• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
Circ Res. Author manuscript; available in PMC Nov 21, 2009.
Published in final edited form as:
PMCID: PMC2746824
NIHMSID: NIHMS126745

Mesencephalic Astrocyte-derived Neurotrophic Factor (MANF) is an Ischemia-inducible Secreted Endoplasmic Reticulum (ER) Stress Response Protein in the Heart

Abstract

The endoplasmic reticulum (ER) stress response (ERSR) is activated when folding of nascent proteins in the ER lumen is impeded. Myocardial ischemia was recently shown to activate the ERSR; however, the role of this complex signaling system in the heart is not well understood. ER stress activates the transcription factor, ATF6, which induces expression of proteins targeted to the ER, where they restore protein folding, thus fostering cytoprotection. We previously developed a transgenic mouse line that expresses a conditionally-activated form of ATF6 in the heart. In this mouse line, ATF6 activation decreased ischemic damage in an ex vivo model of myocardial ischemia/reperfusion, and induced numerous genes, including mesencephalic astrocyte-derived neurotrophic factor (MANF). In the present study, MANF expression was shown to be induced in cardiac myocytes and in other cell types in the hearts of mice subjected to in vivo myocardial infarction. Additionally, simulated ischemia induced MANF in an ATF6-dependent manner in neonatal rat ventricular myocyte cultures (NRVMC). In contrast to many other ER-resident ERSR proteins, MANF lacks a canonical ER-retention sequence, consistent with our finding that MANF was readily secreted from cultured cardiac myocytes. Knock-down of endogenous MANF with miRNA increased cell death upon simulated I/R, while addition of recombinant MANF to media protected cultured cardiac myocytes from simulated I/R-mediated death. Thus, one possible function of the ERSR in the heart is the ischemia-mediated induction of secreted proteins, such as MANF, that can function in an autocrine/paracrine manner to modulate myocardial damage from ER stresses, including ischemia.

Keywords: Adenovirus, Cardiac muscle, Cardiac myocytes, Cardiomyocytes, Caspase activation, Endoplasmic reticulum stress, Gene expression, Hypoxia, Ischemia, Myocardial infarction, Transcription factors, Unfolded protein response

Introduction

Numerous proteins that are critical to cellular function are synthesized endoplasmic reticulum (ER) ribosomes, then folded and further post-translationally modified in the ER lumen. Stresses that impede ER protein folding trigger the ER stress response (ERSR) 14, a signaling system that has not been studied extensively in the heart. ER stress activates the transcription factors, X-box binding protein (XBP1) and activator of transcription-6 (ATF6), which induce numerous ERSR proteins designed to restore efficient ER protein folding, which contributes to resisting the stress 5,6. Many ERSR genes are induced by ATF6 or XBP1, while others exhibit a requirement for only one of the two factors 7.

The folding of proteins in the ER lumen requires molecular oxygen 8, suggesting that that hypoxia-mediated induction of ERSR proteins during myocardial ischemia may enhance ER protein folding in and survival of cardiac myocytes and limit ischemic damage. Consistent with this hypothesis are recent studies showing that simulated ischemia (sI) activates the ERSR in cultured rat and mouse ventricular myocytes, and that ER stress is activated in the surviving myocytes adjacent to the damaged region in a mouse model of in vivo myocardial infarction 912.

To examine potential functions for ER stress in the heart, we developed a transgenic mouse line that expresses a conditionally-activated form of ATF6 in the heart, allowing selective activation of this branch of the ERSR at any time. A microarray analysis showed that one of the 381 genes induced in response to ATF6 activation in cardiac myocytes in vivo was arginine-rich mutated in early tumors, or ARMET 13. The protein encoded by the ARMET had not been isolated until recent studies showed that in astrocytes, ARMET encodes a 158 amino acid protein that is secreted and enhances survival of cultured dopaminergic neurons 14. Based on these characteristics, the authors of this study named the protein, mesencephalic astrocyte-derived neurotrophic factor (MANF).

