts affecting responses to DNA damage and diverse environmental stresses were statistically over-represented. BNA2, required for the biosynthesis of NAD+, is highly and significantly up-regulated upon telomere uncapping in cdc13-1 strains. We find that deletion of BNA2 and NPT1, which is also involved in NAD+ synthesis, suppresses the temperature sensitivity of cdc13-1 strains, indicating that NAD+ metabolism may be linked to telomere end protection.


Our data support the hypothesis that the response to telomere uncapping is related to, but distinct from, the response to non-telomeric double-strand breaks. The induction of environmental stress responses may be a conserved feature of the eukaryotic response to telomere damage. BNA2, which is involved in NAD+ synthesis, plays previously unidentified roles in the cellular response to telomere uncapping.


Telomeres are the specialized structures at the ends of linear eukaryotic chromosomes [1,2]. Their fundamental configuration is conserved in most eukaryotes and consists of repetitive DNA elements with single-stranded (ss) 3' G-rich overhangs. Telomeres are bound by numerous proteins with specificity for both double-stranded DNA (dsDNA) and the ss overhangs [3] and telomere 'capping' function is critical in preventing the cell from recognizing the chromosome ends as double-strand breaks (DSBs) [1,3]. Telomeres also need to circumvent the 'end replication problem', which is due to the inability of DNA polymerases to fully replicate chromosome ends [1]. In the presence of telomerase, a reverse transcriptase that uses an RNA template to add telomeric DNA, chromosome ends are maintained by the addition of DNA repeats [4]. In budding yeast and mammalian cells not expressing telomerase, telomeres get progressively shorter with every cell division until they eventually reach a critically short length that is sensed by the DNA-damage apparatus and promotes a cell cycle arrest and replicative senescence [3,5-7]. Cell cycle arrest also occurs when telomere damage is caused by absence or loss of function of telomere capping proteins [3,8-10].

Telomere degeneration is probably relevant to human cancer and aging [11]. In many human somatic tissues, telomeres become progressively shorter with increasing number of cell divisions. Additionally, age related diseases and premature aging syndromes have been characterized by short telomeres and are associated with altered functioning of both telomerase and telomere-interacting proteins. Regulation of telomere length is also relevant to cancer since, in the majority of human tumors and cancer cell lines thus far examined, telomerase is inappropriately activated, permitting cells to divide indefinitely.

Cdc13 is an essential telomere binding protein in Saccharomyces cerevisiae. Cdc13 is the functional homologue of human Pot1 in that it binds the ss G-tail [12,13]. Cdc13 is involved in telomere length homeostasis, due, at least in part, to its role in the recruitment of the catalytic subunit of telomerase [14-16]. The critical role of Cdc13, however, appears to be in telomere end protection. When Cdc13 is present, telomeres are capped and DNA-damage responses, which would be elicited if telomeres were perceived as DSBs, are suppressed [3]. In the absence of functional Cdc13, uncapping occurs and the resulting dysfunctional telomeres become substrates of the DNA damage response pathway, leading to accumulation of ssDNA at telomeres [9,17], activation of a DNA damage checkpoint [9,18] and eventually cell death [19,20].

CDC13 is an essential gene; however, temperature sensitive alleles such as cdc13-1 allow telomeres to be conditionally uncapped and the resulting cellular response to be studied in detail. This has facilitated identification of the genes required for checkpoint arrest of cdc13-1 strains [1,3,18,21]. Telomere uncapping in cdc13-1 strains induces rapid and efficient cell cycle arrest, like many types of DNA damage. Whether uncapped telomeres elicit a different response to that to a DSB elsewhere in the genome remains unknown. A genome-wide analysis of the transcriptional response of yeast to deletion of the telomerase RNA subunit revealed that when telomeres become critically short, changes in gene expression overlap with those associated with a number of cellular responses, including the DNA damage response, but also possess unique features that suggest that shortened telomeres invoke a specific cellular response [22]. Telomere damage suffered by yeast cells that lack functional telomerase takes several days to manifest and does so heterogeneously within populations of cells [22]. In contrast, telomere uncapping in cdc13-1 strains exposed to the restrictive temperature is rapid and synchronous, with over 80% of cells within a population exhibiting the G2-M cell cycle arrest indicative of telomere uncapping within a single cell cycle [18]. We hypothesized that, while the response to telomere uncapping in cdc13-1 strains was likely to overlap with the response to telomerase deletion and DNA damage responses, rapid telomere uncapping in cdc13-1 strains would induce an acute response to telomere damage that would allow us to better dissect, and therefore understand, the response to telomere uncapping.

In this paper, we used DNA microarray analyses to determine the genome-wide response to telomere uncapping in cdc13-1 yeast strains. We show that genes differentially expressed upon telomere uncapping show similarities to expression programs induced by other conditions, such as exogenous cellular stresses and the absence of telomerase. BNA2, encoding an enzyme required for de novo NAD+ synthesis, was one of the most highly and significantly up-regulated genes upon telomere uncapping in cdc13-1 strains and has no known function in telomere metabolism. We show that deletion of BNA2 suppresses the temperature sensitivity of cdc13-1 strains; thus, BNA2 plays a role in chromosome end protection.


Promoting telomere uncapping in cdc13-1 strains

In order to better understand the eukaryotic response to uncapped telomeres, we examined the genome-wide expression changes associated with telomere uncapping in cdc13-1 yeast strains.

We first sought to determine appropriate conditions to induce telomere uncapping in temperature-sensitive cdc13-1 mutants. The method commonly employed to promote uncapping is to switch from growth at a permissive temperature of 23°C to a restrictive temperature of 36°C or 37°C [23], close to the maximum temperature (38-39°C) at which wild-type yeast can grow. Transcriptomic profiling of yeast lacking functional telomerase [22] demonstrated that telomere damage affects expression of heat shock genes [22,24]. Since a change of culture temperature from 23°C to 36-37°C would also be sensed as a heat shock, and could potentially cause similar changes in gene expression to those that occur specifically as a result of telomere uncapping, we first tested whether a lower restrictive temperature was able to induce telomere uncapping without a strong heat shock response. We compared restrictive temperatures of 30°C (the optimum growth temperature for wild-type yeast) and 36°C in cdc13-1 strains.

We first compared the kinetics of cell cycle arrest in cdc13-1 cultures transferred from 23°C to 30°C or 36°C (Figure (Figure1a).1a). cdc13-1 strains transferred to 30°C underwent a G2-M cell cycle arrest with broadly similar kinetics to those transferred to 36°C, with over 80% of cells in each culture arresting within 2 hours of the temperature shift. Secondly, quantitative RT-PCR was used to examine gene expression in cdc13-1 and CDC13+ strains (Figure 1b,c; Additional data file 1). We examined expression of HSP12, which is robustly induced in response to heat stress [24] and also when telomeres are critically short in telomerase deletion mutants [22]. In the CDC13+ strain, elevating the culture temperature to 30°C caused a mild heat shock, as indicated by 2.3-fold up-regulation of HSP12 1 hour after altering the temperature (Figure (Figure1b).1b). For the remainder of the time course, HSP12 expression returned to levels slightly below those that were observed before the temperature shift. In the cdc13-1 strain after 1 hour of incubation at 30°C, HSP12 was up-regulated 3.9-fold above levels in the T = 0 sample. By 90 minutes, this induction was reduced to 2.1-fold but then rose steadily at each subsequent time point, presumably due to telomere uncapping, until 4 hours after the temperature shift, when HSP12 was 74-fold up-regulated (Figure (Figure1b1b).

Figure 1
Comparison of 30°C and 36°C as restrictive temperatures. (a) Two independent cultures of a cdc13-1 strain (DLY1622) grown at 23°C, were sampled. One culture was transferred to 30°C (filled triangles) and the other to 36°C ...

