• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
Mech Dev. Author manuscript; available in PMC Oct 1, 2010.
Published in final edited form as:
PMCID: PMC2757446
NIHMSID: NIHMS142499

Wnt signaling maintains the notochord fate for progenitor cells and supports the posterior extension of the notochord

Abstract

The notochord develops from notochord progenitor cells (NPCs) and functions as a major signaling center to regulate trunk and tail development. NPCs are initially specified in the node by Wnt and Nodal signals at the gastrula stage. However, the underlying mechanism that maintains the NPCs throughout embryogenesis to contribute to the posterior extension of the notochord remains unclear. Here, we demonstrate that Wnt signaling in the NPCs is essential for posterior extension of the notochord. Genetic labeling revealed that the Noto-expressing cells in the ventral node contribute the NPCs that reside in the tail bud. Robust Wnt signaling in the NPCs was observed during posterior notochord extension. Genetic attenuation of the Wnt signal via notochord-specific β-catenin gene ablation resulted in posterior truncation of the notochord. In the NPCs of such mutant embryos, the expression of notochord-specific genes was down-regulated, and an endodermal marker, E-cadherin, was observed. No significant alteration of cell proliferation or apoptosis of the NPCs was detected. Taken together, our data indicate that the NPCs are derived from Noto-positive node cells, and are not fully committed to a notochordal fate. Sustained Wnt signaling is required to maintain the NPCs’ notochordal fate.

Keywords: Notochord, progenitor cells, Wnt, β-catenin, cell fate specification, CreER, lineage tracing

1. Introduction

During mouse embryogenesis, the organizer and its descendant signaling centers play central roles in the establishment of the correct body plan (reviewed in (Davidson and Tam, 2000; Niehrs, 2004; Tam and Behringer, 1997). Among them, the midline mesodermal tissue, the notochord, is the major signaling center controlling trunk and tail development. The notochord expresses both signaling molecules and their antagonists, thereby regulating the differentiation, growth, and patterning of the surrounding tissues (see review by (Cleaver and Krieg, 2001). Development of the notochord proceeds from the anterior toward the posterior through the continuous addition of more-posterior cells in parallel with the posterior extension of the body axis.

The notochord develops from notochord progenitor cells (NPCs), which are initially specified in the ventral layer of the node at the late gastrula stage (Kinder et al., 2001). At later stages, the notochord is formed from the tail bud, which was previously thought to be an undifferentiated blastema (Griffith et al., 1992). However, recent studies in Xenopus and mouse have divided the tail bud into sub-domains, each consisting of a distinct cell population that arises during gastrulation (Cambray and Wilson, 2002; Cambray and Wilson, 2007; Gofflot et al., 1997; Gont et al., 1993). They showed with dye labeling and cell transplantation experiments that the NPCs originating from the ventral layer of the node contribute to wide range of the notochord, including the posterior end of the elongating notochord in the tail bud (Cambray and Wilson, 2002; Tam et al., 1997). However, these analyses are limited to the duration of in vitro culture of mouse embryos (48 hours), and it remains unknown whether the cells originating from the ventral node of E7.5 or E8.5 embryos actually contribute to the posterior end of the notochord at E13.5. Recent live imaging of the EGFP-expressing node cells revealed presence of two cell types. The cells within the node undergo convergent extension movements to constitute the trunk notochord, and the peripheral node cells actively migrate towards the posterior (Yamanaka et al., 2007), most likely to generate posterior notochord extension. The absence of the notochord in ectopic tails induced by mimicking the tail organizer activities in Xenopus and zebrafish embryos also supports the notion that the organizer (containing the equivalent of the mouse node)-derived NPCs form the entire notochord (Agathon et al., 2003; Beck and Slack, 1999; Beck et al., 2001).

Initial specification of NPCs in the node is achieved cooperatively by Wnt and Nodal signals (Lickert et al., 2002; Vincent et al., 2003; Yamamoto et al., 2001). Although the continuous production of notochord cells by the NPCs is critically important to establish the correct body plan, relatively little is known about the mechanisms by which the NPCs are maintained throughout embryogenesis in the tail bud. Notochord development is governed by a set of transcription factors: Foxa2, Brachyury, and Noto (Abdelkhalek et al., 2004; Ang and Rossant, 1994; Herrmann and Kispert, 1994; Weinstein et al., 1994; Yamanaka et al., 2007). Of these, Foxa2 is essential throughout notochord development; the other two are required only for later or posterior notochord development.

Noto cooperates with Foxa2 in trunk notochord development (Yamanaka et al., 2007). To address the mechanism of notochord development, we have examined the regulatory mechanism of Foxa2 in the node and notochord (Nishizaki et al., 2001; Sasaki and Hogan, 1996; Sawada et al., 2005). Our analysis identified the node/notochord enhancer and its core element, which is essential for the enhancer activity and sufficient for gene expression in the NPCs. This core element is regulated by the cooperation of a Tead family transcription factor and a second factor, and it is regulated downstream of the Wnt signal (Sawada et al., 2008; Sawada et al., 2005). Therefore, we hypothesized that Wnt signaling regulates the development of NPCs. This hypothesis is partially supported by the absence of a posterior notochord in mice bearing a mutant Wnt ligand (Wnt3a), Wnt receptor (LRP5 or LRP6), or downstream transcription factor (Lef1 or Tcf1) (Galceran et al., 1999; Kelly et al., 2004; Takada et al., 1994). However, because these mutants completely lack or have abnormal posterior tissues, the role of Wnt signaling in NPC development remains to be established.

Here, we showed by genetic lineage tracing that NPCs of the tail bud originate in the ventral node. Next, we examined the role of Wnt signaling in the posterior notochord extension by conditionally inactivating the β-catenin gene in only the notochord, including the NPCs. We demonstrated that Wnt signaling in the NPCs is absolutely essential for the posterior extension of the notochord. We also demonstrated that the developmental fate of NPCs to become notochord is not pre-determined. The role of Wnt signaling in the NPCs is to maintain their notochordal fate throughout the notochord’s posterior extension.