Previous microarray studies on fibroblasts showed that MANF might be an ERSR gene 7. Moreover, the MANF gene was induced by hypoxia in HeLa cells 15, as well as in the surviving myocardium in mouse hearts subjected to in vivo myocardial infarction 16. The current study was undertaken to determine whether MANF is expressed as an ischemia-inducible ERSR gene in cardiac myocytes, and to examine possible roles for MANF on cardiac myocyte survival during ischemic stress.

Methods

Animals

The transgenic mice used in this study have been described previously 9. Approximately 100 neonatal rats and 24 adult male non-transgenic and transgenic C57/BL6 mice were used. All procedures were in compliance with the San Diego State University Institutional Animal Care and Use Committee. In vivo myocardial infarction, immunoblotting and sectioning for immunocytofluorescence were carried out as described 17.

Statistics

Statistical treatments were carried out by ANOVA followed by Newman-Keul’s post-hoc analysis. Unless otherwise stated, *, § p < 0.05 different from all other values.

Cultured Cardiac Myocytes

Primary neonatal rat ventricular myocyte cultures (NRVMC) were prepared as previously described 10.

Real Time Quantitative PCR

Real time quantitative PCR was performed as previously described 9.

The following rat primers were used:

  • MANF, Forward: TGCAAAGGCTGTGCAGAGAAG
    MANF, Reverse: ATGAACTGCTGTTTCCCTCCG
    GAPDH, Forward: CCTGGCCAAGGTCATCCAT
    GAPDH, Reverse: GTCATGAGCCCTTCCACGAT

The following mouse primers were used:

  • MANF, Forward: TGGGTGCGTTCTTCGACAT
    MANF, Reverse: GACGGTTGCTGGATCATTGAT

Immunocytofluorescence and Immunoblots

Immunofluorescent confocal microscopy was carried out as previously described 10,17. The MANF antibody (R&D Systems, Catalog# AF3748) was used at 1:25. Immunoblots were performed as previously described 10 using the MANF antibody at 1:2000.

MANF Mammalian Expression Construct and Adenovirus

The coding sequence of the mouse MANF gene (GenBank Accession AK131997) was cloned into pcDNA 3.1 containing a C-terminus 3x HA tag using standard cloning procedures. A recombinant adenoviral strain was then prepared using the mouse MANF cDNA, as described 10.

MANF Bacterial Expression Construct

The mouse MANF cDNA without the N-terminal signal sequence (amino acids 1–21) was amplified and cloned into a cleavable N-terminal 6x–His containing prSET-B (Invitrogen, Catalog # V351-20), then transformed into BL-21 cells (Stratagene, Catalog # 200131). Recombinant protein was purified from bacterial extracts using Ni-NTA agarose columns (Qiagen, Catalog #30210). The His-tag was removed as described in the manual (Invitrogen, Catalog #45–0437). The cleaved protein was purified by size-exclusion column (Millipore Centricon, Catalog #4225).

Caspase-3 Activity Assay

Cells were infected with various recombinant adenovirus strains (AdV) in 2% FCS-containing medium for 6h, after which cells were washed and fed with the same medium, but without the AdV. One day after infection = day 0; cells were maintained in this serum-starved condition for 0 to 7 days. In other experiments, recombinant MANF or equivalent molar quantities of bovine serum albumin was added to culture medium; in these experiments, all cells were infected with control AdV to maintain consistency between experimental protocols. At days 0, 3 or 7, cultures were extracted in assay buffer containing 50 mM Hepes, pH 7.4, 0.1% CHAPS, 0.1mM EDTA. Fifty µl of the lysate and 10 µl of the assay buffer were then combined with 45 µl of reaction buffer [40 µl caspase assay buffer, 1 mM DTT, 40 µM DEVD-AFC in DMSO (Sigma, Catalog #A0466)]. After 1h at 37°C, fluorescence was measured at an excitation wavelength of 400 nm and an emission wavelength of 505 nm. Caspase activity was defined as fluorescence/protein.

