• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
J Biol Chem. Author manuscript; available in PMC Sep 28, 2009.
Published in final edited form as:
PMCID: PMC2753450
NIHMSID: NIHMS134887

DOMAIN ARCHITECTURE AND BIOCHEMICAL CHARACTERIZATION OF VERTEBRATE MCM10

Abstract

Mcm10 plays a key role in initiation and elongation of eukaryotic chromosomal DNA replication. As a first step to better understand the structure and function of vertebrate Mcm10, we have determined the structural architecture of Xenopus laevis Mcm10 (xMcm10) and characterized each domain biochemically. Limited proteolytic digestion of the full-length protein revealed amino-terminal (NTD), internal (ID), and carboxy-terminal (CTD) structured domains. Analytical ultracentrifugation revealed that xMcm10 self-associates and that the NTD forms homodimeric assemblies. DNA binding activity of xMcm10 was mapped to the ID and CTD, each of which binds to single- (ss) and double-stranded (ds) DNA with low micromolar affinity. The structural integrity of xMcm10-ID and CTD is dependent on the presence of bound zinc, which was experimentally verified by atomic absorption spectroscopy and proteolysis protection assays. The ID and CTD also bind independently to the amino-terminal 323 residues of the p180 subunit of DNA polymerase α-primase (pol α). We propose that the modularity of the protein architecture, with discrete domains for dimerization and for binding to DNA and pol α, provides an effective means for coordinating the biochemical activities of Mcm10 within the replisome.

INTRODUCTION

Eukaryotic DNA replication is carried out by large multiprotein machines that coordinate DNA unwinding and synthesis at the replication fork. Initiation of replication involves ordered assembly of the replisome and local denaturation of duplex DNA at the origin, followed by replisome activation. Screens for mutants defective in minichromosome maintenance (Mcm) and DNA replication in yeast identified a number of factors essential for replication (1-4). Pre-replicative complexes (pre-RCs) composed of the origin recognition complex (ORC), Cdc6, Cdt1, and the hexameric Mcm2-7 helicase are assembled in G1 (reviewed in 5) and converted into active replication forks at the onset of S phase. Mcm10 loads onto chromatin after pre-RC assembly (6,7) and stimulates phosphorylation of Mcm2-7 by Dbf4-Cdc7 kinase (8). Once Mcm10 is present, Cdc45 and GINS are loaded onto chromatin (6,9,10) and form a Cdc45/Mcm2-7/GINS helicase complex (11-14). Cyclin- and Dbf4-dependent kinases, together with Sld2, Sld3, and Dpb11 in budding yeast (15,16), stimulate origin unwinding, which is signified by recruitment of RPA to single-stranded DNA (17,18). Mcm10, Cdc45, and RPA facilitate subsequent loading of DNA polymerase α-primase (pol α) onto chromatin (7,9,19,20). The association of PCNA, RFC, and replicative DNA polymerases δ and ε with the origin completes the replisome (reviewed in 21).

A number of interactions have been observed between Mcm10 and proteins found in the pre-RC and at the replication fork. Mcm10 is a component of active replication complexes in Xenopus and budding yeast (12,14) and is associated with chromatin throughout S-phase (7). Mcm10 interacts genetically with Mcm2-7, DNA pol δ and ε, ORC, and Dpb11 (2,22-24). In vitro, interactions of Mcm10 with initiation factors ORC, Mcm2-7, Cdc45, and Cdc7/Dbf4 have been observed by co-immunoprecipitation from cell extracts (8,22,24,25). Importantly, Cdc45 and RPA cannot load onto chromatin in Mcm10-depleted Xenopus egg extracts, preventing DNA unwinding (6). Thus, the essential role of Mcm10 in initiation links the pre-RC with origin unwinding.

Several lines of evidence suggest that Mcm10 migrates with the elongating replication fork through association with DNA polymerases and DNA. Schizosaccharomyces pombe Mcm10 (spMcm10) affects chromatin binding and sub-nuclear distribution of pol α (19,26), and Saccharomyces cerevisiae Mcm10 (scMcm10) has been shown to interact with and stabilize the catalytic subunit of pol α in vivo (7,27). In vitro, spMcm10 interacts with and stimulates the activity of the catalytic (polymerase) subunit of pol α (28), and has been shown to contain primase activity (29). Additionally, an interaction between diubiquitinated scMcm10 and PCNA is essential for replication in budding yeast (30). Finally, spMcm10 binds to single (ss)- and double-stranded (ds) DNA in vitro, and DNA binding activity is localized in the N-terminal 300 residues of the protein (28). The interactions between Mcm10, DNA, and pol α have led to the suggestion that Mcm10 helps to recruit pol α to the replisome and may regulate its activity. Studies in Xenopus extracts have demonstrated that when an elongating fork stalls, Mcm10 and DNA polymerases α, δ, and ε are uncoupled from the Cdc45/Mcm2-7/GINS helicase (12).

Sequence alignments of Mcm10 from divergent eukaryotes show stretches of consecutive residues that are phylogenetically conserved (Figure 1A), suggesting that these regions may be important to the structure and function of the protein. Mcm10 from metazoa contains ~100-300 residues not present in the yeast proteins, and conservation from yeast to human is limited to ~200-amino acids in the middle of the protein. Consistent with Mcm10’s DNA binding activity, the conserved central region contains an invariant CCCH zinc-binding motif (22,23,31) and a putative oligonucleotide/oligosaccharide binding (OB)-fold (27).

FIGURE 1
Domain architecture of Mcm10

The lack of sequence similarity outside of the central region raises a question of whether the function of Mcm10 is conserved from yeast to metazoa. In the present study, we report the first structure-function analysis of vertebrate Mcm10 using the Xenopus laevis protein (xMcm10). Limited proteolytic digestion of xMcm10 revealed the protein to be composed of at least three structural domains—an amino-terminal domain (NTD) that forms homodimers in solution, and highly conserved internal (ID) and carboxy-terminal domains (CTD) that bind to ssDNA, dsDNA, and to the p180 subunit of pol α. Our results confirm and extend previous work from yeast, and suggest that vertebrate Mcm10 contains a CTD not present in the yeast orthologs.