As expected, switching from growth at 23°C to 36°C induced a stronger heat shock response than switching to 30°C. In the CDC13+ strain, 1 hour of exposure to 36°C induced HSP12 expression 49-fold above levels in the T = 0 sample (Figure (Figure1c).1c). At later time points, HSP12 up-regulation in the CDC13+ strain subsided, although expression was still elevated between 6- and 15-fold above those measured pre-induction. Expression of HSP12 in the cdc13-1 strain transferred to 36°C was up-regulated 94-fold after 1 hour and this increased to levels between 132- and 347-fold above the T = 0 sample for the remainder of the time course (Figure (Figure1c1c).

Additionally, we measured the expression of CTT1 and MSC1 in cdc13-1 and CDC13+ strains that had been transferred from 23°C to 30°C or 36°C (Additional data file 1). Both of these genes are also up-regulated in response to heat shock [24] and the absence of telomerase [22]. For CTT1, a shift to 36°C induced a stronger heat shock response in CDC13+ strains than a shift to 30°C. For MSC1, neither 30°C nor 36°C appreciably induced gene expression in CDC13+ strains. For both of these genes (and also HSP12), differential expression in cdc13-1 strains compared to CDC13+ was readily detectible after a shift to 30°C, indicating that this temperature induces telomere uncapping. Both 30°C and 36°C can induce heat shock but, as expected, this effect is also more appreciable at 36°C.

We decided that 30°C was a suitable restrictive temperature for examination of the transcriptional response to telomere uncapping as this temperature induces telomere uncapping in cdc13-1 strains whilst causing minimal heat stress.

In order to generate a robust data set, a multi-time-point time course and three biological replicates of each strain were used (Figure (Figure2a).2a). To produce independent biological replicates, we performed a genetic cross between a CDC13+ and a cdc13-1 strain to generate three cdc13-1 and three CDC13+ strains. The resulting sets of strains demonstrated reproducible cell cycle arrest, growth, viability and HSP12 expression upon exposure to the 30°C restrictive temperature (Additional data file 2). Strains were in the S288C genetic background since the S. cerevisiae genome sequence was derived from an S288C strain and oligonucleotides on microarray chips are based upon the published genome sequence. Additionally, other large scale genetic screens carried out in our and other laboratories have used this strain background.

Figure 2
Genome wide expression changes in response to telomere uncapping. (a) Schematic representation of microarray time courses. For each of the three separate time course experiments, one CDC13+ and one cdc13-1 strain were inoculated into liquid culture and ...

Overview of the genomic expression response to telomere uncapping

cDNAs generated from the three cdc13-1 and three CDC13+ strains treated as in Figure Figure2a2a were analyzed using Affymetrix GeneChip® Yeast Genome 2.0 arrays. The entire dataset can be downloaded from the ArrayExpress website, accession number E-MEXP-1551. We used limma [25] to compare transcript levels between CDC13+ and cdc13-1 strains at each time point and identified 647 genes with at least two-fold changes in expression levels between cdc13-1 and CDC13+ strains and where the differences between cdc13-1 and CDC13+ strains showed statistically significant p-values (≤ 0.05; Figure Figure2b;2b; Table A in Additional data file 3). Of these genes, 229 were down-regulated upon telomere uncapping and 418 were up-regulated. Analysis of the lists of up- and down-regulated genes using GOstats [26], which identifies statistically over-represented Gene Ontology (GO) terms, revealed that the up-regulated list was enriched for genes involved in processes including carbohydrate metabolism, energy generation and the response to oxidative stress (Table A in Additional data file 4) while the down-regulated list was enriched for genes with roles in processes including amino acid and ribosome biogenesis, RNA metabolism and chromatin modification (Table B in Additional data file 4). Hierarchical clustering was used to investigate the relationships between the differentially expressed genes. This clustering algorithm groups genes with similar expression profiles (Figure (Figure2b).2b). During the time course, the number of differentially expressed genes increased with time (Figure (Figure2b)2b) and almost all of the changes occurring at early time points persisted for the duration of the experiment (Table (Table11 and Figure Figure2b).2b). There were no differences in gene expression between cdc13-1 and CDC13+ strains before the temperature shift, indicating that in cdc13-1 strains, telomeres are functionally capped at 23°C (Figure (Figure2b).2b). In CDC13+ strains, the expression of 41 genes was altered during the time course. Analysis of this gene list using GOstats [26] demonstrated that genes with roles in cell division and the cell cycle were over-represented in this list (Table C in Additional data file 4).

Table 1
Numbers of differentially expressed genes at each timepoint

In order to validate the microarray data, we used quantitative RT-PCR to examine the expression of five of the up-regulated genes in a set of RNA samples that had been used in the array analysis (Figure (Figure3a).3a). This confirmed that all of the genes examined were up-regulated in cdc13-1 relative to CDC13+. Expression patterns of these same genes in cdc13-1 and CDC13+ strains throughout the microarray time course were also examined (Figure (Figure3b).3b). Comparison between gene expression in the microarray experiments with quantitative RT-PCR revealed that while the RT-PCR broadly agreed with the array data, for UBI4 there were differences between gene expression levels quantified using these methods. This may be due to the smaller dynamic range of arrays compared to quantitative RT-PCR. As expected from our pre-array RT-PCR analysis (Figure 1c,d; Additional data file 1), HSP12, CTT1 and MSC1 were up-regulated in our microarray experiment. We plotted the expression of these genes throughout the microarray time course (Additional data file 5) and observed that expression patterns were very similar to those that we had observed by RT-PCR, although like UBI4, expression levels of HSP12 measured in the array were lower than those quantified by RT-PCR.

Figure 3
Validation of microarray data. (a) RNA from a single set of time course samples (CDC13+ (DLY3108; filled circles) and cdc13-1 (DLY3102; open circles)) was subjected to quantitative RT-PCR. Transcript levels of PNC1, UBI4, MAG1, RNR3, and YKL161C were ...

Expression of genes involved in the response to telomerase deletion

The transcriptomic response to telomere uncapping in cdc13-1 strains was expected to overlap with the response to absence of telomerase [22], since in both cases damaged telomeres activate a checkpoint response. Telomerase deletion is associated with the differential expression of genes involved in processes including the DNA-damage response (DDR) [27,28] and the environmental stress response (ESR) [24]. A significant proportion of the genes differentially expressed in cdc13-1 strains were also involved in similar responses to these (see below for further details), suggesting that different types of telomere damage invoke common biological processes.

Direct comparison of the cdc13-1 dataset with the 581 genes altered in the absence of telomerase [22] showed that 244 genes were common to both (Table A in Additional data file 6). The overlap may encompass genes whose expression is altered universally in response to telomere damage and includes the DNA damage response genes RAD51, RNR2, RNR3 and RNR4. There were 230 genes up-regulated in cdc13-1 strains but not in the response to telomerase deletion (Table B in Additional data file 6). These include the DNA damage response genes DUN1, RAD16, MAG1, DDR2 and HUG1, and MSN4, which encodes a key transcription factor in the response to environmental stresses [29]. Under conditions of stress, Msn4 and a related protein, Msn2, bind to defined promoter elements called 'stress response elements' (STREs); 36% of genes up-regulated in cdc13-1 strains possess STREs (p ≤ 10 e-15), while only 18% of genes down-regulated in cdc13-1 strains possess such elements (p = 0.526). Therefore, it is probable that up-regulation of MSN4 in the response to telomere uncapping is responsible for the downstream induction of many genes.

Some of the genes differentially expressed in the cdc13-1 experiment but not in response to telomerase deletion may respond specifically to acute telomere damage, while some genes in the tlc1Δ data set but not cdc13-1 may be specific to an adaptive response that occurs as cells gradually adapt to telomere erosion over a number of days. We envisaged that because cdc13-1 strains undergo a rapid cell cycle arrest when telomeres are uncapped, use of this system may allow us to identify genes that are involved in the acute response to telomere uncapping. One hour after the temperature shift, the DDR genes DUN1, HUG1, RAD51, RNR2 and RNR3 were already up-regulated in cdc13-1 strains, indicating that damaged telomeres had already been sensed, despite cell cycle arrest not having yet reached maximum levels (Figure (Figure2).2). DUN1 and HUG1 were not identified as differentially expressed in tlc1Δ strains [22].