2. Results

2.1. NPCs in the tail bud proliferate actively

Previous dye-labeling studies showed that the notochord is formed from NPCs that are initially localized to the ventral node and later move to the posterior end of the notochord in the tail bud (Cambray and Wilson, 2002; Cambray and Wilson, 2007; Tam et al., 1997). Although the continuous increase in notochordal mass predicts active proliferation of the NPCs, earlier studies indicate that these cells proliferate little during the period between embryonic day (E)7.5 and E8.25, when they are in the ventral node (Bellomo et al., 1996). We therefore re-investigated cell proliferation in the NPC-containing tissues up to E10.5. Consistent with previous observations, only 1% of the E7.75 ventral node cells was labeled with BrdU (Fig. 1A, C). However, at E9.25 and E10.5 respectively, 39% and 24% of the cells at the posterior end of the notochord incorporated BrdU within a two-hour period, indicating the active proliferation of NPCs (Fig. 1B, C). Therefore, cell proliferation is inactive only before E9, after which the NPCs in the tail bud proliferate actively to generate the long-lasting posterior extension of the notochord.

Figure 1
Proliferation of NPCs during development

2.2. Noto-positive node cells contribute the NPCs of the tail bud, which generate the posterior notochord extension

A recent live-imaging study of Noto+/eGFP knock-in mouse embryos, which express EGFP in the cells of the ventral node and posterior notochord, revealed that the node does not regress posteriorly, and the cells in the node form trunk notochord by convergent-extension movements (Yamanaka et al., 2007). In contrast, the Noto-positive cells located at the peripheral node actively migrate toward the posterior, and probably generate the posterior extension of the notochord (Yamanaka et al., 2007). However, because live imaging is restricted to a single day of observation, it was unresolved whether these Noto-expressing cells actually contributed subsequently to the NPCs of the tail bud and generated the posterior extension of the notochord.

To address this issue, we performed lineage tracing of Noto-positive cells by genetically labeling the cells. For this purpose, we generated NotonmCherry-CreERT2 mice, which express tamoxifen-inducible Cre recombinase (CreERT2) (Feil et al., 1997) from the Noto locus, with homologous recombination in ES cells. In this knock-in line, the coding sequences for nuclear fluorescent protein (Histone H2B-mCherry) (Shaner et al., 2005) and CreERT2 were placed downstream of the Noto coding sequence, with sequences for virus-derived 2A peptides (Szymczak et al., 2004) inserted between the protein coding sequences (Fig. 2A, B). Because 2A peptide-containing proteins are self-cleaved downstream of the 2A peptide, their introduction allows the production of multiple, in this case three, proteins from a single transcript (Szymczak and Vignali, 2005; Szymczak et al., 2004) (Fig. 2A). We confirmed the successful homologous recombination between the Noto loci and deletion of the neomycin-resistance gene cassette (ACN cassette) (Bunting et al., 1999) by Southern blotting and PCR (Fig. 2C-F).

Figure 2
Production of the NotonmCherry-CreERT2/+ mouse

The NotonmCherry-CreERT2 mouse lines were produced from three independent ES cell lines (#58, #62, #74). Because all three knock-in lines exhibited the same phenotype, we used the line derived from ES #62 for most of the analyses. Although we designed the mice to express Noto, approximately half of the NotonmCherry-CreERT2/nmCherry-CreERT2 mice showed various degrees of tail defects (curled, short, or no tail, data not shown), which resembled those of NotoeGFP/eGFP or Nototc/tc mutant mice (Abdelkhalek et al., 2004). Therefore, it is likely that the addition of the 2A peptide to the Noto C-terminus interfered with the activity of the protein, or alternatively, the cleavage of the 2A sequence between Noto and the nuclear mCherry was incomplete.

Consistent with the expression of Noto in the ventral node and posterior notochord between E7.5 and E12.5 (Abdelkhalek et al., 2004; Plouhinec et al., 2004), the mCherry fluorescence was observed in the nuclei of the node and posterior notochord cells between E7.5 and E8.5 (arrowheads in Fig. 3A, A’, B, B’). A faint mCherry signal was also observed in the tail bud in a notochord-like pattern at later stages (arrowheads in Figure 3C, C’ and data not shown). The immunostaining of sections of E9.5 tail for mCherry confirmed the localization of the mCherry protein to the nuclei of notochord cells. Weaker signals were also observed in some of the paraxial mesoderm cells adjacent to the notochord. A similar paraxial expression of EGFP was also reported with NotoeGFP/+ embryos (Yamanaka et al., 2007).

Figure 3
Genetic lineage tracing of Noto-expressing cells

When Cre activity was induced by the oral administration of tamoxifen (Tx) to pregnant female mice at E8.5, the posterior notochord cells of NotonmCherry-CreERT2/+;ROSA26LacZ/+ embryos were β-galactosidase-positive at E9.5 (Fig. 3D). In contrast, no labeled cells were observed without induction by Tx (Fig. 3E), suggesting that the self-cleavage at the 2A peptide between nuclear mCherry and CreERT2 took place efficiently. Tx administration at E7.75 led to dense labeling of the ventral node and sparse labeling of the posterior notochord at E8.5 (Fig. 3F). At E9.5, the labeling was present in a wide range of posterior notochord cells, including cells at the posterior end of the tail bud (Fig. 3G, H), indicating a broad distribution of NPCs. Because not all the ventral node cells were labeled with this protocol, the distribution of labeled cells in the notochord often appeared discontinuous. Similar labeling of the NPCs and posterior notochord was observed in E12.5 and E13.5 embryos (Fig. 3I and data not shown), but a scattered and segmental distribution of labeled cells in the non-notochordal mesoderm gradually became evident as development proceeded (asterisks in Fig. 3G, I, L). The contribution of Noto-positive cells to non-notochordal mesoderm is consistent with a previous observation that a minor population of eGFP-positive cells contributes to the non-notochordal mesoderm in NotoeGFP/+ embryos (Yamanaka et al., 2007).