EXPERIMENTAL PROCEDURES

Cloning, Expression and Purification of xMcm10

The cDNAs encoding full-length xMcm10 (FL, 1-860) and deletion fragments 1-145, 1-230, 230-427, 427-860, and 596-860 were PCR amplified from a previously described plasmid encoding a GST-xMcm10 fusion (6). The FL-xMcm10 PCR product was ligated into a modified pMAL-c2x vector (New England Biolabs) to generate an MBP-xMcm10-His6 fusion protein, and xMcm10 fragments were ligated into a modified pET-32a plasmid (Novagen) to generate N-terminal thioredoxin (Trx)-His6-fusion proteins. Protein was overexpressed in E. coli BL21(DE3) cells in Luria-Bertani medium supplemented with 100 μg/ml ampicillin, 5 μM ZnSO4, and 0.5 mM IPTG. Proteins were overexpressed at 22° C for 4 hr (FL) or at 16° C for 16 hr (fragments). The cells were resuspended in 50 mM Tris-HCl pH 7.5, 500 mM NaCl, 10% glycerol and lysed under pressure (25,000 psi) using an EmulsiFlex-C3 homogenizer (Avestin, Inc.). FL-xMcm10 was purified by tandem nickel-NTA and amylose affinity chromatography, cleavage of the MBP-tag, and SP-sepharose cation exchange. Protein was concentrated and stored in FL-buffer (20 mM Tris-HCl pH 7.5, 500 mM NaCl, 1 mM dithiothreitol (DTT) and 5% glycerol). xMcm10 fragments were purified by nickel-NTA affinity chromatography, followed by cleavage of the Trx-His6 tag. The cleaved proteins were further purified by cation exchange (fragments 230-427, 427-860, 596-860) or anion exchange (1-145 and 1-230) chromatography, followed by gel filtration on a Superdex™ 200 preparative column (GE Healthcare) that had been equilibrated with S-200 buffer (20 mM Tris-HCl pH 7.5, 100 mM NaCl, 5% glycerol, 4mM β-mercaptoethanol [β-ME]). Structural integrity of fragment proteins was verified by circular dichroism spectroscopy.

Limited Proteolysis and Fragment Identification

Proteolysis experiments were carried out in S-200 buffer, in which 5-20 μM xMcm10 was incubated with 1-200 ng protease (trypsin, α-chymotrypsin, elastase, or endoproteinase-Glu-C) in a 10-μl reaction at 37° C for 30 min. Proteolysis protection reactions contained 10 mM EDTA. Proteases were inactivated by adding 10 μl SDS—PAGE sample buffer (63 mM Tris-HCl pH 6.8, 700 mM β-ME, 2% w/v SDS, 0.03% w/v bromophenol blue, and 10% glycerol) and heating 5 min at 95° C. Proteolytic fragments were separated by SDS-PAGE and visualized by Coomassie blue staining.

Proteolytic fragments from MBP-xMcm10-His6 were excised from the SDS-PAGE gel and subjected to in-gel digestion with Trypsin Gold (Promega) using standard procedures (32). The resulting peptides were analyzed by matrix-assisted laser desorption/ionization, time-of-flight mass spectrometry (MALDI-TOF MS) and TOF/TOF tandem MS using a Voyager 4700 (Applied Biosciences, Framingham MA). Peptide ion masses (M+H) were accurate to within 20 ppm after internal calibration using either trypsin autolytic peptides or xMcm10-derived peptides confirmed by TOF/TOF MS.

Molecular masses of xMcm10 domains resulting from proteolysis of deletion mutants Δ1, Δ2, and Δ3 were obtained by MALDI-TOF mass-spectrometry of the proteolysis reactions prior to SDS-PAGE. Reactions were concentrated in 0.1% trifluoroacetic acid, mixed with 3 μl saturated sinapinic acid in 60:40 (vol/vol) acetonitrile:1% trifluoroacetic acid/dH2O, and 1 μl was deposited onto a gold 100-well plate. Mass spectra were acquired on a Perceptive Biosystems Voyager Elite TOF spectrometer equipped with a laser desorption ionization source and an extended-path ion reflector. Protein standards from Sigma (MSCAL1-1KT) were used for mass calibration. For N-terminal sequencing of xMcm10 domains, intact proteolytic fragment proteins were transferred from SDS gel to PVDF membrane, stained with Ponceau-S, extracted from the membrane and subjected to Edman degradation chemistry using an Applied Biosystems Model 492HT Protein/Peptide Sequencer equipped with an on-line PTH-amino acid analyzer.

Zinc Quantitation

Quantitative analysis of zinc bound to xMcm10 was performed using graphite furnace atomic absorption (GFAA) spectroscopy. Analyses were performed using a Perkin Elmer HGA SIMAA 6000 graphite furnace equipped with an AAnalyst 800 GFAA/FLAA spectrophotometer. xMcm10 domains were quantified by absorbance spectroscopy at 280 nm using extinction coefficients of 0.092 (NTD), 1.09 (ID), and 0.524 (CTD) ml·mg-1·cm-1.

Gel Filtration Chromatography and Analytical Ultracentrifugation

Size exclusion chromatography of FL-xMcm10 was performed on a Superose 6 column (GE Healthcare) equilibrated with 20 mM Tris-HCl pH 7.5, 500 mM NaCl, 5% glycerol, and 1 mM DTT. xMcm10 domains were eluted from an analytical Superdex™ 200 column (GE Healthcare) equilibrated with S-200 buffer. 50 μl solutions of either xMcm10 (~1-2 mg/ml) or molecular weight standards were eluted at 0.5 ml/min. The standard curve was generated from thyroglobulin (670 kD), aldolase (158 kD), albumin (67 kD), chicken ovalbumin (44 kD), equine myoglobin (17kD), and Vitamin B12 (1.4 kD).

Sedimentation velocity analysis was conducted at 20°C and 55,000 RPM using interference optics with a Beckman-Coulter XL-I analytical ultracentrifuge. Double sector synthetic boundary cells equipped with sapphire windows were used to match the sample and reference menisci. FL-xMcm10 was prepared in FL-buffer, and NTD and CTD were prepared in S-200 buffer. The data were initially analyzed using the program DCDT+ which computes the apparent sedimentation coefficient distribution function g(s*) using the time-derivative method (33,34). For CTD, the molecular weight and sedimentation coefficient of the main component was obtained by global fitting of the data sets collected at multiple concentrations to a hybrid discrete-continuous model with Sedphat (35). For NTD, the data were fit to a monomer-dimer equilibrium model using the programs Sedanal (36) and Sedphat. Molecular masses, partial specific volumes and solvent densities were calculated using the SEDNTERP program (37).