Differences in gene expression between cdc13-1 strains and those lacking telomerase are likely to be due to a number of factors. Firstly, different genes may be altered due to responses to distinct types of telomere damage. Secondly, in a population of cells lacking telomerase, erosion of telomeres and cell cycle arrest occur heterogeneously and over a period of days rather than hours [22], making transcriptional differences less polarized (and thus more difficult to detect) than in a population of rapidly and synchronously arrested cdc13-1 cells. Also, because of heterogeneity of entry into senescence between cultures of telomerase deficient strains [22], results from biological replicates cannot be readily combined to allow statistical analyses such as the ones that we have employed. Additionally, some differences between differentially expressed genes identified in these two experiments are likely because the studies were carried out using different types of arrays and because different algorithms have been used to identify altered gene expression.

Expression of cell cycle regulated genes

cdc13-1 strains at the restrictive temperature arrest in the G2-M phase of the cell cycle [18], while CDC13+ cells continue to divide. Therefore, the differential expression of many genes in cdc13-1 strains is likely a result of enrichment/depletion of cell cycle-regulated transcripts at the arrest point compared to levels in asynchronous cycling controls. Of the 647 differentially regulated genes in cdc13-1 strains, 256 were shown to be periodically expressed during a recent, comprehensive study of the cell division cycle [30]. A hypergeometric test confirmed that periodically expressed transcripts were over-represented in our data set (p ≤ 10e-15; Table Table2).2). Changes in gene expression in cdc13-1 strains displayed a distinct temporal pattern in that total numbers of differentially expressed genes increased at each time point (Figures (Figures2b2b and and4a),4a), while cell cycle regulated genes represented an increasingly smaller proportion of the total numbers of differentially expressed genes at each time point (Figure 4a,b). Over 50% of the genes that are differentially expressed upon telomere uncapping in cdc13-1 strains are not known to be cell cycle regulated; thus, the majority of the observed changes do not seem to be attributable to the G2-M arrest. We subtracted the genes that are known to be cell cycle regulated from our list of 647 differentially expressed genes and subjected the remaining 391 to a GOstats analysis (Table D in Additional data file 4). This list is enriched for genes involved in energy generation and genes involved in nicotinamide metabolism are also over-represented in it (p = 3.7e-4).

Table 2
Over-representation of ESR, DDR and CC genes in cdc13-1 dataset and QT clusters
Figure 4
Expression of cell cycle-regulated genes. (a) Total numbers of differentially expressed genes (DEGs) at each time point (filled circles) and numbers of genes at each time point that have been previously classified as cell cycle regulated [30] (open circles) ...

It has recently been shown that budding yeast cells disrupted for all S-phase and mitotic cyclins still express nearly 70% of periodic genes periodically and on schedule, despite being arrested at the G1-S border [30]. Thus, it is possible that despite cdc13-1 strains being arrested at G2-M, this may have a relatively limited effect upon periodic gene expression.

Similarities to DNA-damage and stress responses

Uncapped telomeres are sensed by cells as if they were DSBs [9,18]; thus, the response to telomere uncapping is expected to share features in common with the DDR. Accordingly, many of the genes differentially expressed in cdc13-1 strains have previously been shown to respond to any one of three types of DNA damaging event, namely exposure to ionizing radiation [27], treatment with methyl methanesulfonate [27], or induction of a single, unrepaired cut by HO endonuclease [28]. A hypergeometric test confirmed that genes differentially expressed in response to any of these types of DNA damaging insult were over-represented in our data set (p ≤ 10 e-15; Table Table2).2). This could be due, at least in part, to the fact that DSBs induce cell cycle arrest at G2-M similarly to uncapped telomeres and, thus, the same sets of transcripts will be enriched/depleted at the arrest point in all cases. In order to account for this effect, we subtracted cell cycle regulated genes [30] from the list of genes differentially expressed in cdc13-1 strains and compared the remaining genes to those that are expressed in response to DNA damage [27,28]. Of the genes altered in cdc13-1 that are not cell cycle regulated, 35% are also involved in responses to DNA damage, and a hypergeometric test confirmed that the over-representation of DDR genes in this group was statistically significant (p ≤ 10e-15). While genes whose expression is altered in response to telomere uncapping in cdc13-1 strains overlap with those whose expression changes in response to other types of DNA damage, the majority of the altered genes have not been implicated in the DDR, suggesting that uncapped telomeres are not simply sensed as DSBs by cells.

Genome-wide responses to absence of telomerase and to DNA damaging agents share features in common with the ESR. The ESR involves approximately 900 genes whose expression is stereotypically altered in response to diverse environmental conditions [24]. A hypergeometric test confirmed that ESR genes were over-represented in our data set (p ≤ 10e-15; Table Table2).2). GOstats analysis also demonstrated that significant numbers of genes involved in the response to oxidative stress are present in the list of genes up-regulated in cdc13-1 strains (Table A in Additional data file 4).

Differential expression of transcriptional regulators during telomere uncapping

In order to identify transcriptional regulators whose expression is altered in cdc13-1 strains, we compared our list of differentially expressed genes to a list of 203 known yeast transcription factors [31]. Fourteen genes encoding transcriptional regulators were up-regulated in cdc13-1 strains (Table A in Additional data file 7). Some of the up-regulated transcription factors are known to play roles in glucose metabolism while MSN4 plays a key role in the ESR (see above). Fourteen genes encoding transcriptional regulators were also down-regulated in cdc13-1 strains (Table B in Additional data file 7). The down-regulated transcription factors appeared to possess diverse roles and worthy of note is the telomeric silencing role of RAP1.

Co-expression of functionally related genes in the response to telomere uncapping

In order to identify groups of genes that may be co-regulated and/or involved in the same pathways or processes, we subjected genes differentially expressed in cdc13-1 strains to a 'quality threshold' (QT) clustering analysis [32] (Figure (Figure5).5). This analysis uses an algorithm that groups genes non-hierarchically into high quality clusters based upon similarity in expression patterns. The QT clustering analysis revealed that all but 45 of the genes differentially regulated in cdc13-1 strains can be grouped into 13 QT clusters (Figure (Figure5;5; Tables B-N in Additional data file 3). In order to identify common properties of genes in each cluster, we used hypergeometric tests to determine whether single clusters had higher than expected numbers of genes that had been implicated in the DDR, the ESR, or were known to be cell cycle regulated (Table (Table2).2). Additionally, we carried out a GOstats analysis [26] to determine whether the lists were enriched for genes associated with particular GO terms (Figure (Figure5;5; Tables E-Q in Additional data file 4). The majority of the QT clusters were enriched for genes with specific GO terms and/or exhibited over-representation of genes involved in the DDR, the ESR or the cell cycle (Table (Table2).2). Thus, within some of the sets of co-expressed genes there are significant proportions that clearly share common functions and, as such, their co-ordinate expression may be critical for the cell to mount its response to uncapped telomeres.

Figure 5
Quality threshold (QT) clustering analysis of genes differentially expressed upon telomere uncapping. Bioconductor was used to execute a QT clustering analysis [32] of the 647 differentially expressed genes (DEGs). A Euclidean similarity measure was used. ...

Expression of genes linked to telomere function

Genes with direct roles in telomere function were scarce in the cdc13-1 dataset and, accordingly, GOstats did not identify genes whose products have telomeric roles as being over-represented. Three genes with established roles in telomere maintenance were down-regulated in cdc13-1 strains (HEK2, RAP1 and TBF1), while ESC8, which is involved in chromatin silencing at telomeres, was up-regulated. Two separate large scale screens have identified a total of 248 genes that contribute to maintenance of normal telomere length [33,34]. Direct comparison of the cdc13-1 gene expression data set to these showed that five of the up-regulated genes (DUN1, GUP2, PPE1, YBR284W and YSP3) overlapped with these datasets while six of the down-regulated genes (HTL1, LRP1, RPB9, RRP8, BRE1 and NPL6) have been shown to play a role in telomere length maintenance.