Finally, to restrict the Cre induction period to early stages, we also examined the effect of Tx administration at E6.5, when Noto is expressed in the anterior primitive streak (Plouhinec et al., 2004), the location of the presumptive NPCs (Kinder et al., 2001). At E7.5, dense labeling was observed in the ventral node, and sparse labeling in the anterior midline (Fig. 3J). At E10.5, strong labeling was observed in the posterior notochord (Fig. 3K, L), which was essentially the same pattern as obtained when Tx was administered at E7.75. Taken together, these results are consistent with the hypothesis that the NPCs of the tail bud originate from the Noto-positive cells of E7.5 to E8.5 embryos, which are probably the peripheral node cells that migrate toward the posterior, and that these cells generate the posterior extension of the notochord.

2.3. Active Wnt signaling co-localizes with NPCs

To address the mechanism by which the Noto-positive cells generate the posterior notochord extension in the tail bud, we focused on the Wnt signal, because mouse mutants of various Wnt signaling components (Galceran et al., 1999; Kelly et al., 2004; Takada et al., 1994) lack a posterior trunk, but the role of Wnt signaling in posterior notochordal development has not been established. Because our previous study on Foxa2, an essential gene for node/notochord development, suggested that the control of NPC gene expression is downstream of Wnt signaling (Sawada et al., 2005), we first examined whether Wnt signaling was active in the NPCs. In an extension of previous studies that showed active Wnt signaling in the E7.5-8.5 node by using the transgenic Wnt reporter lines BAT-gal, BATlacZ, and TOPGAL (Maretto et al., 2003; Merrill et al., 2004; Nakaya et al., 2005), we investigated Wnt signaling in the NPCs after E8.5. Expression of the Wnt reporter gene TOPGAL in transgenic embryos was studied from E8.5 to E13.5. Strong TOPGAL expression was observed in the ventral layer of the E8.5 node, confirming previous reports (Fig. 4A). Strong TOPGAL activity was also detected in the posterior notochordal region, with a decrease in activity in the anterior notochord at E8.75 and E9.5 (Fig. (Fig.4B,4B, ,5G).5G). Thus, robust Wnt signaling is active in the tissue area where NPCs reside.

Figure 4
Activation of Wnt signaling in the NPCs
Figure 5
Attenuation of Wnt signaling by notochord-specific ablation of the β-catenin gene

Since the posterior extension of the tail continues until E13, NPCs are presumably maintained until this stage. Until E12.5, TOPGAL expression patterns similar to those at E9.5 were observed in the tail region, but TOPGAL began to decrease at E12.5 (Fig. 4C, D) and was barely detectable by E13.5 (Figure 4E). Therefore, TOPGAL expression coincided with the expected localization of the NPCs.

To corroborate our findings on TOPGAL expression, we used a second transgenic Wnt reporter line, ins-TOPGAL (Moriyama et al., 2007), in which the transgene is flanked by the core element of the chicken β-globin HS4 insulator (Recillas-Targa et al., 2002) to eliminate the effects of surrounding genes. The ins-TOPGAL generally leads to a stronger and broader expression of β-galactosidase than TOPGAL. Although ins-TOPGAL was expressed in all the tissues in the posterior embryo around E9.5 (Fig. 4G), the faster development of the reaction product in the posterior notochord clearly indicated that its expression was much stronger in the posterior notochord than in the surrounding tissues (Fig. 4H, I). Taken together, these data indicate that Wnt signaling is strongly active in the NPCs.

2.4. Notochord-specific gene ablation of β-catenin

To clarify the role of Wnt signaling in the NPCs, we conditionally inactivated the β-catenin gene by the combined use of floxed β-catenin (Brault et al., 2001) and a second notochord-specific Cre transgene, Not-Cre. The Not-Cre mouse is an enhancer trap line (see Experimental Procedures). We used this constitutive Cre line for the complete deletion of β-catenin, because the deletion by induced Cre with NotonmCherry-CreERT2/+ was much less effective, and the resulting mutant embryos showed no apparent abnormalities (data not shown). The Not-Cre transgenic embryos exhibited detectable Cre activity in notochord from E8.25, and after E8.5, its strong activity prevailed the entire notochord (Fig. 5A-D). In normal embryo at E9.25, β-catenin protein strongly accumulated in the notochord, while Not-Cre;β-cateninflox/flox embryos showed notchord-specific reduction of β-catenin accumulation (Fig. 5E, F). Consistently, in Not-Cre;β-cateninflox/flox embryos, TOPGAL expression in the posterior notochord was clearly reduced after E9.25, which followed β-catenin ablation (Fig. 5G-J). The significantly weaker β-galactosidase signals in these sections clearly indicated reduced TOPGAL expression in individual notochord cells (Fig. 5I, J). Thus, in Not-Cre;β-cateninflox/flox embryos, Wnt signaling in the NPCs was reduced after E9.25, and this was utilized in the further analyses.

2.5. Attenuation of posterior notochord development via β-catenin ablation

The gross morphology of embryos was not significantly altered after notochordal β-catenin ablation at E9.5, but histological analysis indicated that the posterior notochord was smaller (Fig. 5G-J, 6A, B). At E10.5, β-catenin-ablated embryos showed a bent and shortened tail that lacked a notochord (Figures 6C-F). These embryos developed to term and survived at least to weaning age. However, they lacked a tail and their posterior vertebrae were truncated at the lumbar region (L6) or the first sacral vertebra (S1) (Fig. 6G, H and data not shown). These results indicate that Wnt signaling in the NPCs is required for the posterior extension of the notochord and for the complete development of the tail.

Figure 6
Not-Cre;β-cateninflox/flox mutants lack a posterior notochord

2.6. Altered gene expression profile at the notochord posterior end

We examined whether the identity of NPCs was still maintained if Wnt signaling was inhibited. Noto is expressed specifically in the posterior end of the notochord (Abdelkhalek et al., 2004; Plouhinec et al., 2004), and Noto expression was dramatically reduced in the Not-Cre;β-cateninflox/flox mutants (Fig. 7A, B). However, notochord-like tissue was still morphologically identifiable on sections in the absence of Noto expression (Fig. 7C, D, n = 8/8). When notochordal β-catenin was ablated, Brachyury expression in the posterior notochord (Wilkinson et al., 1990) was clearly reduced without significantly affecting its expression in the anterior notochord (Fig. 7E-J, n = 6/6). Similarly, the expression of Sonic hedgehog (Shh) was dramatically reduced, but again only in the posterior notochord (Echelard et al., 1993) (Fig. 7K, L and data not shown, n = 5/5).