Fluorescence Anisotropy

DNA binding was measured by following an increase in fluorescence anisotropy as protein (MBP-xMcm10-His6, NTD, ID, or CTD) was added to oligonucleotide, d(TGACTACTACATGGTTGCCTACCAT), containing a 6-carboxyfluorescein moiety at the 3′-end, either alone (ssDNA) or annealed to an excess of the complementary strand (dsDNA). Forked DNA substrate tested against full-length Mcm10 was generated from two 50mer deoxyoligonucleotides, in which dC25 was added to the 3′-end of the sequence above and to the 5′-end of the complementary sequence. For Mcm10-ID and -CTD, forked and bubble DNA substrates were generated from the sequences d(GGTAGGCACGAACCATGTAGTAGTA) / d(AACCATGTAGTAGTACGTGCCTACC) and d(GGTAGGCACGAACCATGTAGTAGTAGGCAATCAGC) / d(GCTGATTGCCAACCATGTAGTAGTACGTGCCTACC), respectively, in which the bold-face denotes duplex regions. Protein was added over the concentration range of 0.05-50 μM to a solution containing 25 nM DNA in S-200 buffer. For EDTA titrations, the buffer was supplemented with 0.1, 1, 10, and 25 mM EDTA. Polarized fluorescence intensities using excitation and emission wavelengths of 495 and 515 nm, respectively, were measured for 30 s (1/s) and averaged. Anisotropy (r) was calculated using the equation r = (Ipar-Iperp)/(Ipar+2Iperp), where Ipar and Iperp are the observed fluorescence intensities recorded through polarizers oriented parallel and perpendicular, respectively, to the direction of vertically polarized light. Dissociation constants (Kd) were derived by fitting a simple two-state binding model to data from three experiments using Kaleidagraph 3.6 (Synergy Software, PA).

Mcm10-pol α Binding Assay

Recombinant DNA polymerase α-primase (pol-prim) was purified by immunoaffinity chromatography from extracts of Hi-5 insect cells co-infected with four recombinant baculoviruses as previously described (38). The p180 subunit was prepared identically except only one recombinant baculovirus was used for infection. p180N (aa 1-323) was amplified by PCR on a cDNA template pBR322-p180 and cloned into the BamHI/EcoRI sites of a pGEX-2T expression vector (GE Healthcare). GST fusion proteins were expressed and purified by glutathione-agarose affinity chromatography as described previously (39).

For the binding experiments, a total of 7 μg of purified pol-prim or p180 was incubated with SJK132-20 antibodies covalently coupled to Sepharose-4B beads (GE Healthcare), or 7 μg of purified p180N was incubated with glutathioneagarose beads (Sigma-Aldrich) in binding buffer (30 mM HEPES-KOH pH 7.8, 10 mM KCl, 7 mM MgCl2) containing 2% nonfat dry milk for 1 hr at 4° with end-over-end rotation. Reactions contained either 5 or 15 μg Trx-His6-xMcm10-domain proteins. The beads were washed once with binding buffer, three times with wash buffer (30 mM HEPES-KOH pH 7.8, 75 mM KCl, 7 mM MgCl2 0.25% inositol, 0.1% NP-40) and once with binding buffer (rotated for 10 min during each wash). The beads were resuspended in 30 μl of 2x SDS-PAGE loading buffer and heated at 100° C for 5 min. Half of each sample was analyzed by 10% SDS-PAGE and immunoblotting with monoclonal antibody 2CT25, specific for the p180 subunit of pol-prim, rabbit anti-GST (Invitrogen) for p180N, and H-15 anti-His (Santa Cruz Biotechnology) for xMcm10 domains. Trx-only control experiments were performed to confirm that pol α, p180, and p180N did not interact with the Trx affinity tag.

DNA Primase Assay

Oligoribonucleotide synthesis activity was measured as previously described for spMcm10 (29). Briefly, 2-8 pmol purified xMcm10 or 0.6-2.4 pmol purified pol-prim were incubated at 37° C for 40 min with 1.0 μM dT50, 25 μCi [α-32P]ATP and 0.1 mM ATP in a 10 μM reaction containing 40 mM Tris-HCl (pH 7.4), 10 mM magnesium acetate, 1 mM DTT, and 100 μg/ml BSA. Reactions were treated with 1 U calf intestine phosphatase at 37° C for 40 min. After addition of 3 μl sequencing gel running buffer (98% formamide, 10 mM EDTA pH 8.0, 0.1% xylene cyanol, 0.1% bromophenol blue), samples were heated to 98° C for 5 min and separated on a 25% polyacrylamide/7 M urea gel. RNA was visualized by autoradiography.

RESULTS

xMcm10 Contains Three Structural Domains

In the current study, experiments to characterize the domain architecture of vertebrate Mcm10 were carried out using the Xenopus laevis ortholog because of previous investigations of the function of the protein using Xenopus egg extracts (6,40). Homology exists in three distinct regions of the protein (Figure 1A, Supplementary Figure S1). The internal region (aa 240-430) is highly conserved among all known Mcm10 orthologs, with an overall similarity of 21.3% (39.0% for non-yeast Mcm10). Likewise, the carboxy-terminus contains a region of high (aa ~700-860) and moderate (aa 510-700) similarity among higher eukaryotes. However, this region is not present in the yeast proteins (23.3% similarity for metazoan as compared to 3.6% for all eukaryotes). Moderate sequence similarity also exists at the amino-terminus (10% similarity for aa 1-130 in non-yeast sequences). This sequence analysis immediately suggested the presence of at least three domains tethered by disordered linkers. Consistent with this, no secondary structure was predicted in regions 130-230 and 575-624 (Supplementary Figure S1), and region 130-230 was predicted to be largely disordered.