In a separate study, our laboratory has carried out a genome-wide screen that has identified more than 240 gene deletions that suppress the temperature sensitivity of cdc13-1 strains and, thus, may play specific roles in telomere capping [35]. With the aim of identifying differentially expressed genes with novel telomeric roles, we compared the list of cdc13-1 suppressors to genes differentially expressed in the cdc13-1 microarrays, and found that 22 genes were common to both (Figure (Figure6a6a and Table Table3).3). In order to extend the comparison between the two data sets, we used Biogrid [36,37] and Osprey [38] to identify and visualize functional relationships between differentially expressed genes and those whose deletion suppresses cdc13-1 temperature sensitivity. These functional relationships are based upon protein-protein interactions, co-lethality, co-expression across large numbers of microarray experiments and co-citation in the literature. We were particularly interested in a gene called BNA2, because it was highly and significantly up-regulated in cdc13-1 strains (Figure (Figure6b).6b). Differential expression of BNA2 was not observed in the absence of telomerase [22], although it is expressed in response to environmental stress [24]. Biogrid analysis revealed that BNA2 interacts genetically with a cdc13-1 suppressor, NPT1 [35], as co-deletion of these genes is synthetically lethal (Figure (Figure6c).6c). NPT1 is not differentially expressed when telomeres are uncapped in cdc3-1 strains. BNA2 encodes a tryptophan 2,3-dioxygenase required for biosynthesis of nicotinic acid (an NAD+ precursor) from tryptophan via the kynurenine pathway [39], while NPT1 encodes a nicotinate phosphoribosyltransferase that acts in the salvage pathway of NAD+ biosynthesis and is required for telomeric silencing [40].

Table 3
Genes differentially regulated in cdc13-1 strains that suppress temperature sensitivity of cdc13-1
Figure 6
Differentially expressed genes that suppress the temperature sensitivity of cdc13-1. (a) Genes that were differentially expressed in cdc13-1 strains and those that suppress cdc13-1 temperature sensitivity [35] were plotted using a Venn diagram. (b) Normalized ...

NAD+ biosynthetic genes and telomere capping

In order to determine whether BNA2, like NPT1, interacts genetically with cdc13-1, we deleted BNA2 and NPT1 in the W303 strain background and compared the abilities of these gene deletions to suppress the temperature sensitivity of cdc13-1 strains. Deletion of BNA2 suppresses the temperature sensitivity of cdc13-1 strains to similar levels as deletion of NPT1, allowing cells to grow at 26°C (Figure (Figure7a7a).

Figure 7
NAD+ biosynthetic genes and Sirtuin function. (a) Six-fold serial dilutions of the indicated strains were spotted onto YEPD plates and grown for 3 days at the indicated temperatures before being photographed. WT, wild type. (b) Six-fold serial dilutions ...

NAD+ is a ubiquitous biomolecule that is essential for life in all organisms, both as a coenzyme for oxidoreductases and as a source of ADP ribosyl groups [41]. We wondered whether there may be a link between NAD+ metabolism and telomere uncapping. NPT1 and BNA2 are both involved in NAD+ biosynthesis and deletion of both suppresses the temperature sensitivity of cdc13-1 strains. Additionally, genes associated with the GO term 'nicotinamide metabolic process' are over-represented in a list of cdc13-1 differentially expressed genes that are not cell cycle regulated (Table D in Additional data file 4). 'Nicotinamide metabolic process' is a GO term that encompasses genes involved in both the synthesis and the consumption of NAD+ and its derivatives [42]. The majority of the differentially expressed genes associated with this GO term are up-regulated. Three genes with direct roles in NAD+ biosynthesis are differentially expressed when telomeres are uncapped in cdc13-1 strains. BNA2 and PNC1, which is involved in the NAD salvage pathway [40], are up-regulated, while a down-regulated gene, NMA1 [43], plays roles in both the salvage and the de novo pathways. Because a yeast cell must be able to utilize at least one of these pathways to survive and NMA1 is not an essential gene, NMA1 is clearly not vital for the synthesis of NAD+. This may be because there is a second enzyme called Nma2 with the same biochemical activity as Nma1. Thus, up-regulation of BNA2 and PNC1 could lead to increased NAD+ synthesis when telomeres are uncapped. Increased NAD+ levels may be required for the response to telomere uncapping because biological processes that increase in cdc13-1 strains include energy production and oxidative phosphorylation (Table A in Additional data file 4), which require NAD+ and other up-regulated 'nicotinamide metabolic process' genes that encode products that utilize NAD+ or its derivatives, including NDE1 and NDE2, which are involved in NADH oxidation, and YEF1, GND2, and SOL4, which are involved in the synthesis of NADP or NADPH.

NAD+ is also required for the activity of Sirtuins, which are deacetylases with conserved roles in DNA repair, heterochromatin formation and lifespan determination [44]. Telomere maintenance appears to be a conserved function of Sirtuins as, in yeast, they are known to play roles in telomeric silencing [44], and SIRT6, a human Sirtuin, is required for modulation of telomeric chromatin [45].

We wondered whether deletion of BNA2 suppresses cdc13-1 temperature sensitivity via an effect upon Sirtuin function. We hypothesized that bna2Δ strains may contain reduced NAD+ levels when telomeres are uncapped. This may cause decreased Sirtuin activity, leading to reduction of telomeric silencing and increasing accessibility of uncapped chromosomes to the DNA repair machinery. If deletion of BNA2 rescues the temperature sensitivity of cdc13-1 strains via a reduction in Sirtuin function, deletion of Sirtuin genes should also have positive effects upon the growth of cdc13-1 mutants at high temperatures. To test this, we deleted SIR2, and the functionally related SIR4 gene, in cdc13-1 strains. However, in contrast to deletion of BNA2, deletion of SIR2 or SIR4 exacerbates the temperature sensitive phenotype of cdc13-1 strains (Figure (Figure7b).7b). Therefore, we conclude that because deletion of BNA2 has opposite effects upon the temperature sensitivity of cdc13-1 to deletions of SIR2 or SIR4, bna2Δ does not suppress cdc13-1 by inhibiting Sirtuin function. To confirm this, we also grew cdc13-1 strains in the presence of nicotinamide, which inhibits Sirtuin function. Consistent with our observation that abrogation of Sirtuin function is deleterious to cdc13-1 strains, nicotinamide inhibited the growth of cdc13-1 strains, while isonicotinamide, which stimulates Sirtuin function, enhanced the growth of cdc13-1 strains (Figure (Figure7c7c).

To determine whether BNA2 is required to maintain NAD+ levels upon telomere uncapping in cdc13-1 strains, we directly quantified intracellular NAD+. Firstly, we measured NAD+ in wild type, npt1Δ, bna2Δ and cdc13-1 strains grown in rich medium at 23°C (Figure (Figure7d).7d). Deletion of BNA2 did not reduce NAD+ levels under these growth conditions. This was expected because deletion of BNA1, which is in the same linear NAD+ biosynthetic pathway as BNA2, has no discernible effects upon intracellular NAD+ levels unless nicotinic acid is limiting [40]. In contrast, and as previously observed [46], deletion of NPT1 did lead to a reduction in intracellular NAD+ levels. At 23°C, NAD+ levels in cdc13-1 strains were comparable to those recorded in wild-type strains. We also measured NAD+ levels after telomere uncapping in cdc13-1 strains 2 and 4 hours after a shift to 30°C, and showed that they did not change notably (Figure (Figure7d).7d). In order to determine whether BNA2 is required to augment NAD+ consumed during the response to telomere uncapping, we also examined NAD+ levels in cdc13-1 bna2Δ strains before and after telomere uncapping (Figure (Figure7e).7e). Surprisingly, we did not observe any reduction in intracellular NAD+ levels upon telomere uncapping in the absence of BNA2. Thus, BNA2 is not required for NAD+ homeostasis in response to telomere uncapping but our data do not formally rule out that increased BNA2 expression boosts NAD+. We attempted to over-express BNA2 from a galactose-inducible plasmid to see if this increased intracellular NAD+ levels, but found that simply growing cells in galactose led to very high intracellular NAD+ levels (data not shown). Telomere uncapping in cdc13-1 strains induces expression of genes involved in de novo NAD+ synthesis and also in NAD+ salvage. Thus, when telomeres are uncapped in the absence of BNA2, intracellular NAD+ levels may be maintained by the NAD+ salvage pathway. Further experiments are required to determine the mechanism by which BNA2 affects telomere capping and whether this is related to its role in NAD+ biosynthesis.