MANF-luciferase and MANF-M-luciferase Constructs

Native and mutated versions of the 5’-flanking sequence of the mouse MANF gene from −1513 to +17 were cloned into a luciferase reporter vector.

Reporter Enzyme Assay

Reporter enzyme assays for luciferase and β-galactosidase were carried out as previously described 10.

Results

MANF mRNA was examined in the hearts of ATF6-transgenic (TG) mice that consitutively express a tamoxifen-activated form of ATF6 in cardiac myocytes 9. MANF mRNA was very low in the hearts of non-transgenic (NTG) mice treated ± tamoxifen, and was increased by 2.5-fold in the hearts of untreated TG mice (Fig. 1A, bars 1–3). However, compared to NTG, MANF mRNA was increased by 10-fold in the hearts of tamoxifen-treated transgenic mice (Fig. 1A, bar 4). MANF protein expression was examined in mouse heart sections by confocal immunocytofluorescence microscopy. While MANF was almost undetectable in the myocardium of TG mice in the absence of tamoxifen (Fig. 1B, panels 1 and 4), it was elevated considerably in hearts from tamoxifen-treated TG mice (Fig. 1C, panels 1, 4 and 5). These results demonstrated that MANF mRNA and protein were induced upon ATF6 activation in the myocardium, in vivo, consistent with the hypothesis that ER stresses, such as ischemia, which can activate ATF6, might also induce MANF expression in the heart.

Figure 1
Effect of ATF6 on MANF Expression in the Mouse Heart

Since ER stress is activated in the mouse heart by myocardial infarction, in vivo 10, the expression of MANF in infarcted mouse hearts was examined using confocal immunocytofluorescence microscopy and immunoblotting. MANF expression was essentially undetectable in sections of the hearts of mice subjected to sham infarct surgery (Fig. 2A, panels 1–4). In contrast, 4 days after infarct surgery, MANF protein was elevated in cells in the infarct zone, which, since they did not stain for tropomyosin, may be non-myocytes, and in tropomyosin-positive myocytes bordering the infarct (Fig. 2B, panels 1–4; arrows point to myocytes). MANF expression was also examined by immunoblotting of heart tissue obtained at various times from the peri-infarct zone of hearts subjected to sham or permanent occlusion infarct surgery, as previously described 17. While MANF was undetectable in the sham sample, as well as samples from hearts obtained from animals up to 3 days after infarction, by 4 days following infarction, MANF levels were clearly elevated. The level of MANF increased further at 7 and 14d following infarction (Figure 2C and D). Taken together, these results demonstrate that MANF increased in myocytes and, perhaps non-myocytes, in the border zone and infarct zone in a mouse model of in vivo myocardial infarction.

Figure 2
Effect of Myocardial Infarction on MANF Expression

To examine MANF expression on the cellular level in cardiac myocytes, a neonatal rat ventricular myocyte culture (NRVMC) model system was used. Immunocytofluorescence showed that while it was expressed in very low levels in untreated cultured cardiac myocytes (Fig. 3A and D, Panel 1), MANF increased dramatically in cells subjected to simulated ischemia (sI) (Fig. 3B and E, Panel 1), or in cells treated with the prototypical ER stressor, tunicamycin (TM) (Fig. 3C and F, Panel 1). To examine the intracellular location of MANF, the expression of GRP78, a well characterized ER-resident ERSR protein, was assessed. As expected for an ERSR protein, GRP78 was increased by sI or TM (Fig. 3B and C, Panel 2). Moreover, there was significant, although not complete co-localization of MANF and GRP78, as indicated by the striking similarities in the staining patterns (Fig. 3B and 3C, compare Panels 1 and 2), as well as yellow fluorescence in the merged image of the red and green MANF and GRP78 images, respecitvely (Fig. 3B and C, Panel 3). Finally, co-staining for the cardiac myocyte-specific protein, α-actinin, demonstrated that the cultures were mostly cardiac myocytes, that MANF staining was mostly perinuclear and it did not localize in a sarcomeric pattern (Fig. 3E and F, Panels 2 and 3). Thus, most of the MANF in cardiac myocytes is co-localized with the known ER-resident protein, GRP78, consistent with MANF being an ER-resident protein.