In order to experimentally determine the domain organization of Mcm10, the full-length protein was overexpressed in E. coli with a cleavable N-terminal maltose binding protein (MBP) tag and a C-terminal His6 tag. The purified MBP-xMcm10-His6 protein was subjected to limited proteolytic digestion by trypsin, chymotrypsin, and elastase, and the major proteolytic fragments identified by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) and MALDI-TOF/TOF tandem MS (Figure 1B). Peptide masses were mapped to the xMcm10 amino acid sequence to define domains (Supplementary Figure S2). In most cases the endpoint regions were defined by peptide ions that were present in the full-length protein but absent in the fragment under study, and in some cases the endpoint was confirmed with tandem MS on unique peptide(s) that were generated by chymotrypsin cleavage on one side (from limited proteolysis) and trypsin cleavage on the other (from in-gel digestion). Peptides analyzed in this way revealed proteolytic-resistant domains separated by cleavage sites at amino acids 159, 241, 425, 484, 525, 566, and 599 (Figure 1B and Supplementary Figure S2).

Using the proteolytically sensitive regions as a guide, three deletion constructs encompassing the entire protein were designed in order to define the domain boundaries more accurately: xMcm101-230 (Δ1), xMcm10230-427 (Δ2), and xMcm10427-860 (Δ3). Each of these proteins were expressed in bacteria, purified, and subjected to limited proteolysis by trypsin (Supplementary Figure S3). Precise endpoints of tryptic fragments were identified by Edman degradation and MALDI mass spectrometry (Figure 1C). Chymotrypsin, elastase, and endoproteinase-Glu-C digestion was also performed (data not shown). Despite the unique specificities of each protease tested, the resulting cleavage patterns were similar for each Mcm10 deletion mutant. Proteolysis of each deletion mutant revealed the presence of smaller fragments that were resistant to digestion and that were consistent with the cleavage pattern of the full-length protein (Figure 1B) and with regions of sequence conservation (Figure 1A). Cleavage of the C-terminal ends of Δ1 and Δ2 yielded xMcm101-145 and xMcm10230-417, respectively. For Δ3, ~170 residues were cleaved from the N-terminus, yielding xMcm10596-860. The resistance of xMcm101-145, xMcm10230-417, and xMcm10596-860 to further degradation indicates the presence of stable tertiary folds that sterically preclude protease access to their cleavage sites. To prepare for further characterization, regions 1-145 (NTD), 230-417 (ID), and 596-860 (CTD) were sub-cloned, overexpressed, and purified (Figure 1D). The anomalous electrophoretic mobility of the NTD can be rationalized on the basis of the predicted pI (4.2) and elongated shape of the protein (see below). The NTD, ID, and CTD were relatively stable to further proteolytic digestion, and circular dichroism spectra confirmed the presence of secondary structure in each domain (data not shown).

Dimerization of xMcm10-NTD

Purified scMcm10 and spMcm10 have been reported to oligomerize in solution (8,29,31), and human Mcm10 was recently reported to form hexameric assemblies (41). Prior to a rigorous analysis of xMcm10 oligomerization, we first investigated the hydrodynamic properties of the full-length, NTD, ID, and CTD proteins by gel filtration chromatography (Supplementary Figure S4). The elution volumes of full-length and NTD proteins were considerably less than expected for globular, monomeric proteins. Similarly, the CTD showed a modest decrease in retention volume as compared to that of a 30-kD protein standard. The elution profile of the ID, on the other hand, corresponded exactly to that of a 22-kD protein, indicating that this domain does not self-associate. These results raised the question of whether xMcm10 oligomerizes in solution or whether the shape of the protein significantly deviates from a globular fold.

The oligomeric states of the NTD, CTD and full-length proteins were determined using sedimentation velocity experiments (Figure 2). Figure 2A shows an overlay of the normalized g(s*) sedimentation coefficient distributions for four concentrations of the NTD. The distributions shift to the right with increasing concentration, indicating reversible self-association. The best fit to the data was obtained using a monomer-dimer equilibrium model. The sedimentation coefficient for the monomer could not be accurately determined due to the fact that the protein is predominantly dimeric over the concentration range tested. Thus, the sedimentation coefficient ratio s(dimer) / s(monomer) was fixed at 1.45, which is the value predicted for a monomer-dimer system (42). The best fit parameters are s20,w (monomer) = 1.22 S, s20,w (dimer) = 1.77 S, a dissociation constant of Kd = 3.1 μM and an rms error of 0.0048 mg/ml. The corrected sedimentation coefficients of the monomer and dimer can be used to calculate frictional ratios, f/f0, of 1.8 and 2.0, respectively, indicating that the NTD is highly asymmetric.

FIGURE 2
Self-association of xMcm10

The normalized g(s*) profiles for the CTD superimpose over the concentration range tested (0.17-1.5 mg/ml), indicating that the system does not undergo reversible association under these conditions. The molecular weight obtained from a global fit of the data to single species model is 31.0 kD, which agrees closely with the predicted monomeric value of 30.1 kD. The frictional ratio (f/f0) of 1.89 indicates that CTD is also quite asymmetric, consistent with its gel filtration behavior.

Figure 2C shows the normalized g(s*) distributions for the full-length enzyme. Like NTD, the distributions shift to the right with increasing concentration, indicating mass-action association. In this case, the presence of lower- and higher-S contaminants precludes further analysis of these data. However, the limiting sedimentation coefficient of ~2.6 S at low concentration indicates that xMcm10 is predominantly monomeric at low concentrations with f/f0 ~ 2.2. Assuming an alternative model where the s=2.6 S species is a dimer yields an unreasonably high f/f0 ~ 3.5.

Zinc-Dependent Stability of xMcm10-ID and CTD

Sequence alignments show clusters of highly invariant cysteine and histidine residues in both the ID and CTD (Figure 3A), suggesting that these domains contain zinc binding motifs. Strong evidence has been provided for the presence of a zinc motif in scMcm10 internal region (31), although zinc binding by the CTD has not yet been reported. To verify the presence and determine the stoichiometry of Zn2+ in xMcm10 domains, we analyzed each of the domains by graphite furnace atomic absorption (GFAA) spectroscopy. Molar ratios of Zn2+/xMcm10 for the NTD, ID, and CTD were determined to be 0.16, 1.3 ± 0.3, and 1.8 ± 0.5, respectively (Table 1). As a positive control, 3-methyladenine DNA glycosylase I (TAG), which has been shown previously to contain 1 Zn2+/molecule (43,44), was analyzed by GFAA and returned a value of 0.98 Zn2+/TAG. We therefore conclude that the NTD, CTD, and ID contain 0, 1, and 2 Zn2+ ions, respectively. In support of the GFAA data, X-ray fluorescence emission spectra of xMcm10-ID single crystals, which were grown in the absence of Zn2+ in the crystallization buffer, revealed a strong peak at 9.6 keV corresponding to the Zn2+ absorption edge (data not shown).