Figure 7
Not-Cre;β-cateninflox/flox embryos showed altered gene expression and unaltered cell proliferation and survival at the end of the posterior notochord

We further investigated the nature of the notochord-like tissue that formed in the posterior region even in the absence of Noto, Brachyury, or Shh. Interestingly, Foxa1 and Foxa2, which are expressed in both the notochord and the endoderm (Sasaki and Hogan, 1993), were expressed in the mutant embryos at normal levels (Fig. 7M-P, n = 5/5 and n = 5/5, respectively). We therefore examined the possibility that the NPCs’ fate had been re-specified to an endodermal one. Indeed, notochord-specific β-catenin ablation resulted in the ectopic expression of E-cadherin, which is expressed in the endoderm but not in the notochord (Nose and Takeichi, 1986), in the posterior notochord at E9.5 (Fig. 7Q, Q’, R, R’, n = 7/7). The frequent accumulation of E-cadherin at cell-cell boundaries in the mutant notochord (data not shown) suggests that cadherin-mediated cell adhesion was maintained in the β-catenin-ablated cells, probably owing to the presence of plakoglobin and/or residual β-catenin. However, we failed to observe an increased expression of other endoderm-specific genes, Rbm35 or Ripk4 (Sherwood et al., 2007) (data not shown). These observations suggest that Wnt/β-catenin signaling is required to maintain the notochordal identity of the NPCs, and under reduced Wnt/β-catenin signaling, the expression of notochord-specific genes is lost and only the genes expressed in both the notochord and the endoderm are maintained.

2.7. No significant alteration in cell proliferation or apoptosis

Because Wnt signaling often acts as a mitogen in progenitor cells, we next asked whether cell proliferation and survival of the β-catenin-ablated posterior notochord/NPCs was altered, by BrdU labeling and TUNEL staining, at E9.25. Although the total cell number was already reduced in the β-catenin-ablated posterior notochord, the fraction of BrdU-positive cells was comparable to that in normal notochord, indicating that cell proliferation was not significantly affected (Fig. 7S, T, W). Similarly, TUNEL analysis showed similar levels of apoptosis between the wild-type and mutant NPCs (Fig. 7, U, V, X). Taken together, these results indicate that Wnt signaling is required only for the cell-fate specification of NPCs and that it is dispensable for their proliferation.

3. Discussion

3.1 Origin of the NPCs in the tail bud

We have shown with genetic cell labeling that the Noto-expressing ventral node cells contribute the NPCs that generate the entire posterior notochord, including the posterior end, and therefore also contribute the NPCs of the tail bud. Consistent with this observation, previous dye labeling and transplantation experiments showed that NPCs reside in the ventral node, especially in the boundary region between the node and the primitive streak (Beddington, 1994; Cambray and Wilson, 2002; Cambray and Wilson, 2007; Wilson and Beddington, 1996). Noto-expressing cells from this region or the periphery of the node actively migrate toward the posterior (Yamanaka et al., 2007). Taken together, our results are consistent with the hypothesis that Noto-expressing and posteriorly migrating cells from around the node constitute the NPCs in the tail bud, and these cells generate the posterior extension of the notochord.

3.2 Wnt signaling maintains the notochordal fate of NPCs

NPCs in both the ventral node and the tail bud express notochord-specific genes (Gofflot et al., 1997), and when transplanted to ectopic sites, the node produces an ectopic notochord (Beddington, 1994; Kinder et al., 2001). Therefore, NPCs have been considered to be committed to the notochordal fate. In this study, however, we demonstrated that the notochordal identity of NPCs depends on a sustained supply of Wnt signaling. In its absence, the NPCs lost their expression of notochord-specific genes, and they maintained only the expression of genes that were expressed in both the notochord and the endoderm. Assuming that the NPCs in the node originally derive from mesoendodermal cells located at the anterior end of the primitive streak of the gastrula, and that this process requires Wnt signaling (Lickert et al., 2002), it is likely that NPCs in the node and tail bud remain in a transitional state of differentiation from the mesoendoderm to the notochord, despite their earlier expression of notochord-specific genes. Therefore, NPCs are partially committed cells, and the role of Wnt signaling is to maintain their notochordal fate. In this paper, we used the constitutive Cre line, Not-Cre, for the complete deletion of β-catenin, because deletion by induced Cre with NotonmCherry-CreERT2/+ was much less effective. Since Not-Cre transgenic mouse also showed weaker Cre activity in the posterior endoderm and mesoderm (Fig. 5C,D), we cannot officially rule out the possibility that presence of β-catenin—ablated cells in the non-notochordal tissues caused the observed notochordal defects; however, we did not find non-notochordal cells showing reduced β-catenin levels by immunostaining (Fig. 5F).

Wnt signaling plays a similar role in fate specification in other stem/progenitor cell systems, including in skin development (Reya and Clevers, 2005). Although Wnt signaling is mitogenic in other systems (for example, in hematopoietic stem cells (Willert et al., 2003)), we did not observe significant changes in cell proliferation in the β-catenin-ablated NPCs. Therefore, the exact mechanism for the loss of posterior notochord in these mutants is currently unknown. Some other signaling pathway, however, might be responsible for stimulating the NPCs to proliferate. For example, in the zebrafish tailbud, Bmp4 signaling promotes cell proliferation and inhibits maturation of the notochord (Esterberg et al., 2008). It is tempting to speculate that Bmp signaling plays similar mitogenic roles in mouse NPCs, and that Wnt and Bmp signaling cooperatively regulate notochord development.