Figure 3
Microscopic Examination of MANF in Cultured Cardiac Myocytes

To examine molecular characteristics of MANF expression, MANF mRNA and protein were measured in extracts of NRVMC subjected to ER stress. MANF mRNA increased by 2- and 5-fold when NRVMCs were subjected to sI, or treated with TM, respectively (Fig. 4A, bars 2 and 3). Moreover, cellular MANF protein increased by 2- to 2.5-fold in response to sI, or TM, respectively (Fig. 4B, lanes 4–9 and bars 2 and 3). Thus, in cultured cardiac myocytes, MANF is induced by two different activators of ER stress, TM and sI.

Figure 4
Effects of Simulated Ischemia, Tunicamycin, ATF6 or XBP1 on MANF Expression

To study the mechanism of MANF induction, the effects of overexpressing activated ATF6 or XBP1 were examined. Cardiac myocytes infected with recombinant adenoviral strains encoding activated forms of ATF6 or XBP1 exhibited 10- and 5-fold increases in MANF mRNA, respectively (Fig. 4C, bars 2 and 3). ATF6 and XBP1 also increased cellular MANF protein levels by 3.5- and 5-fold, respectively (Fig. 4D, lanes 4–9 and bars 2 and 3). These results indicate that MANF gene expression in cultured cardiac myocytes can be induced by either ATF6 or XBP1, a hallmark of many ERSR genes.

To explore the roles for endogenous ATF6 and XBP1 on MANF induction, cultures were infected with recombinant adenovirus strains encoding dominant negative (DN) forms of each transcription factor, which are recombinant forms that retain their DNA-binding domains, but do not have transcriptional activation domains10,18. Compared to cells infected with a control adenovirus, cardiac myocytes infected with DN-ATF6 adenovirus exhibited reduced levels of MANF mRNA and protein in response to sI, or TM (Fig. 5A, bars 3–6; Fig. 5B, lanes 13–18 and bars 3–6). Cultures infected with DN-XBP1 adenovirus also exhibited reduced MANF mRNA and protein (Fig. 5C and 5D), indicating that either endogenous ATF6 or XBP1 participate in MANF induction in response to ER stress in cultured cardiac myocytes.

Figure 5
Effects of Adenovirus-encoded Dominant-negative ATF6 or XBP1 on MANF Expression

To determine whether ER stress can activate the MANF promoter in cardiac myocytes, a construct encoding the 5’-flanking sequence and promoter of mouse MANF comprised of nucleotides −1513 to +17 driving firefly luciferase was generated (Fig. 6A). When cultured cardiac myocytes were transfected with this construct, relative luciferase increased by 3- and 10-fold when cells were subjected to sI, or TM, respectively (Fig. 6B, bars 1–3). In contrast, induction of MANF-luciferase by either treatment was effectively blocked by DN-ATF6 (Fig. 6B, bars 4–6) or DN-XBP1 (Fig. 6B, bars 7–9). ATF6 and XBP1 confer ERSR gene induction through at least 3 types of ER stress response elements (ERSE); the canonical ERSE 1921, the ERSE-II 22, and the unfolded protein response element 22. A search of the mouse or human MANF 5’-flanking sequence showed that there are two putative ERSEs in the promoter-proximal 1.5 kb; one canonical ERSE 19, located at −492 to −473, and one ERSE-II 23, located at −134 to −124 in the mouse gene. Mutation of the putative ERSE-II located at −134 to −124 (Fig. 6A M1) resulted in a 10-fold decrease of MANF-luciferase induction by sI or TM (Fig. 6C, bars 1–3 vs 4–6); however, mutation of the putative ERSE located at −492 to −473 (Fig. 6A M2) resulted in much less inhibition (Fig. 6D, bars 1–3 vs 7–9). The requirement of the ERSE at −134 to −124 for MANF induction by either ATF6 or XBP1 is consistent with other ERSR genes, where an ERSE-II can bind either factors and confer transcriptional induction in response to ER stress 22. These findings are also supported by a recent study showing the need for the ERSE at −130 bp in the mouse MANF gene for promoter induction by TM in cultured pancreatic β-cells 24.