The genome-wide response to telomere uncapping in cdc13-1 strains

Uncapped telomeres are dangerous to unicellular and multicellular organisms as they are precursors to genomic instability [1]. Hence, conserved cellular responses to damaged telomeres have evolved. Telomere damage in budding yeast leads to a cell cycle arrest [1,6,22,47] that resembles replicative senescence induced by uncapped telomeres in mammalian cells [7,48]. Here we show that, in response to acute telomere damage in cdc13-1 yeast strains, cells mount a transcriptional response that exhibits distinct features and that also encompasses aspects of the responses in yeast to the absence of telomerase [22], the DDR [27] and the ESR [24]. Furthermore, the response to uncapped telomeres in cdc13-1 budding yeast strains has features in common with the responses to telomere damage in Schizosaccharomyces pombe [49] and in mammalian cells [50].

Telomere damage induces a response distinct from the DDR

A major question is whether uncapped telomeres are recognized simply as DSBs or whether the cell senses them as a distinct type of damage. The majority of genes altered in cdc13-1 strains have not thus far been implicated in the DDR, showing that the response to uncapped telomeres is not identical to the response to DSBs at non-telomeric loci. The response to telomerase deletion was also sufficiently different to the DDR for the same conclusion to be drawn [22]. Thus, we confirm that the general cellular response to telomere damage is distinct from the response to DSBs. It is noteworthy that, while telomere uncapping in cdc13-1 strains is associated with the differential expression of many genes involved in the DDR, absent are most of those that are known to be critical for the checkpoint arrest, such as MEC1, DDC2, RAD9, RAD24, DDC1, MEC3, RAD17, RAD53 and CHK1 [1,3]. Many of these are kinases or kinase regulators and, therefore, may not be expected to be transcriptionally regulated. In fact, differential expression of checkpoint genes was not observed in response to ionizing radiation in S. cerevisiae [27] or S. pombe [51], suggesting that these genes are primarily regulated at the post-translational level. One exception is the DDR kinase-encoding gene DUN1, which is up-regulated in cdc13-1 strains and in response to other cellular insults [27,51]. Interestingly, DUN1 is also induced in senescent human retinal pigment epithelial cells with shortened telomeres [52], suggesting that its altered expression may be a common feature in response to telomere damage.

Induction of a stress response may be a conserved feature of the response to telomere damage

A major feature of the response to telomere damage in cdc13-1 strains and to the absence of telomerase is the induction of genes involved in the ESR. Telomerase deletion in S. pombe is associated with the differential expression of many genes that are also involved in the ESR [49]. A microarray analysis of replicative senescence comparing young human fibroblasts with senescent fibroblasts with shortened telomeres demonstrated that genes involved in stress responses were altered [50], suggesting that telomere damage in mammalian cells is also perceived as a stress. Thus, it appears that the induction of stress responses when telomeres are damaged may be conserved.

NAD+ synthetic genes have roles in telomere capping

BNA2 is highly and significantly up-regulated when telomeres are uncapped in cdc13-1 strains and is involved in de novo NAD+ synthesis [39]. Identification of a functional interaction between BNA2 and a suppressor of cdc13-1 temperature sensitivity, NPT1, suggested that a bna2Δ might also suppress it (Figure (Figure6c).6c). This was confirmed as deletion of BNA2 allowed growth of cdc13-1 strains at 26°C (Figure (Figure7a).7a). That Bna2 inhibits the growth of yeast with telomere capping defects indicates that Bna2 possesses a previously unknown role in the cellular response to telomere uncapping. NPT1 is also involved in the generation of NAD+ [40]. Thus, NAD+ metabolism may be linked to responses to telomere uncapping. In support of this hypothesis, GOstats analysis of genes altered in cdc13-1 strains but not periodically expressed during the cell cycle revealed that genes involved in nicotinamide metabolism were over-represented. It is also noteworthy that genes involved in nicotinate and nicotinamide metabolism were over-represented in the list of genes differentially expressed in senescent human fibroblasts with shortened telomeres [50]. Because NAD+ is required for the activity of Sirtuins, we investigated whether deletion of BNA2 was exerting its effects upon cdc13-1 via modulation of Sirtuin function. Our experiments suggest that this is not the case (Figure 7b,c). It is likely that deletion of NPT1 reduces Sirtuin activity [40,46]. Reduced Sirtuin function has adverse effects upon cdc13-1 (Figure 7b,c), but despite this, npt1Δ suppresses the temperature sensitivity of cdc13-1 (Figure (Figure7a)7a) [35]. Thus, cdc13-1 suppression in npt1Δ strains is likely also independent of any role in modulation of Sirtuin function. NAD+ is an abundant biomolecule with many roles within the cell. Further experiments will investigate whether the roles of BNA2 and NPT1 in telomere capping are related to other aspects of NAD+ regulation and, if so, how this affects telomere function.


Dysregulation of telomere capping is associated with aging and carcinogenesis. To better understand eukaryotic responses to telomere uncapping, we examined the genome-wide transcriptional response to telomere uncapping in cdc13-1 yeast strains. The response to uncapped telomeres in cdc13-1 strains has features in common with responses to the absence of telomerase, environmental stress, and to DNA damage at non-telomeric loci. Induction of stress responses appears to be a conserved feature of the eukaryotic response to telomere damage. The BNA2 gene, involved in NAD+ synthesis, is highly and significantly induced when telomeres are uncapped in yeast, and its gene product acts to inhibit growth of cdc13-1 mutants. From this, and complementary experiments, we conclude that genes involved in NAD+ metabolism play roles in telomere end protection, which has implications for aging and carcinogenesis.

Materials and methods

Strains, media and growth conditions

All strains used in the microarray study were in the S288C background (Table (Table4).4). All strains used for spot tests were in the W303 genetic background (Table (Table4).4). Cultures were grown in YEPD supplemented with 50 mg/l adenine. Strains for microarray study were grown in medium derived from a single batch. To construct strains, standard genetic procedures of transformation and tetrad analysis were used [53].

Table 4
Strains used in this study

Culture growth, sample collection, RNA isolation and microarray processing

Cultures were grown overnight at 23°C to a density of 3-4 × 106cells/ml and diluted as described previously [23]. Cultures were transferred to restrictive temperatures and no further dilutions were made thereafter. Aliquots were taken at each time point to assess cell cycle arrest, viability and cell numbers as described previously [23]. Samples were harvested by spinning at 3,000 rpm for 2 minutes before being snap frozen. RNA was isolated using a hot phenol method followed by purification using Qiagen (Crawley, West Sussex, UK) RNeasy columns [54]. cDNA was prepared, labeled and hybridized to Affymetrix GeneChip Yeast Genome 2.0 arrays, according to the manufacturer's instructions. Arrays were scanned with an Affymetrix Genechip Scanner.

Quantitative RT-PCR

RNA was prepared as described above and treated with DNAse I from Invitrogen (Paisley, Renfrewshire, UK), according to the manufacturer's instructions. RT-PCRs were carried out using the Invitrogen Superscript III Platinum SYBR green one-step qRT-PCR kit, as prescribed by the manufacturer, using an ABI (Warrington, Cheshire, UK) prism 7700 sequence detector. PCR primers (Table (Table5)5) were from Sigma Genosys (Gillingham, Dorset, UK) and were designed using the Invitrogen OligoPerfect designer. In all cases, each measurement was performed in triplicate. Correction factors to normalize RNA concentrations of each sample were generated by quantification of up to three loading controls (ACT1, PAC2 and BUD6). Where indicated, the geometric means of multiple loading controls were calculated [55].