The role of Wnt signaling in the maintenance of NPC identity is likely to be evolutionally conserved. In support of this assertion, a similar activation of Wnt signaling at the posterior end of developing Xenopus was observed to follow β-catenin accumulation in the nucleus (Schohl and Fagotto, 2002). Likewise, Wnt3a knockdown in zebrafish embryos results in posterior notochord truncation in the tail (Thorpe et al., 2005). Because of these similarities, we believe that the abnormalities observed in our current study are primarily attributable to the attenuation of Wnt signaling. Nonetheless, the involvement of other effects caused by the reduced β-catenin levels cannot be formally excluded. Moreover, given that the notochordal truncation phenotypes in this mouse β-catenin ablation model and the zebrafish Wnt3a knockdown (Thorpe et al., 2005) are similar, and given the posterior body truncation seen in Wnt3a mouse mutants (Takada et al., 1994), Wnt3a is a logical candidate for the ligand that acts on the NPCs. In further support of this idea, the timing of the gradual decrease of Wnt3a expression during elongation arrest of the mouse tail (Cambray and Wilson, 2007) matches the gradual reduction of TOPGAL in the NPCs. Although Wnt8 plays a synergistic role in zebrafish tail development (Shimizu et al., 2005; Thorpe et al., 2005), the E9.5 mouse tail bud expresses neither Wnt8a nor Wnt8b (K.U. and H.S., unpublished observation).

4. Experimental procedures

4.1. Mouse lines

The NotonmCherry-CreERT2/+ (Acc. No. CDB0579K: http://www.cdb.riken.jp/arg/mutant%20mice%20list.html) mouse was generated by homologous recombination in ES cells as follows. The C57BL/6 mouse BAC genomic DNA clone RP23-437M22, which contains the Noto gene, was obtained from BACPAC Resources, Children’s Hospital Oakland Research Institute, and the gene with its surrounding genomic material was subcloned into MC1-DTA-pA/pMW118 (Nishioka et al., 2008; Sawada et al., 2008) using homologous recombination in E. coli, a recombineering method (Liu et al., 2003).

The Noto targeting vector was designed to remove the termination codon of the Noto protein, and introduced upstream of the following sequences: Equine rhinitis A virus (ERAV) 2A peptide (Szymczak and Vignali, 2005), a fusion protein of human histone H2B and mCherry (Shaner et al., 2005), Thosea asigna virus (TaV) 2A peptide (Szymczak and Vignali, 2005), and CreERT2 (Feil et al., 1997). The neomycin-resistance gene was supplied as the ACN cassette, which is self-excised in the germ line (Bunting et al., 1999). The targeting vector was generated using a recombineering method (Liu et al., 2003).

TT-2 ES cells (Yagi et al., 1993) were transformed by electroporation with the linearized targeting vector, followed by positive and negative selection with G418 and DT-A, respectively (Murata et al., 2004). The ES clones were screened for homologous recombination by long polymerase chain reaction (PCR) using LA-Taq (TaKaRa, Japan), as described (Murata et al., 2004). To screen for the Noto locus, the following primer pair was used: SVloxP-3′-F2 (AGGCCCAGGGCTCGCAGCCAACGTCG) and Noto-PC-3′-R2 (TTCAGGAGGTGAGGGCAGGGAGGACC). The positions of these primers are indicated in Fig. 2A. Correct homologous recombination of the Noto locus and the absence of randomly inserted targeting vectors were confirmed in the PCR-positive clones by Southern hybridization (Fig. 2B-D). The confirmed ES clones were injected into 8-cell embryos to produce chimeric mice. Chimeric founders from three independent ES cell lines (#58, #62, #74) were crossed with C57BL/6 mice, and the resulting knock-in mouse lines were maintained on the C57BL/6 background. Confirmation that the ACN cassette had been removed and genotype determination were performed by PCR with primers that produced both knock-in and wild-type bands: Noto genotype F (nF, GTGCGGTGACTGAGAGCTTAGG), Noto genotype R (nR, CGTCTATCCCATAAACCTCACC), ERT2 genotype F (eF, GGGCTCTACTTCATCGCATTCC). The positions of these primers are indicated in Fig. 2A. A 545-bp product is generated from the wild-type allele of nF and nR, and a 389-bp product is generated from the knock-in allele with eF and nR. The PCR conditions were 95 °C for 1 min, 30 cycles of 95 °C for 30 seconds, 58 °C for 30 seconds, 72 °C for 1 min, followed by 72 °C for 5 min. To induce Cre activity, pregnant mice were given tamoxifen (Sigma, T5648) dissolved in peanut oil (10 mg/ml) at 0.12 mg/g body weight, by oral gavage, as described previously (Park et al., 2008).

The floxed β-catenin mutant (Brault et al., 2001), TOPGAL (Merrill et al., 2004), and ROSA26R (Soriano, 1999) mice were all obtained from The Jackson Laboratory. The Not-Cre mouse line was incidentally established while generating a Pax6(Lens)-Cre transgenic mouse (Yoshimoto et al., 2005). The transgene integration site was assigned to Chr 5, C1 by chromosomal FISH. The ins-TOPGAL line was described elsewhere (Moriyama et al., 2007). Mice were housed in environmentally controlled rooms of the Laboratory Animal Housing Facility of RIKEN Center for Developmental Biology, under the institutional guidelines for animal and recombinant DNA experiments.

4.2. Preparation of skeletal specimens

The cartilage and bone from P0 neonates and weaning-age (four weeks) mice were stained with Alucian Blue and Alizarin Red, respectively, as described (Hogan et al., 1994).

4.3. In situ hybridization

Whole-mount in situ hybridization and the sectioning of stained embryos were performed as described (Sasaki and Hogan, 1993). Probes for Not (Abdelkhalek et al., 2004) and Foxa1 were described previously (Sasaki and Hogan, 1993). Probes for Brachyury and Shh were gifts from Drs. S. Takada and H. Hamada, respectively.

4.4. Antibody staining

Immunohistochemical and immunofluorescence staining of paraffin sections from embryos were performed according to standard procedures. Briefly, sections were incubated with a rabbit anti-Foxa2 antibody (1:100) (Yasui et al., 1997), rabbit anti-β-catenin antibody (Sigma, 1:4000), or mouse anti-E-cadherin antibody (BD Biosciences, 1:250) at 4°C overnight, followed by detection with anti-rabbit IgG conjugated with alkaline phosphatase (Jackson ImmunoResearch Laboratories) or Alexa594 (Molecular Probes). Immunofluorescence staining for mCherry protein was performed on cryosections of embryos using an anti-DsRed antibody (Clontech, 1:500), followed by detection with anti-rabbit IgG-Alexa594 (Molecular Probes), and DAPI.