Figure 6
MANF Promoter Analyses

Since MANF possesses a C-terminal RTDL that does not conform with canonical ER-retention/retrieval sequences (i.e. KDEL), it is possible that MANF is not effectively retained in the ER. When cardiac myocytes were cultured under non-stressed conditions, MANF was detectible in cell extracts, but not in culture medium (Fig. 7A, lanes 1–3). However, when subjected to ER stress, cellular MANF expression increased, as expected, and there was a robust increase in MANF in the medium (Fig. 7A, lanes 4–6). Immunoblots for ERSR proteins that have a canonical C-terminal KDEL demonstrated strong induction of glucose regulated proteins 94 and 78 (GRP94 and GRP78), upon ER stress; however, even with this strong induction, neither was detected in the medium, (Fig. 7B, lanes 4–6), nor was GAPDH (Fig. 7C). The lack of GRP94, GRP78 and GAPDH in the medium verified that the cells were not dying and in so doing, releasing their contents, including MANF, in response to TM treatment, and that the appearance of MANF in the medium is most likely due to secretion. Thus, unlike proteins with a C-terminal KDEL, MANF can be released from cardiac myocytes, suggesting that, in part, it may function in an extracellular manner.

Figure 7
MANF Secretion and MANF Overexpression

To examine possible functions of MANF in cardiac myocytes, a MANF-encoding recombinant adenoviral strain (MANF-AdV) was generated. Compared to cells infected with a control strain of adenovirus (Con-AdV), cells infected with MANF-AdV exhibited increased cellular and secreted MANF (Fig. 7D, lanes 4–6), even in the absence of ER stress. When Con-AdV-infected cells were maintained for various times in serum-free medium, which lacks growth factors and leads to apoptosis of cultured cardiac myocytes 25, the activity of caspase-3, an indicator of apoptosis, increased by 3- and 4-fold after maintenance for 3 and 7d in serum-free medium, respectively (Fig. 7E, bars 1, 3 and 5). In contrast, MANF-AdV-infected cells exhibited no significant increase in caspase-3 activation (Fig. 7E, bars 2, 4 and 6). The effects of MANF-AdV on sI or simulated ischemia/reperfusion (sI/R)-mediated cell death were also examined. In Con-AdV-infected cultures, sI and sI/R increased cell death by about 2- and 3-fold, respectively (Fig. 7F lanes 1, 3 and 5). However, cell death from either sI or sI/R was decreased by about 50% in cultures infected with MANF-AdV (Fig. 7F lanes 2, 4 and 6). These results indicate that MANF can protect cardiac myocytes from apoptotic cell death in response to a variety of stresses.

To examine whether MANF functions in an extracellular manner, recombinant mouse MANF (rMANF), purified from bacterial extracts, was added to NRVMC medium. Compared with equimolar quantities of a control protein, bovine serum albumin, rMANF decreased caspase-3 activation by serum starvation in a dose-dependent manner, with a half-maximal effect at 6.6 nM (Fig. 8A, bars 4–7). This level was lower than that of MANF found in the medium of TM-treated NRVMC, 140 nM, which was estimated using immunoblotting and rMANF as a standard (Fig. 8B), consistent with the hypothesis that, at least in part, it is secreted MANF that is responsible for the protection observed in MANF-overexpressing cells. The effects of rMANF on sI or sI/R-induced cardiac myocyte death were also examined. sI and sI/R-mediated cell death were significantly reduced by adding rMANF to culture medium (Fig. 8C).