Table 5
Primers for Q RT-PCR

Analysis of microarray data

CEL files and MIAME-compliant information for those files were stored internally in the CISBAN SyMBA repository [56]. SyMBA is an open-source project that provides an archive and web interface for multi-omics experimental data and associated metadata. Raw data is publicly available from the ArrayExpress website, accession number E-MEXP-1551. To identify significant differentially expressed genes whose expression was altered in cdc13-1 strains relative to CDC13+ at least two-fold during at least one time point in all three replicates, CEL files were loaded into Bioconductor [57] and the data normalized using RMA. The list of significantly differentially expressed genes used for subsequent analysis was based on the limma contrasts 'm1-w1', 'm2-w2', 'm3-w3', 'm4-w4'. The probe sets with F-test p-value (adjusted using the 'Bonferroni' method for multiple testing) lower than 0.05 are identified as significantly differentially expressed. GOstats analyses [26] were carried out using GOstats version 2.6.0 and data were subjected to conditional hypergeometric tests with a cut-off of 0.01.

Creation of W303 deletion strains

Deletion constructs were amplified by PCR from S288C gene deletion library strains, in which genes have been replaced with a KANMX cassette [58]. Primers are described in Table Table6.6. PCR fragments were transformed into the diploid W303 strain DDY145 (cdc13-1/CDC13+rad9::HIS3/RAD9+) as described previously [59], with an additional incubation for 2 hours at 23°C at the end of the protocol. Transformants were selected based upon G418 resistance and gene deletions were confirmed by PCR, using forward (5') primers (Table (Table6)6) and reverse primer 1261 (TCAGCATCCATGTTGGAATT), which anneals to the G418 cassette. Diploids were sporulated, tetrads dissected and progeny selected.

Table 6
PCR primers for W303 deletion strains

Spot tests

Cultures (2 ml) were grown overnight to saturation, diluted to OD600 = 1 and then subjected to a six-fold dilution series in a 96-well plate using sterile water. We spotted 3-5 μl onto specified plates using a 48-prong replica plating device and plates were incubated at specified temperatures for 3 days before being photographed.

NAD+ measurements

NAD+ measurements were made using a BioAssay Systems (Hayward, CA, USA) EnzyChrom NAD+/NADH Assay kit. Cultures (2 ml) were grown overnight to saturation, diluted to OD600 = 0.5 in 5 ml and allowed to double. OD600 measurements were taken before cultures were harvested and pellets resuspended in 125 μl NAD+ extraction buffer. Ice-cold acid-washed glass beads (0.25 ml) were added. Lysis was achieved by applying samples to a Stretton Scientific (Stretton, Derbyshire, UK) Precellys 24 for 2 × 10 seconds at 6,500 rpm. Samples were recovered and assays were carried out according to the kit manufacturer's instructions. NAD+ levels in each sample were quantified in duplicate. Correction factors based upon OD measurements were generated to account for increases in cell size after cell cycle arrest and applied to calculated NAD+ concentrations.


DDR: DNA-damage response; ds: double stranded; DSB: double-strand break; ESR: environmental stress response; GO: Gene Ontology; QT: quality threshold; ss: single-stranded; STRE: stress-response element.

Authors' contributions

AG designed and carried out the majority of the experiments, analyzed the data and drafted and edited the manuscript. GL, DCS, and DJW processed and analyzed array data. KJ and AW carried out GOstats analysis. LW and HP carried out experiments. DL designed experiments and drafted and edited the manuscript.

Additional data files

The following additional data are available with the online version of this paper. Additional data file 1 is a figure showing RT-PCR analysis of heat shock gene expression. Additional data file 2 is a figure showing quality control of microarray strains and samples. Additional data file 3 includes tables listing differentially expressed genes in cdc13-1 strains and genes in QT clusters 1-13. Additional data file 4 includes tables listing results from GOstats analyses. Additional data file 5 is a figure showing expression of HSP12, MSC1 and CTT1 during the microarray time course. Additional data file 6 includes tables listing differentially expressed genes in both cdc13-1 and tlc1Δ and genes altered in cdc13-1 but not in tlc1Δ. Additional data file 7 includes tables listing transcription factor genes up-regulated and down-regulated in cdc13-1 strains.

Supplementary Material

Additional data file 1:

RT-PCR analysis of heat shock gene expression.

Additional data file 2:

Quality control of microarray strains and samples.

Additional data file 3:

Table A lists differentially expressed genes in cdc13-1 strains. Tables B-N list genes in QT clusters 1-13, respectively.

Additional data file 4:

Table A shows GOstats analysis of up-regulated genes. Table B shows GOstats analysis of down-regulated genes. Table C shows GOstats analysis of genes altered in CDC13+ strains. Table D shows GOstats analysis of genes altered in cdc13-1 strains that are not cell cycle regulated. Tables E-Q show GOstats analysis of genes in QT clusters 1-13 respectively.

Additional data file 5:

Expression of HSP12, MSC1 and CTT1 during the microarray time course.

Additional data file 6:

Table A lists differentially expressed genes in both cdc13-1 and tlc1Δ. Table B lists genes altered in cdc13-1 but not in tlc1Δ.

Additional data file 7:

Table A lists transcription factor genes up-regulated in cdc13-1 strains. Table B lists transcription factor genes down-regulated in cdc13-1 strains.


We would like to thank Jürg Bähler for critical reading of the manuscript and members of CISBAN for helpful discussions. We are grateful to Stephen Addinall for help with BioGrid and to Allyson Lister for assistance with the ArrayExpress submission. This work was supported by the BBSRC CISBAN grant (BB/C008200/1).