4.5. Analysis of cell proliferation and apoptosis

Proliferating cells were detected via BrdU-labeling by combining the described procedures (Liu et al., 2000; Megason and McMahon, 2002). Briefly, pregnant mice were given intra-peritoneal injections of BrdU at 200 μg/g body weight, 2 hours prior to dissection. The embryos were fixed with 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS), and paraffin sections were prepared. To detect BrdU incorporation, deparaffinized and rinsed sections were incubated in 200 ng/ml Proteinase K in PBS for 5 minutes at room temperature, rinsed, incubated in 50% formamide, 1x SSC, 0.1% Tween-20 at 65°C for 2 hours, in 2N-HCl for 15 minutes, and in 0.1 M Na2B4O7 (pH 8.5) for 10 min, rinsed again, and stained with mouse monoclonal anti-BrdU (Sigma, 1:1000), anti-mouse IgG-Alexa594, and DAPI. Apoptosis was detected using the ApopTag Red In Situ Apoptosis Detection Kit (Chemicon) following the manufacturer’s instructions. The numbers of notochord cells and of labeled notochord cells within 100 μm of the posterior end of the notochord (E9.25 and E10.5) or the ventral node (E7.75) were counted on two (E9.25), three (E10.5), or five (E7.75) sections per embryo, and the total numbers were used for statistical analyses. Statistical analyses were performed with Prism5 statistical software (GraphPad) using an unpaired, two-tailed t-test.

4.6 β-galactosidase staining of embryos

Whole-mount staining of embryos for β-galactosidase activity, and paraffin sectioning of the stained embryos were performed as described (Wurst and Gossler, 2000).

4.7 Imaging

Images of the whole-mount embryos and sections were acquired with a Leica MZ16 or Axioplan2 (Zeiss) microscope equipped with an AxioCam HRc (Zeiss) or AxioCamMRm (Zeiss). For some images of whole-mount embryos, all-focal-levels images were generated by merging multiple images of different focal planes using Dynamic Eye REAL software (Mitani Corporation, Japan). Confocal images of whole-mount embryos were acquired with a Nikon AZ-C1 macro-confocal microscope.