FIGURE 3
Effect of EDTA on the stability of xMcm10-ID and -CTD
Table 1
Molar equivalents of Zn2+ in xMcm10 domains

The importance of bound zinc on the tertiary folding of the ID and CTD was investigated by limited proteolysis protection assays. The ID and CTD were subjected to proteolysis by elastase in the presence and absence of ethylenediamine tetraacetic acid (EDTA), a known Zn2+ chelator. Both domains were more readily degraded in the presence of EDTA (Figure 3B), suggesting that in the absence of bound Zn2+, the ID and CTD were at least partially unfolded and thus more susceptible to protease cleavage. Similarly, when the ID and CTD were incubated at room temperature for 10 days in the presence or absence of EDTA, spontaneous degradation was increased in the presence of EDTA (Supplementary Figure S5). These results suggest that the zinc motifs in xMcm10-ID and -CTD play a key role in maintaining the overall structural integrity of these domains.

xMcm10-ID and CTD are DNA Binding Domains

In order to quantitatively characterize the DNA binding activity of purified xMcm10, the change in fluorescence anisotropy was monitored as the protein was added to a fluorescein-labeled 25mer oligonucleotide (Figure 4). Binding isotherms for MBP-xMcm10-His6 show that the full-length Xenopus protein bound to both ssDNA and dsDNA with the same affinity (Kd ~ 0.1μM) (Figure 4A, Table 2). To determine if Mcm10 might bind to the replication fork at the ss/dsDNA junction, a forked substrate containing both ssDNA and dsDNA regions was also tested and did not show a difference in binding affinity (Kd = 0.08 ± 0.06 μM) compared to ssDNA and dsDNA (Table 2). Interestingly, in the presence of EDTA, binding of xMcm10 to dsDNA was abolished, whereas the affinity for ssDNA remained unchanged (Figure 4A, Table 2). The overall anisotropy change for ssDNA binding was different between EDTA and non-EDTA titrations, indicating that a change in the tumbling rate of the complex occurred, likely as a result of EDTA-induced local unfolding of the zinc motifs (Figure 3). These results establish that zinc-dependent structural integrity of xMcm10 is important for the dsDNA binding activity.

FIGURE 4
DNA binding of xMcm10
Table 2
Dissociation constants for DNA binding a

Binding of DNA to the NTD, ID, and CTD was then measured in order to determine the DNA binding domain of xMcm10. No anisotropy change was observed in the presence of the NTD, indicating that this domain does not interact with DNA (Figure 4B). Unexpectedly, both the ID and CTD showed robust binding to both ssDNA and dsDNA (Figure 4B). The affinity of each domain for DNA was roughly the same and was an order of magnitude less than that of the full-length protein (Table 2). Unlike full-length xMcm10, the affinity of each domain for ssDNA was ~2-fold greater than for dsDNA. In order to test the effect of the Zn2+ motifs, binding experiments for each domain were again carried out in the presence of EDTA (Figure 4C). Both xMcm10-ID and -CTD exhibited a dramatic decrease in dsDNA binding affinity as a function of increasing EDTA concentration, whereas the ssDNA affinity was only moderately affected under the same conditions (Figure 4C). Interestingly, EDTA had a greater affect on ssDNA binding to the CTD than the ID, suggesting that ssDNA is able to bind to the ID in the absence of a folded zinc motif.

xMcm10 Binding to DNA Polymerase α-Primase is Localized to the ID and CTD

We investigated whether vertebrate Mcm10 can undergo direct, physical interactions with pol α, and if so, to map these interactions with the xMcm10 domains. Since purified recombinant human pol α has been shown to substitute functionally for the Xenopus laevis protein in in vitro Xenopus replication assays (45), human pol α was chosen for these experiments (Figure 5A). The first experiment examined the ability of the purified four-subunit human pol α-primase complex immobilized on beads to capture His-tagged xMcm10 domains from solution. After incubation with purified xMcm10-NTD, ID, or CTD and extensive washing, xMcm10 domains remaining bound to the beads were detected by denaturing gel electrophoresis and anti-His Western blot. Figure 5B shows the results of the pol α primase-Mcm10 affinity capture, in which both the ID and CTD, but not the NTD, bound to the polymerase complex. The experiment was repeated using only the purified catalytic pol α-p180 subunit in the absence of p48, p58, and p68. Again the NTD was not detected in the bound fraction, and both the ID and CTD bound to p180 (Figure 5C). This result demonstrates that the p180 subunit is sufficient to bind xMcm10-ID and CTD.

FIGURE 5
Binding of xMcm10 to the p180 subunit of DNA pol α

We next sought to map the specific Mcm10-binding region of p180. The p180 subunit has a modular organization with a ~300 residue N-terminal region dispensable for polymerase activity, an extended core region containing the conserved polymerase motifs, and a C-terminal region that complexes with the other subunits (46). Only the N-terminal region of p180 binds to SV40 T antigen, an interaction essential for viral DNA replication (47). Based on this information, an N-terminal construct encompassing p180 residues 1-323 (p180N) was tested. GST-tagged p180N immobilized on glutathione-sepharose was able to capture both the ID and CTD, but not the NTD, consistent with the pol α-primase and p180 pull-downs (Figure 5D). Thus, p180N is sufficient for Mcm10 interaction. These results also show that as for binding DNA, the ID and CTD function in a coordinated manner.

xMcm10 Does Not Contain Primase Activity

Based on the recent report that spMcm10 contains primase activity (29), we examined the ability of full-length xMcm10 to synthesize an oligoribonucleotide in the presence of a DNA template. Purified xMcm10 that contained no MBP-tag (Figure 1D) was incubated with dT50 template and [α-32P]ATP, and product RNA visualized by denaturing PAGE. No radiolabeled products were apparent when compared to a no-enzyme control reaction (Figure 6). Under identical conditions, pol α-primase showed robust, concentration dependent formation of oligoribonucleotides ~12 nucleotides in length. This result indicates that a purified preparation of xMcm10 is not capable of priming DNA.