  • Lydall D. Hiding at the ends of yeast chromosomes: telomeres, nucleases and checkpoint pathways. J Cell Sci. 2003;116:4057–4065. doi: 10.1242/jcs.00765. [PubMed] [Cross Ref]
  • Longhese MP, Foiani M, Muzi-Falconi M, Lucchini G, Plevani P. DNA damage checkpoint in budding yeast. EMBO J. 1998;17:5525–5528. doi: 10.1093/emboj/17.19.5525. [PMC free article] [PubMed] [Cross Ref]
  • Longhese MP. DNA damage response at functional and dysfunctional telomeres. Genes Dev. 2008;22:125–140. doi: 10.1101/gad.1626908. [PMC free article] [PubMed] [Cross Ref]
  • Cech TR. Beginning to understand the end of the chromosome. Cell. 2004;116:273–279. doi: 10.1016/S0092-8674(04)00038-8. [PubMed] [Cross Ref]
  • Lundblad V, Blackburn EH. An alternative pathway for yeast telomere maintenance rescues est1-senescence. Cell. 1993;73:347–360. doi: 10.1016/0092-8674(93)90234-H. [PubMed] [Cross Ref]
  • Lundblad V, Szostak JW. A mutant with a defect in telomere elongation leads to senescence in yeast. Cell. 1989;57:633–643. doi: 10.1016/0092-8674(89)90132-3. [PubMed] [Cross Ref]
  • d'Adda di Fagagna F, Reaper PM, Clay-Farrace L, Fiegler H, Carr P, Von Zglinicki T, Saretzki G, Carter NP, Jackson SP. A DNA damage checkpoint response in telomere-initiated senescence. Nature. 2003;426:194–198. doi: 10.1038/nature02118. [PubMed] [Cross Ref]
  • Zubko MK, Lydall D. Linear chromosome maintenance in the absence of essential telomere-capping proteins. Nat Cell Biol. 2006;8:734–740. doi: 10.1038/ncb1428. [PubMed] [Cross Ref]
  • Garvik B, Carson M, Hartwell L. Single-stranded DNA arising at telomeres in cdc13 mutants may constitute a specific signal for the RAD9 checkpoint. Mol Cell Biol. 1995;15:6128–6138. [PMC free article] [PubMed]
  • Grandin N, Damon C, Charbonneau M. Cdc13 prevents telomere uncapping and Rad50-dependent homologous recombination. EMBO J. 2001;20:6127–6139. doi: 10.1093/emboj/20.21.6127. [PMC free article] [PubMed] [Cross Ref]
  • Blasco MA. Telomeres and human disease: ageing, cancer and beyond. Nat Rev Genet. 2005;6:611–622. doi: 10.1038/nrg1656. [PubMed] [Cross Ref]
  • Lin JJ, Zakian VA. The Saccharomyces CDC13 protein is a single-strand TG1-3 telomeric DNA-binding protein in vitro that affects telomere behavior in vivo. Proc Natl Acad Sci USA. 1996;93:13760–13765. doi: 10.1073/pnas.93.24.13760. [PMC free article] [PubMed] [Cross Ref]
  • Nugent CI, Hughes TR, Lue NF, Lundblad V. Cdc13p: a single-strand telomeric DNA-binding protein with a dual role in yeast telomere maintenance. Science. 1996;274:249–252. doi: 10.1126/science.274.5285.249. [PubMed] [Cross Ref]
  • Evans SK, Lundblad V. Est1 and Cdc13 as comediators of telomerase access. Science. 1999;286:117–120. doi: 10.1126/science.286.5437.117. [PubMed] [Cross Ref]
  • Pennock E, Buckley K, Lundblad V. Cdc13 delivers separate complexes to the telomere for end protection and replication. Cell. 2001;104:387–396. doi: 10.1016/S0092-8674(01)00226-4. [PubMed] [Cross Ref]
  • Bianchi A, Negrini S, Shore D. Delivery of yeast telomerase to a DNA break depends on the recruitment functions of Cdc13 and Est1. Mol Cell. 2004;16:139–146. doi: 10.1016/j.molcel.2004.09.009. [PubMed] [Cross Ref]
  • Maringele L, Lydall D. EXO1-dependent single-stranded DNA at telomeres activates subsets of DNA damage and spindle checkpoint pathways in budding yeast yku70Delta mutants. Genes Dev. 2002;16:1919–1933. doi: 10.1101/gad.225102. [PMC free article] [PubMed] [Cross Ref]
  • Lydall D, Weinert T. Yeast checkpoint genes in DNA damage processing: implications for repair and arrest. Science. 1995;270:1488–1491. doi: 10.1126/science.270.5241.1488. [PubMed] [Cross Ref]
  • Qi H, Li TK, Kuo D, Nur EKA, Liu LF. Inactivation of Cdc13p triggers MEC1-dependent apoptotic signals in yeast. J Biol Chem. 2003;278:15136–15141. doi: 10.1074/jbc.M212808200. [PubMed] [Cross Ref]
  • Wysocki R, Kron SJ. Yeast cell death during DNA damage arrest is independent of caspase or reactive oxygen species. J Cell Biol. 2004;166:311–316. doi: 10.1083/jcb.200405016. [PMC free article] [PubMed] [Cross Ref]
  • Weinert TA, Kiser GL, Hartwell LH. Mitotic checkpoint genes in budding yeast and the dependence of mitosis on DNA replication and repair. Genes Dev. 1994;8:652–665. doi: 10.1101/gad.8.6.652. [PubMed] [Cross Ref]
  • Nautiyal S, DeRisi JL, Blackburn EH. The genome-wide expression response to telomerase deletion in Saccharomyces cerevisiae. Proc Natl Acad Sci USA. 2002;99:9316–9321. doi: 10.1073/pnas.142162499. [PMC free article] [PubMed] [Cross Ref]
  • Zubko MK, Maringele L, Foster SS, Lydall D. Detecting repair intermediates in vivo: effects of DNA damage response genes on single-stranded DNA accumulation at uncapped telomeres in budding yeast. Methods Enzymol. 2006;409:285–300. doi: 10.1016/S0076-6879(05)09016-6. [PubMed] [Cross Ref]
  • Gasch AP, Spellman PT, Kao CM, Carmel-Harel O, Eisen MB, Storz G, Botstein D, Brown PO. Genomic expression programs in the response of yeast cells to environmental changes. Mol Biol Cell. 2000;11:4241–4257. [PMC free article] [PubMed]
  • Smyth GK. Linear models and empirical bayes methods for assessing differential expression in microarray experiments. Stat Appl Genet Mol Biol. 2004;3:Article3. [PubMed]
  • Falcon S, Gentleman R. Using GOstats to test gene lists for GO term association. Bioinformatics. 2007;23:257–258. doi: 10.1093/bioinformatics/btl567. [PubMed] [Cross Ref]
  • Gasch AP, Huang M, Metzner S, Botstein D, Elledge SJ, Brown PO. Genomic expression responses to DNA-damaging agents and the regulatory role of the yeast ATR homolog Mec1p. Mol Biol Cell. 2001;12:2987–3003. [PMC free article] [PubMed]
  • Lee SE, Pellecioli A, Demeter J, Vaze MP, Gasch AP, Malkova A, Brown PO, Botstein D, Stearns T, Foiani M, Haber JE. Biological Responses To DNA Damage. Vol. 65. Plainview, New York: Cold Spring Harbour Laboratory Press; 2000. Genomic expression in yeast responding to HO endonuclease cleavage. pp. 303–314.
  • Martinez-Pastor MT, Marchler G, Schuller C, Marchler-Bauer A, Ruis H, Estruch F. The Saccharomyces cerevisiae zinc finger proteins Msn2p and Msn4p are required for transcriptional induction through the stress response element (STRE). EMBO J. 1996;15:2227–2235. [PMC free article] [PubMed]
  • Orlando DA, Lin CY, Bernard A, Wang JY, Socolar JE, Iversen ES, Hartemink AJ, Haase SB. Global control of cell-cycle transcription by coupled CDK and network oscillators. Nature. 2008;453:944–947. doi: 10.1038/nature06955. [PMC free article] [PubMed] [Cross Ref]
  • Harbison CT, Gordon DB, Lee TI, Rinaldi NJ, Macisaac KD, Danford TW, Hannett NM, Tagne JB, Reynolds DB, Yoo J, Jennings EG, Zeitlinger J, Pokholok DK, Kellis M, Rolfe PA, Takusagawa KT, Lander ES, Gifford DK, Fraenkel E, Young RA. Transcriptional regulatory code of a eukaryotic genome. Nature. 2004;431:99–104. doi: 10.1038/nature02800. [PMC free article] [PubMed] [Cross Ref]
  • Heyer LJ, Kruglyak S, Yooseph S. Exploring expression data: identification and analysis of coexpressed genes. Genome Res. 1999;9:1106–1115. doi: 10.1101/gr.9.11.1106. [PMC free article] [PubMed] [Cross Ref]