Acknowledgments

We thank Ms. M. Shibata for mouse genotyping; Ms. M. Harano for technical assistance; the Laboratory for Animal Resources and Genetic Engineering for generating the mutant mice and housing all the mice; Dr. I. Matsuo for sharing mice; Dr. M. Seiki-Furutani for sharing unpublished information; Dr. Y. Saijoh for advice on Cre induction by Tamoxifen administration; Dr. H. Enomoto for advice on knock-in strategy and plasmids; Dr. N. Copeland for the recombineering system; Dr. K.R. Thomas for ACN cassette plasmid; Dr. P. Chambon for CreERT2 plasmid; and Drs. S. Takada, A. Gossler, H. Hamada, and R. I. Sherwood for in situ probes. This work was supported by a grant from RIKEN to HS, National Institutes of Health grant NICHD to R. R. B., and Grants-in-Aid for Scientific Research 17107005 to HK from the Ministry of Education, Culture, Sports, Science and Technology of Japan.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • Abdelkhalek HB, Beckers A, Schuster-Gossler K, Pavlova MN, Burkhardt H, Lickert H, Rossant J, Reinhardt R, Schalkwyk LC, Muller I, Herrmann BG, Ceolin M, Rivera-Pomar R, Gossler A. The mouse homeobox gene Not is required for caudal notochord development and affected by the truncate mutation. Genes Dev. 2004;18:1725–36. [PMC free article] [PubMed]
  • Agathon A, Thisse C, Thisse B. The molecular nature of the zebrafish tail organizer. Nature. 2003;424:448–52. [PubMed]
  • Ang SL, Rossant J. HNF-3 β is essential for node and notochord formation in mouse development. Cell. 1994;78:561–574. [PubMed]
  • Beck CW, Slack JM. A developmental pathway controlling outgrowth of the Xenopus tail bud. Development. 1999;126:1611–20. [PubMed]
  • Beck CW, Whitman M, Slack JM. The role of BMP signaling in outgrowth and patterning of the Xenopus tail bud. Dev Biol. 2001;238:303–14. [PubMed]
  • Beddington RS. Induction of a second neural axis by the mouse node. Development. 1994;120:613–20. [PubMed]
  • Bellomo D, Lander A, Harragan I, Brown NA. Cell proliferation in mammalian gastrulation: the ventral node and notochord are relatively quiescent. Dev Dyn. 1996;205:471–85. [PubMed]
  • Brault V, Moore R, Kutsch S, Ishibashi M, Rowitch DH, McMahon AP, Sommer L, Boussadia O, Kemler R. Inactivation of the beta-catenin gene by Wnt1-Cre-mediated deletion results in dramatic brain malformation and failure of craniofacial development. Development. 2001;128:1253–64. [PubMed]
  • Bunting M, Bernstein KE, Greer JM, Capecchi MR, Thomas KR. Targeting genes for self-excision in the germ line. Genes Dev. 1999;13:1524–8. [PMC free article] [PubMed]
  • Cambray N, Wilson V. Axial progenitors with extensive potency are localised to the mouse chordoneural hinge. Development. 2002;129:4855–66. [PubMed]
  • Cambray N, Wilson V. Two distinct sources for a population of maturing axial progenitors. Development. 2007;134:2829–40. [PubMed]
  • Cleaver O, Krieg PA. Notochord patterning of the endoderm. Dev Biol. 2001;234:1–12. [PubMed]
  • Davidson BP, Tam PP. The node of the mouse embryo. Curr Biol. 2000;10:R617–9. [PubMed]
  • Echelard Y, Epstein DJ, St-Jacques B, Shen L, Mohler J, McMahon JA, McMahon AP. Sonic hedgehog, a member of a family of putative signaling molecules, is implicated in the regulation of CNS polarity. Cell. 1993;75:1417–30. [PubMed]
  • Esterberg R, Delalande JM, Fritz A. Tailbud-derived Bmp4 drives proliferation and inhibits maturation of zebrafish chordamesoderm. Development. 2008;135:3891–901. [PMC free article] [PubMed]
  • Feil R, Wagner J, Metzger D, Chambon P. Regulation of Cre recombinase activity by mutated estrogen receptor ligand-binding domains. Biochem Biophys Res Commun. 1997;237:752–7. [PubMed]
  • Galceran J, Farinas I, Depew MJ, Clevers H, Grosschedl R. Wnt3a-/--like phenotype and limb deficiency in Lef1(-/-)Tcf1(-/-) mice. Genes Dev. 1999;13:709–17. [PMC free article] [PubMed]
  • Gofflot F, Hall M, Morriss-Kay GM. Genetic patterning of the developing mouse tail at the time of posterior neuropore closure. Dev Dyn. 1997;210:431–45. [PubMed]
  • Gont LK, Steinbeisser H, Blumberg B, de Robertis EM. Tail formation as a continuation of gastrulation: the multiple cell populations of the Xenopus tailbud derive from the late blastopore lip. Development. 1993;119:991–1004. [PubMed]
  • Griffith CM, Wiley MJ, Sanders EJ. The vertebrate tail bud: three germ layers from one tissue. Anat Embryol (Berl) 1992;185:101–13. [PubMed]
  • Herrmann BG, Kispert A. The T genes in embryogenesis. Trends Genet. 1994;10:280–6. [PubMed]
  • Hogan B, Beddington R, Constantini F, Lacy E. Manipulating the Mouse Embryo: Laboratory Manual. 2nd edn. Cold Spring Harbor Laboratory Press; 1994.
  • Kelly OG, Pinson KI, Skarnes WC. The Wnt co-receptors Lrp5 and Lrp6 are essential for gastrulation in mice. Development. 2004;131:2803–15. [PubMed]
  • Kinder SJ, Tsang TE, Wakamiya M, Sasaki H, Behringer RR, Nagy A, Tam PP. The organizer of the mouse gastrula is composed of a dynamic population of progenitor cells for the axial mesoderm. Development. 2001;128:3623–34. [PubMed]
  • Lickert H, Kutsch S, Kanzler B, Tamai Y, Taketo MM, Kemler R. Formation of multiple hearts in mice following deletion of beta-catenin in the embryonic endoderm. Dev Cell. 2002;3:171–81. [PubMed]
  • Liu P, Jenkins NA, Copeland NG. A highly efficient recombineering-based method for generating conditional knockout mutations. Genome Res. 2003;13:476–84. [PMC free article] [PubMed]
  • Liu Y-H, Snead ML, Maxon RE., Jr. Transgenic mouse models of craniofacial disorders. In: Tuan RS, editor. Methods Mol. Biol, Vol 137: Developmental Biology Protocols. III. Vol. 137. Humana Press Inc; NJ: 2000. pp. 499–511.
  • Maretto S, Cordenonsi M, Dupont S, Braghetta P, Broccoli V, Hassan AB, Volpin D, Bressan GM, Piccolo S. Mapping Wnt/beta-catenin signaling during mouse development and in colorectal tumors. Proc Natl Acad Sci U S A. 2003;100:3299–304. [PMC free article] [PubMed]
  • Megason SG, McMahon AP. A mitogen gradient of dorsal midline Wnts organizes growth in the CNS. Development. 2002;129:2087–98. [PubMed]
  • Merrill BJ, Pasolli HA, Polak L, Rendl M, Garcia-Garcia MJ, Anderson KV, Fuchs E. Tcf3: a transcriptional regulator of axis induction in the early embryo. Development. 2004;131:263–74. [PubMed]
  • Moriyama A, Kii I, Sunabori T, Kurihara S, Takayama I, Shimazaki M, Tanabe H, Oginuma M, Fukayama M, Matsuzaki Y, Saga Y, Kudo A. GFP transgenic mice reveal active canonical Wnt signal in neonatal brain and in adult liver and spleen. Genesis. 2007;45:90–100. [PubMed]
  • Murata T, Furushima K, Hirano M, Kiyonari H, Nakamura M, Suda Y, Aizawa S. ang is a novel gene expressed in early neuroectoderm, but its null mutant exhibits no obvious phenotype. Gene Expr Patterns. 2004;5:171–8. [PubMed]