FIGURE 6
xMcm10 does not contain primase activity

DISCUSSION

Modular architecture of Mcm10

The present work provides new insight into Mcm10’s role in initiation and elongation complexes by carrying out the first structure-function analysis of the protein. We have determined using limited proteolysis that purified preparations of xMcm10 contain at least three structural domains located from residues 1-145 (NTD), 230-417 (ID), and 596-860 (CTD) (Figure 7). The extreme proteolytic sensitivity of regions 146-230 and 418-596 suggests that these are exposed flexible linkers connecting each independently folded globular domain. It is likely that these flexible regions become more structured or protected from proteolytic cleavage when Mcm10 is part of the larger multiprotein replisome assembly. Nevertheless, the present work suggests that Mcm10 is at least able to adopt multiple conformations in which each globular domain can move relative to the other two. Such a flexible protein architecture would be necessary for the multiple protein and DNA transactions at an inherently dynamic replication fork. Indeed, many replication proteins have evolved modular architectures with distinct domains that are able to act independently or cooperatively to perform a common task (reviewed in 48,49). For example, separate structural domains often provide multiple binding sites that increase the affinity for one ligand, or that enable the protein to contact multiple ligands in a concerted or sequential fashion (50).

FIGURE 7
Domain and functional organization of xMcm10

Structural features of Mcm10-ID and -CTD

Motifs predicted within the ID and CTD provide a rationale for their interactions with DNA and pol α (Figure 7). The protein structure prediction Protein Homology/analogY Recognition Engine (PHYRE) program (51) and manual inspection of the xMcm10-CTD primary sequence identified two putative Zn2+-binding motifs (aa 692-755, 768-821) and a 3-helical bundle from the winged helix superfamily (aa 692-755) (Supplementary Figure S1). These motifs were not identified in yeast Mcm10 proteins. Previously identified motifs in the conserved ID were also found by this method, including an OB-fold (aa 286-346) and zinc motif (391-406) (22,23,27). Consistent with the ability of the ID and CTD to bind both DNA and pol α, OB-folds, winged helix bundles, and zinc motifs have each been shown to mediate protein-protein interactions in addition to their role in nucleic acid recognition (52-54).

The zinc-binding motifs are essential to the structure and function of Mcm10. Mutations in the putative CCCH-type zinc finger within the conserved ID have been shown to disrupt the association of scMcm10 with chromatin (22), to cause growth defects in yeast, and to disrupt the NMR chemical shift dispersion of purified scMcm10 (31). Our atomic absorption data show conclusively that one molar equivalent of zinc is present in the ID, and reveal two additional zinc atoms bound to the CTD (Table 1). The effect of Zn2+ chelation on Mcm10 DNA binding activity and protein stability (Figures (Figures3B,3B, 4A, and 4C; Table 2) helps to explain the dissociation of Mcm10 from chromatin in the S. cerevisiae mcm10-43 (C320Y in the ID) mutant (4,22).

The arrangement of the invariant Cys/His clusters in the xMcm10-CTD into a CX2CX10CX4H-(X13)-CXCX14CX2C consensus sequence (Figure 3A) raises several possibilities for the precise role of the CTD zinc motifs. On one hand, the sequences of each CCCH or CCCC cluster do not deviate significantly from the classical DNA sequence-specific CX2CX12HX3H zinc finger (55). However, there was no difference in binding affinities between either the ID or CTD tested against three different oligonucleotide sequences (data not shown), suggesting that Mcm10 does not recognize DNA in a sequence-specific manner. On the other hand, the two tandem cysteine-rich clusters in the CTD are remarkably similar in sequence to LIM domains and RING-finger motifs, which provide protein-binding interfaces important for a variety of cellular functions (reviewed in 56,57). It is noteworthy that the CTD zinc motif is immediately adjacent in the primary sequence to a putative winged helical (WH) bundle, which was predicted based on its similarity to that of the SCF ubiquitin ligase (58). The globular assembly formed from the RING protein Rbx1 and the WH of Cul1 in the SCF complex is an interaction integral to the cullin-RING ubiquitin ligase machinery (59,60). Thus, the zinc motif in xMcm10-CTD might stabilize the protein fold through a WH-RING interaction.

Structural and functional differences between vertebrate and yeast Mcm10

The lack of sequence conservation within the C-terminal region helps to reconcile differences in DNA binding activities of spMcm10 and xMcm10. The DNA binding affinity for spMcm10 N-terminal (1-303) and C-terminal (295-593) fragments, which are truncated between the putative OB-fold and zinc finger of the ID, was the same as that of the full-length protein (28). Full-length xMcm10, on the other hand, bound to DNA with 10-fold greater affinity than xMcm10-ID or -CTD alone (Table 2). Additionally, spMcm10 exhibited a 20-fold preference for ssDNA over dsDNA (28), whereas xMcm10 bound to ssDNA and dsDNA with the same affinity. Although the domain structure of yeast Mcm10 is unknown, these results are consistent with a second DNA binding domain in vertebrate xMcm10-CTD that is not present in the yeast proteins.

The sequence divergence and different DNA binding activities between vertebrate and yeast Mcm10 suggest that these proteins have evolved subtly different functions. An additional DNA binding domain may have evolved in response to the greater complexity of the genome and the lack of specific nucleotide sequences at origins of replication. Alternatively, the additional DNA and pol α binding domain and the lack of detectable primase activity in xMcm10 suggest that vertebrate Mcm10 evolved a means to recruit pol α-primase in lieu of itself priming DNA. Structural studies will be required to determine whether the ID and CTD are classical DNA binding domains, or if they form versatile structural scaffolds commonly observed in replication proteins (46,61-63).

Perspectives on Mcm10’s role at the replication fork

Structural arrangement of Mcm10 domains together with their macromolecular interactions provides insight into Mcm10 function. Our results are consistent with the notion that Mcm10 recruits pol α to origins of replication (7,27,28). With each of two separate domains encompassing DNA and pol α binding activities, Mcm10 might mediate a hand-off mechanism between pol α and DNA. Domain rearrangement to facilitate a handoff between replication proteins and DNA has been proposed for SV40 T antigen-mediated RPA loading onto DNA (64).