  • Askree SH, Yehuda T, Smolikov S, Gurevich R, Hawk J, Coker C, Krauskopf A, Kupiec M, McEachern MJ. A genome-wide screen for Saccharomyces cerevisiae deletion mutants that affect telomere length. Proc Natl Acad Sci USA. 2004;101:8658–8663. doi: 10.1073/pnas.0401263101. [PMC free article] [PubMed] [Cross Ref]
  • Gatbonton T, Imbesi M, Nelson M, Akey JM, Ruderfer DM, Kruglyak L, Simon JA, Bedalov A. Telomere length as a quantitative trait: genome-wide survey and genetic mapping of telomere length-control genes in yeast. PLoS genetics. 2006;2:e35. doi: 10.1371/journal.pgen.0020035. [PMC free article] [PubMed] [Cross Ref]
  • Addinall S, Downey M, Yu M, Zubko MK, Dewar J, Leake A, Hallinan J, Shaw O, James K, Wilkinson DJ, Wipat A, Durocher D, Lydall D. A genome-wide suppressor and enhancer analysis of cdc13-1 reveals varied cellular processes influencing telomere capping in Saccharomyces cerevisiae. Genetics. 2008 [PMC free article] [PubMed]
  • Stark C, Breitkreutz BJ, Reguly T, Boucher L, Breitkreutz A, Tyers M. BioGRID: a general repository for interaction datasets. Nucleic Acids Res. 2006;34:D535–539. doi: 10.1093/nar/gkj109. [PMC free article] [PubMed] [Cross Ref]
  • Breitkreutz BJ, Stark C, Reguly T, Boucher L, Breitkreutz A, Livstone M, Oughtred R, Lackner DH, Bahler J, Wood V, Dolinski K, Tyers M. The BioGRID Interaction Database: 2008 update. Nucleic Acids Res. 2008;36:D637–640. doi: 10.1093/nar/gkm1001. [PMC free article] [PubMed] [Cross Ref]
  • Breitkreutz BJ, Stark C, Tyers M. Osprey: a network visualization system. Genome Biol. 2003;4:R22. doi: 10.1186/gb-2003-4-3-r22. [PMC free article] [PubMed] [Cross Ref]
  • Panozzo C, Nawara M, Suski C, Kucharczyka R, Skoneczny M, Becam AM, Rytka J, Herbert CJ. Aerobic and anaerobic NAD+ metabolism in Saccharomyces cerevisiae. FEBS Lett. 2002;517:97–102. doi: 10.1016/S0014-5793(02)02585-1. [PubMed] [Cross Ref]
  • Sandmeier JJ, Celic I, Boeke JD, Smith JS. Telomeric and rDNA silencing in Saccharomyces cerevisiae are dependent on a nuclear NAD(+) salvage pathway. Genetics. 2002;160:877–889. [PMC free article] [PubMed]
  • Bieganowski P, Brenner C. Discoveries of nicotinamide riboside as a nutrient and conserved NRK genes establish a Preiss-Handler independent route to NAD+ in fungi and humans. Cell. 2004;117:495–502. doi: 10.1016/S0092-8674(04)00416-7. [PubMed] [Cross Ref]
  • Saccharomyces Genome Database http://db.yeastgenome.org/cgi-bin/GO/goTerm.pl?goid=6769
  • Anderson RM, Bitterman KJ, Wood JG, Medvedik O, Cohen H, Lin SS, Manchester JK, Gordon JI, Sinclair DA. Manipulation of a nuclear NAD+ salvage pathway delays aging without altering steady-state NAD+ levels. J Biol Chem. 2002;277:18881–18890. doi: 10.1074/jbc.M111773200. [PubMed] [Cross Ref]
  • Michan S, Sinclair D. Sirtuins in mammals: insights into their biological function. Biochem J. 2007;404:1–13. doi: 10.1042/BJ20070140. [PMC free article] [PubMed] [Cross Ref]
  • Michishita E, McCord RA, Berber E, Kioi M, Padilla-Nash H, Damian M, Cheung P, Kusumoto R, Kawahara TL, Barrett JC, Chang HY, Bohr VA, Ried T, Gozani O, Chua KF. SIRT6 is a histone H3 lysine 9 deacetylase that modulates telomeric chromatin. Nature. 2008;452:492–496. doi: 10.1038/nature06736. [PMC free article] [PubMed] [Cross Ref]
  • Smith JS, Brachmann CB, Celic I, Kenna MA, Muhammad S, Starai VJ, Avalos JL, Escalante-Semerena JC, Grubmeyer C, Wolberger C, Boeke JD. A phylogenetically conserved NAD+-dependent protein deacetylase activity in the Sir2 protein family. Proc Natl Acad Sci USA. 2000;97:6658–6663. doi: 10.1073/pnas.97.12.6658. [PMC free article] [PubMed] [Cross Ref]
  • Enomoto S, Glowczewski L, Lew-Smith J, Berman JG. Telomere cap components influence the rate of senescence in telomerase-deficient yeast cells. Mol Cell Biol. 2004;24:837–845. doi: 10.1128/MCB.24.2.837-845.2004. [PMC free article] [PubMed] [Cross Ref]
  • Blackburn EH, Chan S, Chang J, Fulton TB, Krauskopf A, McEachern M, Prescott J, Roy J, Smith C, Wang H. Molecular manifestations and molecular determinants of telomere capping. Cold Spring Harbor Symp Quant Biol. 2000;65:253–263. doi: 10.1101/sqb.2000.65.253. [PubMed] [Cross Ref]
  • Mandell JG, Bahler J, Volpe TA, Martienssen RA, Cech TR. Global expression changes resulting from loss of telomeric DNA in fission yeast. Genome Biol. 2005;6:R1. doi: 10.1186/gb-2004-6-1-r1. [PMC free article] [PubMed] [Cross Ref]
  • Passos JF, Saretzki G, Ahmed S, Nelson G, Richter T, Peters H, Wappler I, Birket MJ, Harold G, Schaeuble K, Birch-Machin MA, Kirkwood TB, von Zglinicki T. Mitochondrial dysfunction accounts for the stochastic heterogeneity in telomere-dependent senescence. PLoS Biol. 2007;5:e110. doi: 10.1371/journal.pbio.0050110. [PMC free article] [PubMed] [Cross Ref]
  • Watson A, Mata J, Bahler J, Carr A, Humphrey T. Global gene expression responses of fission yeast to ionizing radiation. Mol Biol Cell. 2004;15:851–860. doi: 10.1091/mbc.E03-08-0569. [PMC free article] [PubMed] [Cross Ref]
  • Shelton DN, Chang E, Whittier PS, Choi D, Funk WD. Microarray analysis of replicative senescence. Curr Biol. 1999;9:939–945. doi: 10.1016/S0960-9822(99)80420-5. [PubMed] [Cross Ref]
  • Adams A, Gottschling DE, Kaiser CA, Stearns T. Methods in Yeast Genetics. New York: Cold Spring Harbour Laboratory Press; 1997.
  • Lyne R, Burns G, Mata J, Penkett CJ, Rustici G, Chen D, Langford C, Vetrie D, Bahler J. Whole-genome microarrays of fission yeast: characteristics, accuracy, reproducibility, and processing of array data. BMC genomics. 2003;4:27. doi: 10.1186/1471-2164-4-27. [PMC free article] [PubMed] [Cross Ref]
  • Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002;3:RESEARCH0034. doi: 10.1186/gb-2002-3-7-research0034. [PMC free article] [PubMed] [Cross Ref]
  • SyMBA http://symba.sourceforge.net
  • Bioconductor http://www.bioconductor.org
  • Tong AH, Evangelista M, Parsons AB, Xu H, Bader GD, Page N, Robinson M, Raghibizadeh S, Hogue CW, Bussey H, Andrews B, Tyers M, Boone C. Systematic genetic analysis with ordered arrays of yeast deletion mutants. Science. 2001;294:2364–2368. doi: 10.1126/science.1065810. [PubMed] [Cross Ref]
  • Schiestl RH, Gietz RD. High efficiency transformation of intact yeast cells using single stranded nucleic acids as a carrier. Curr Genet. 1989;16:339–346. doi: 10.1007/BF00340712. [PubMed] [Cross Ref]
  • Downey M, Houlsworth R, Maringele L, Rollie A, Brehme M, Galicia S, Guillard S, Partington M, Zubko MK, Krogan NJ, Emili A, Greenblatt JF, Harrington L, Lydall D, Durocher D. A genome-wide screen identifies the evolutionarily conserved KEOPS complex as a telomere regulator. Cell. 2006;124:1155–1168. doi: 10.1016/j.cell.2005.12.044. [PubMed] [Cross Ref]
  • Zubko MK, Guillard S, Lydall D. Exo1 and Rad24 differetially regulate generation of ssDNA at telomeres of Saccharomyces cerevisiae cdc13-1 mutants. Genetics. 2004;168:103–115. doi: 10.1534/genetics.104.027904. [PMC free article] [PubMed] [Cross Ref]

Articles from Genome Biology are provided here courtesy of BioMed Central


Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...


Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...