  • Nakaya MA, Biris K, Tsukiyama T, Jaime S, Rawls JA, Yamaguchi TP. Wnt3alinks left-right determination with segmentation and anteroposterior axis elongation. Development. 2005;132:5425–36. [PMC free article] [PubMed]
  • Niehrs C. Regionally specific induction by the Spemann-Mangold organizer. Nat Rev Genet. 2004;5:425–34. [PubMed]
  • Nishioka N, Yamamoto S, Kiyonari H, Sato H, Sawada A, Ota M, Nakao K, Sasaki H. Tead4 is required for specification of trophectoderm in pre-implantation mouse embryos. Mech Dev. 2008;125:270–83. [PubMed]
  • Nishizaki Y, Shimazu K, Kondoh H, Sasaki H. Identification of essential sequence motifs in the node/notochord enhancer of Foxa2 (Hnf3β) gene that are conserved across vertebrate species. Mech Dev. 2001;102:57–66. [PubMed]
  • Nose A, Takeichi M. A novel cadherin cell adhesion molecule: its expression patterns associated with implantation and organogenesis of mouse embryos. J Cell Biol. 1986;103:2649–58. [PMC free article] [PubMed]
  • Park EJ, Sun X, Nichol P, Saijoh Y, Martin JF, Moon AM. System for tamoxifen-inducible expression of cre-recombinase from the Foxa2 locus in mice. Dev Dyn. 2008;237:447–53. [PubMed]
  • Plouhinec JL, Granier C, Le Mentec C, Lawson KA, Saberan-Djoneidi D, Aghion J, Shi DL, Collignon J, Mazan S. Identification of the mammalian Not gene via a phylogenomic approach. Gene Expr Patterns. 2004;5:11–22. [PubMed]
  • Recillas-Targa F, Pikaart MJ, Burgess-Beusse B, Bell AC, Litt MD, West AG, Gaszner M, Felsenfeld G. Position-effect protection and enhancer blocking by the chicken beta-globin insulator are separable activities. Proc Natl Acad Sci U S A. 2002;99:6883–8. [PMC free article] [PubMed]
  • Reya T, Clevers H. Wnt signalling in stem cells and cancer. Nature. 2005;434:843–50. [PubMed]
  • Sasaki H, Hogan BL. Differential expression of multiple fork head related genes during gastrulation and axial pattern formation in the mouse embryo. Development. 1993;118:47–59. [PubMed]
  • Sasaki H, Hogan BL. Enhancer analysis of the mouse HNF-3β gene: regulatory elements for node/notochord and floor plate are independent and consist of multiple sub-elements. Genes Cells. 1996;1:59–72. [PubMed]
  • Sawada A, Kiyonari H, Ukita K, Nishioka N, Imuta Y, Sasaki H. Redundant roles of Tead1 and Tead2 in notochord development and the regulation of cell proliferation and survival. Mol Cell Biol. 2008;28:3177–89. [PMC free article] [PubMed]
  • Sawada A, Nishizaki Y, Sato H, Yada Y, Nakayama R, Yamamoto S, Nishioka N, Kondoh H, Sasaki H. Tead proteins activate the Foxa2 enhancer in the node in cooperation with a second factor. Development. 2005;132:4719–29. [PubMed]
  • Schohl A, Fagotto F. Beta-catenin, MAPK and Smad signaling during early Xenopus development. Development. 2002;129:37–52. [PubMed]
  • Shaner NC, Steinbach PA, Tsien RY. A guide to choosing fluorescent proteins. Nat Methods. 2005;2:905–9. [PubMed]
  • Sherwood RI, Jitianu C, Cleaver O, Shaywitz DA, Lamenzo JO, Chen AE, Golub TR, Melton DA. Prospective isolation and global gene expression analysis of definitive and visceral endoderm. Dev Biol. 2007;304:541–55. [PubMed]
  • Shimizu T, Bae YK, Muraoka O, Hibi M. Interaction of Wnt and caudal-related genes in zebrafish posterior body formation. Dev Biol. 2005;279:125–41. [PubMed]
  • Soriano P. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat Genet. 1999;21:70–1. [PubMed]
  • Szymczak AL, Vignali DA. Development of 2A peptide-based strategies in the design of multicistronic vectors. Expert Opin Biol Ther. 2005;5:627–38. [PubMed]
  • Szymczak AL, Workman CJ, Wang Y, Vignali KM, Dilioglou S, Vanin EF, Vignali DA. Correction of multi-gene deficiency in vivo using a single ‘self-cleaving’ 2A peptide-based retroviral vector. Nat Biotechnol. 2004;22:589–94. [PubMed]
  • Takada S, Stark KL, Shea MJ, Vassileva G, McMahon JA, McMahon AP. Wnt-3a regulates somite and tailbud formation in the mouse embryo. Genes Dev. 1994;8:174–89. [PubMed]
  • Tam PP, Behringer RR. Mouse gastrulation: the formation of a mammalian body plan. Mech Dev. 1997;68:3–25. [PubMed]
  • Tam PP, Steiner KA, Zhou SX, Quinlan GA. Lineage and functional analyses of the mouse organizer. Cold Spring Harb Symp Quant Biol. 1997;62:135–44. [PubMed]
  • Thorpe CJ, Weidinger G, Moon RT. Wnt/beta-catenin regulation of the Sp1-related transcription factor sp5l promotes tail development in zebrafish. Development. 2005;132:1763–72. [PubMed]
  • Vincent SD, Dunn NR, Hayashi S, Norris DP, Robertson EJ. Cell fate decisions within the mouse organizer are governed by graded Nodal signals. Genes Dev. 2003;17:1646–62. [PMC free article] [PubMed]
  • Weinstein DC, Ruiz i Altaba A, Chen WS, Hoodless P, Prezioso VR, Jessell TM, Darnell JE., Jr. The winged-helix transcription factor HNF-3 β is required for notochord development in the mouse embryo. Cell. 1994;78:575–88. [PubMed]
  • Wilkinson DG, Bhatt S, Herrmann BG. Expression pattern of the mouse T gene and its role in mesoderm formation. Nature. 1990;343:657–9. [PubMed]
  • Willert K, Brown JD, Danenberg E, Duncan AW, Weissman IL, Reya T, Yates JR, 3rd, Nusse R. Wnt proteins are lipid-modified and can act as stem cell growth factors. Nature. 2003;423:448–52. [PubMed]
  • Wilson V, Beddington RS. Cell fate and morphogenetic movement in the late mouse primitive streak. Mech Dev. 1996;55:79–89. [PubMed]
  • Wurst W, Gossler A. Gene trap strategies in ES cells. In: Joyner AL, editor. Gene Targeting. A Practical Approach. Oxford University Press Inc; New York: 2000.
  • Yagi T, Tokunaga T, Furuta Y, Nada S, Yoshida M, Tsukada T, Saga Y, Takeda N, Ikawa Y, Aizawa S. A novel ES cell line, TT2, with high germline-differentiating potency. Anal Biochem. 1993;214:70–6. [PubMed]
  • Yamamoto M, Meno C, Sakai Y, Shiratori H, Mochida K, Ikawa Y, Saijoh Y, Hamada H. The transcription factor FoxH1 (FAST) mediates Nodal signaling during anterior-posterior patterning and node formation in the mouse. Genes Dev. 2001;15:1242–56. [PMC free article] [PubMed]
  • Yamanaka Y, Tamplin OJ, Beckers A, Gossler A, Rossant J. Live imaging and genetic analysis of mouse notochord formation reveals regional morphogenetic mechanisms. Dev Cell. 2007;13:884–96. [PubMed]
  • Yasui K, Sasaki H, Arakaki R, Uemura M. Distribution pattern of HNF-3beta proteins in developing embryos of two mammalian species, the house shrew and the mouse. Dev Growth Differ. 1997;39:667–76. [PubMed]
  • Yoshimoto A, Saigou Y, Higashi Y, Kondoh H. Regulation of ocular lens development by Smad-interacting protein 1 involving Foxe3 activation. Development. 2005;132:4437–48. [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links