Evidence is provided here for NTD-mediated dimerization of vertebrate Mcm10 (Figure 2). Analytical ultracentrifugation clearly showed dimerization of the NTD with a Kd of ~3.1 μM. The full-length enzyme is predominantly monomeric at low concentration but also self-associates, and by analogy to NTD it is likely also a monomer-dimer system. We observed that the NTD of mammalian and yeast Mcm10 contains a predicted coiled-coil (Supplementary Figure S1), a highly asymmetric motif that would explain protein dimerization and the anomalously short gel filtration retention times of Mcm10 constructs containing the NTD. Indeed, frictional ratios calculated from the sedimentation data are indicative of a highly asymmetric protein. These data are consistent with glycerol gradient sedimentation results showing spMcm10 dimerization and suggesting an elongated scMcm10 structure (8), and are intriguing in light of the recent report that human Mcm10 forms a globular homohexameric assembly (41).

NTD-mediated dimerization raises the interesting possibility that Mcm10 interacts with both leading and lagging strand polymerases at a replication fork. Direct physical interactions between Mcm10 and pol α have now been observed in scMcm10, spMcm10, and xMcm10 (27,28), and genetic studies raise the possibility that Mcm10 also interacts with replicative polymerases δ and ε. The coiled-coil interaction would orient both subunits of the Mcm10 dimer in the same direction and consequently provide the polarity needed for the individual subunits to associate with co-directional leading and lagging strands.

The fact that xMcm10 did not preferentially bind to forked DNA substrates (Table 2) suggests that Mcm10 does not reside directly at the fork, but rather some distance behind the unwinding DNA. On the other hand, interactions between Mcm10 and Mcm2-7 subunits have been observed by yeast two-hybrid (23). Our data suggest that Mcm10 travels with pol α by association with the N-terminal end of p180. This region is dispensable for polymerase activity of p180 (46), suggesting that Mcm10 is capable of interacting with pol α during DNA synthesis. The p68 subunit of pol α has been reported to interact with SV40 T antigen, tethering pol α to the viral replication fork (65,66), but p68 did not interact with xMcm10 (data not shown). In addition, we were unable to detect a direct interaction between xCdc45 and pol α, or between xMcm10 and xCdc45 (data not shown).

In summary, the structural studies begun here provide a framework for future studies to elucidate the spatial arrangement of vertebrate Mcm10 and its binding partners and to develop a model for the action of these proteins within the replisome.

Supplementary Material

Fig S1-S5

Acknowledgments

The authors wish to thank Tim Bowles, Jami O’Quin and Laura Mizoue for technical assistance, Hassane McHaourab, Albert Beth, and Charles Cobb for access to fluorometers, and Walter Chazin for critical reading of the manuscript. We thank the Vanderbilt Academic Venture Capital Fund for support of the Proteomics Laboratory. Peptide sequencing was provided by the Protein Analysis Lab at Wake Forest University, and atomic zinc analysis was performed by Galbraith Laboratories. This work was funded by the National Institutes of Health (GM080570 to B.F.E. and GM52948 to E.F.) and the Vanderbilt Discovery Grant Program. Additional support for facilities came from the Vanderbilt Center in Molecular Toxicology (P30 ES000267). E.M.W. was supported from the Molecular Biophysics Training Grant (T32 GM08320).