Figure 8
Effects of Recombinant MANF on Cariomyocyte Death

To examine the effects of endogenous MANF on cell survival, recombinant AdV encoding micro (mi) RNAs targeted to rat MANF were generated, as was miRNA that was not targeted to any known mRNA. Either of the two miRNAs, AdV MANF-1 and/or AdV MANF-2, decreased endogenous MANF mRNA and protein levels in cultured cardiac myocytes by 90% (Fig. 8D and 8E). While MANF miRNA had no effect on cell death under control conditions (Fig. 8F, bars 1 and 2), it significantly increased sI/R-mediated cell death (Fig. 8F, compare bars 4 and 5), consistent with a protective role for endogenous MANF. Interestingly, the addition of recombinant MANF to cultures that expressed MANF miRNA reduced sI/R-mediated cell death back to levels observed in cells expressing control miRNA (Fig. 8F, bars 4 and 6). These results are consistent with a protective role for MANF, and demonstrate that the loss of protection observed upon miRNA-mediated knock down of endogenous MANF can be partially restored by addition of recombinant MANF to the culture medium.

Discussion

This study supports the hypothesis that MANF is a novel ERSR gene in the heart that can be induced and secreted in response to ER stresses, including ischemia, and that extracellular MANF may protect cardiac myocytes in an autocrine and paracrine manner. The results that support this hypothesis include the findings that MANF was induced by ATF6 activation in the myocardium, in vivo, and in myocytes and non-myocytes in the infarct and infarct border zones in a mouse model of in vivo myocardial infarction. Additionally, the MANF promoter, mRNA and protein were all induced in an ATF6 and XBP1-dependent manner in cultured cardiac myocytes by TM or simulated ischemia. Finally, the demonstration that MANF can be released from cardiac myocytes, and that at nM levels, extracellular recombinant MANF protected myocytes from apoptosis, even in the absence of endogenous MANF, supports a paracrine and/or endocrine mechanism of function for this novel secreted protein.

This is the first study to demonstrate the secretion of an ERSR protein from cardiac myocytes, and to show that an ERSR protein can function in an autocrine and/or paracrine manner to protect cardiac myocytes. The structure of MANF may reveal important details of the possible mechanism by which this ERSR protein functions in the heart. MANF is targeted to the ER in a manner that is similar to many other ER-targeted ERSR proteins. The MANF gene predicts a 179 amino acid protein, and, according to SignalP 3.0, the N-terminal 21 amino acids serve as a signal sequence, responsible for targeting nascent MANF to the ER lumen in a co-translational manner 26. Accordingly, the co-translational removal of the 21 amino acid signal sequence is predicted to result in the observed 158 amino acid mature product in the ER lumen. However, MANF is unusual amongst ER lumen-targeted ERSR proteins, because, as shown in the present study, it is inefficiently retained in the ER, which may lead to its secretion during ER stress. There are several ways proteins are retained in the ER lumen, the major mechanism requires a C-terminal KDEL sequence, which facilitates binding of ER proteins the ER-transmembrane KDEL receptor, facilitating retention in the ER 27. Thus, while most proteins retained in the ER possess an C-terminal KDEL, MANF has a C-terminal RTDL, which fosters ER retention, albeit, less effectively than KDEL 28. In contrast to the KDEL-containing ER-resident, ERSR proteins, GRP94 and GRP78, significant quantities of MANF were found in the medium during ER stress (Fig. 7), suggesting a weaker retention in the ER than KDEL-containing proteins.

The results from this study indicate that MANF may exert at least a portion of its protective function extracellularly, in a paracrine and/or autocrine manner. Since it is a relatively large, hyrdophillic protein, that is not predicted to readily pass through the cell membrane, MANF most likely functions by binding to a cell-surface receptor. In carrying out bioinformatics analyses in attempts to determine the nature of such receptors we were unable to find any MANF-like proteins for which cell-surface receptors had been identified. Thus, at the present time, we cannot predict the nature of the receptor(s) responsible for the effects of extracellular MANF on cardiac myocyte survival. However, the concentration of MANF needed to protect cardiac myocytes (~6–7 nM) (Fig. 8), which is similar to that needed to protect dopaminergic neurons (~3 nM) in a previous study 29, is typical for other cell-surface receptor-mediated events, lending reasonable support to the hypothetical existence of MANF receptors on cardiac myocytes.