REFERENCES

1. Maine GT, Sinha P, Tye BK. Genetics. 1984;106(3):365–385. [PMC free article] [PubMed]
2. Merchant AM, Kawasaki Y, Chen Y, Lei M, Tye BK. Mol Cell Biol. 1997;17(6):3261–3271. [PMC free article] [PubMed]
3. Nasmyth K, Nurse P. Mol Gen Genet. 1981;182(1):119–124. [PubMed]
4. Solomon NA, Wright MB, Chang S, Buckley AM, Dumas LB, Gaber RF. Yeast. 1992;8(4):273–289. [PubMed]
5. Blow JJ, Dutta A. Nat Rev Mol Cell Biol. 2005;6(6):476–486. [PMC free article] [PubMed]
6. Wohlschlegel JA, Dhar SK, Prokhorova TA, Dutta A, Walter JC. Mol Cell. 2002;9(2):233–240. [PubMed]
7. Ricke RM, Bielinsky AK. Mol Cell. 2004;16(2):173–185. [PubMed]
8. Lee JK, Seo YS, Hurwitz J. Proc Natl Acad Sci U S A. 2003;100(5):2334–2339. [PMC free article] [PubMed]
9. Walter J, Newport J. Mol Cell. 2000;5(4):617–627. [PubMed]
10. Takayama Y, Kamimura Y, Okawa M, Muramatsu S, Sugino A, Araki H. Genes Dev. 2003;17(9):1153–1165. [PMC free article] [PubMed]
11. Pacek M, Walter JC. Embo J. 2004;23(18):3667–3676. [PMC free article] [PubMed]
12. Pacek M, Tutter AV, Kubota Y, Takisawa H, Walter JC. Mol Cell. 2006;21(4):581–587. [PubMed]
13. Moyer SE, Lewis PW, Botchan MR. Proc Natl Acad Sci U S A. 2006;103(27):10236–10241. [PMC free article] [PubMed]
14. Gambus A, Jones RC, Sanchez-Diaz A, Kanemaki M, van Deursen F, Edmondson RD, Labib K. Nat Cell Biol. 2006;8(4):358–366. [PubMed]
15. Zegerman P, Diffley JF. Nature. 2007;445(7125):281–285. [PubMed]
16. Tanaka S, Umemori T, Hirai K, Muramatsu S, Kamimura Y, Araki H. Nature. 2007;445(7125):328–332. [PubMed]
17. Tanaka T, Nasmyth K. Embo J. 1998;17(17):5182–5191. [PMC free article] [PubMed]
18. Zou L, Stillman B. Mol Cell Biol. 2000;20(9):3086–3096. [PMC free article] [PubMed]
19. Yang X, Gregan J, Lindner K, Young H, Kearsey SE. BMC Mol Biol. 2005;6:13. [PMC free article] [PubMed]
20. Mimura S, Takisawa H. Embo J. 1998;17(19):5699–5707. [PMC free article] [PubMed]
21. Garg P, Burgers PM. Crit Rev Biochem Mol Biol. 2005;40(2):115–128. [PubMed]
22. Homesley L, Lei M, Kawasaki Y, Sawyer S, Christensen T, Tye BK. Genes Dev. 2000;14(8):913–926. [PMC free article] [PubMed]
23. Izumi M, Yanagi K, Mizuno T, Yokoi M, Kawasaki Y, Moon KY, Hurwitz J, Yatagai F, Hanaoka F. Nucleic Acids Res. 2000;28(23):4769–4777. [PMC free article] [PubMed]
24. Kawasaki Y, Hiraga S, Sugino A. Genes Cells. 2000;5(12):975–989. [PubMed]
25. Christensen TW, Tye BK. Mol Biol Cell. 2003;14(6):2206–2215. [PMC free article] [PubMed]
26. Gregan J, Lindner K, Brimage L, Franklin R, Namdar M, Hart EA, Aves SJ, Kearsey SE. Mol Biol Cell. 2003;14(9):3876–3887. [PMC free article] [PubMed]
27. Ricke RM, Bielinsky AK. J Biol Chem. 2006 [PubMed]
28. Fien K, Cho YS, Lee JK, Raychaudhuri S, Tappin I, Hurwitz J. J Biol Chem. 2004;279(16):16144–16153. [PubMed]
29. Fien K, Hurwitz J. J Biol Chem. 2006;281(31):22248–22260. [PubMed]
30. Das-Bradoo S, Ricke RM, Bielinsky AK. Mol Cell Biol. 2006;26(13):4806–4817. [PMC free article] [PubMed]
31. Cook CR, Kung G, Peterson FC, Volkman BF, Lei M. J Biol Chem. 2003;278(38):36051–36058. [PubMed]
32. Anumanthan G, Halder SK, Friedman DB, Datta PK. Cancer research. 2006;66(22):10824–10832. [PubMed]
33. Philo JS. Anal Biochem. 2000;279(2):151–163. [PubMed]
34. Stafford WF., 3rd. Anal Biochem. 1992;203(2):295–301. [PubMed]
35. Schuck P. Anal Biochem. 2003;320(1):104–124. [PubMed]
36. Stafford WF, Sherwood PJ. Biophysical chemistry. 2004;108(13):231–243. [PubMed]
37. Laue TM, Shah B, Ridgeway TM, Pelletier SL. SEDNTERP. Royal Society of Chemistry; UK: 1992.
38. Voitenleitner C, Fanning E, Nasheuer HP. Oncogene. 1997;14(13):1611–1615. [PubMed]
39. Smith DB, Johnson KS. Gene. 1988;67(1):31–40. [PubMed]
40. Walter J, Sun L, Newport J. Mol Cell. 1998;1(4):519–529. [PubMed]
41. Okorokov AL, Waugh A, Hodgkinson J, Murthy A, Hong HK, Leo E, Sherman MB, Stoeber K, Orlova EV, Williams GH. EMBO reports. 2007;8(10):925–930. [PMC free article] [PubMed]
42. de la Torre J. G. Garcia, Bloomfield VA. Quarterly reviews of biophysics. 1981;14(1):81–139. [PubMed]
43. Kwon K, Cao C, Stivers JT. J Biol Chem. 2003;278(21):19442–19446. [PubMed]
44. Metz AH, Hollis T, Eichman BF. Embo J. 2007;26(9):2411–2420. [PMC free article] [PubMed]
45. Michael WM, Ott R, Fanning E, Newport J. Science. 2000;289(5487):2133–2137. [PubMed]
46. Mizuno T, Yamagishi K, Miyazawa H, Hanaoka F. Mol Cell Biol. 1999;19(11):7886–7896. [PMC free article] [PubMed]
47. Dornreiter I, Copeland WC, Wang TS. Mol Cell Biol. 1993;13(2):809–820. [PMC free article] [PubMed]
48. Stauffer ME, Chazin WJ. J Biol Chem. 2004;279(30):30915–30918. [PubMed]
49. Fanning E, Klimovich V, Nager AR. Nucleic Acids Res. 2006;34(15):4126–4137. [PMC free article] [PubMed]
50. Arunkumar AI, Stauffer ME, Bochkareva E, Bochkarev A, Chazin WJ. J Biol Chem. 2003;278(42):41077–41082. [PubMed]
51. Kelley L, MacCallum R, Sternberg M. J. Mol. Biol. 2000;299:499–520. [PubMed]
52. Mer G, Bochkarev A, Gupta R, Bochkareva E, Frappier L, Ingles CJ, Edwards AM, Chazin WJ. Cell. 2000;103(3):449–456. [PubMed]
53. Stauffer ME, Chazin WJ. J Biol Chem. 2004;279(24):25638–25645. [PubMed]
54. Leon O, Roth M. Biol Res. 2000;33(1):21–30. [PubMed]
55. Klug A, Schwabe JW. Faseb J. 1995;9(8):597–604. [PubMed]
56. Kadrmas JL, Beckerle MC. Nat Rev Mol Cell Biol. 2004;5(11):920–931. [PubMed]
57. Borden KL. J Mol Biol. 2000;295(5):1103–1112. [PubMed]
58. Murzin AG, Brenner SE, Hubbard T, Chothia C. J Mol Biol. 1995;247(4):536–540. [PubMed]
59. Petroski MD, Deshaies RJ. Nat Rev Mol Cell Biol. 2005;6(1):9–20. [PubMed]
60. Zheng N, Schulman BA, Song L, Miller JJ, Jeffrey PD, Wang P, Chu C, Koepp DM, Elledge SJ, Pagano M, Conaway RC, Conaway JW, Harper JW, Pavletich NP. Nature. 2002;416(6882):703–709. [PubMed]
61. Shamoo Y, Friedman AM, Parsons MR, Konigsberg WH, Steitz TA. Nature. 1995;376(6538):362–366. [PubMed]
62. Lee JY, Chang C, Song HK, Moon J, Yang JK, Kim HK, Kwon ST, Suh SW. Embo J. 2000;19(5):1119–1129. [PMC free article] [PubMed]
63. Bochkareva E, Korolev S, Lees-Miller SP, Bochkarev A. Embo J. 2002;21(7):1855–1863. [PMC free article] [PubMed]
64. Jiang X, Klimovich V, Arunkumar AI, Hysinger EB, Wang Y, Ott RD, Guler GD, Weiner B, Chazin WJ, Fanning E. Embo J. 2006;25(23):5516–5526. [PMC free article] [PubMed]
65. Collins KL, Russo AA, Tseng BY, Kelly TJ. Embo J. 1993;12(12):4555–4566. [PMC free article] [PubMed]
66. Ott RD, Rehfuess C, Podust VN, Clark JE, Fanning E. Mol Cell Biol. 2002;22(16):5669–5678. [PMC free article] [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...