In summary, the present study has revealed many novel features about MANF as a novel secreted protein; however, a great deal remains to be understood about the role of MANF in the heart. For example, identification of the MANF receptor, as well as the signaling pathway by which MANF exerts its protective function, will be required in order to more fully appreciate the possible roles of MANF in the normal and diseased myocardium.

Acknowledgments

SOURCES OF FUNDING:

This work was supported by grants from the National Institutes of Health, HL-075573 and HL-085577. PJB and NG are Fellows of the Rees-Stealy Research Foundation and the San Diego State University Heart Institute. PJB is a scholar of the San Diego Chapter of the Achievement Rewards for College Scientists (ARCS) Foundation and a recipient of an American Heart Association Pre-doctoral Fellowship.

Footnotes

DISCLOSURES:None

References

1. Lee A. The Glucose-regulated Proteins: Stress Induction and Clinical Applications. Trends Biochem Sci. 2001;26:504–510. [PubMed]
2. Wu J, Kaufman RJ. From acute ER stress to physiological roles of the Unfolded Protein Response. Cell Death Differ. 2006;13:374–384. [PubMed]
3. Xu C, Bailly-Maitre B, Reed JC. Endoplasmic reticulum stress: cell life and death decisions. J Clin Invest. 2005;115:2656–2664. [PMC free article] [PubMed]
4. Glembotski CC. Endoplasmic reticulum stress in the heart. Circ Res. 2007;101:975–984. [PubMed]
5. Bailey D, O'Hare P. Transmembrane bZIP transcription factors in ER stress signaling and the unfolded protein response. Antioxid Redox Signal. 2007;9:2305–2321. [PubMed]
6. Yoshida H. Unconventional splicing of XBP-1 mRNA in the unfolded protein response. Antioxid Redox Signal. 2007;9:2323–2333. [PubMed]
7. Lee AH, Iwakoshi NN, Glimcher LH. XBP-1 regulates a subset of endoplasmic reticulum resident chaperone genes in the unfolded protein response. Mol Cell Biol. 2003;23:7448–7459. [PMC free article] [PubMed]
8. Tu BP, Weissman JS. The FAD- and O(2)-dependent reaction cycle of Ero1-mediated oxidative protein folding in the endoplasmic reticulum. Mol Cell. 2002;10:983–994. [PubMed]
9. Martindale JJ, Fernandez R, Thuerauf D, Whittaker R, Gude N, Sussman MA, Glembotski CC. Endoplasmic reticulum stress gene induction and protection from ischemia/reperfusion injury in the hearts of transgenic mice with a tamoxifen-regulated form of ATF6. Circ Res. 2006;98:1186–1193. [PubMed]
10. Thuerauf DJ, Marcinko M, Gude N RubioM, Sussman MA, Glembotski CC. Activation of the unfolded protein response in infarcted mouse heart and hypoxic cultured cardiac myocytes. Circ Res. 2006;99:275–282. [PubMed]
11. Terai K, Hiramoto Y, Masaki M, Sugiyama S, Kuroda T, Hori M, Kawase I, Hirota H. AMP-activated protein kinase protects cardiomyocytes against hypoxic injury through attenuation of endoplasmic reticulum stress. Mol Cell Biol. 2005;25:9554–9575. [PMC free article] [PubMed]
12. Szegezdi E, Duffy A, O'Mahoney ME, Logue SE, Mylotte LA, O'Brien T, Samali A. ER stress contributes to ischemia-induced cardiomyocyte apoptosis. Biochem Biophys Res Commun. 2006;349:1406–1411. [PubMed]
13. Belmont PJ, Tadimalla A, Chen WJ, Martindale JJ, Thuerauf DJ, Marcinko M, Gude N, Sussman MA, Glembotski CC. Coordination of growth and ER stress signaling by regulator of calcineurin 1 (RCAN1),a novel ATF6-inducible gene. J Biol Chem. 2008 [PMC free article] [PubMed]
14. Petrova P, Raibekas A, Pevsner J, Vigo N, Anafi M, Moore MK, Peaire AE, Shridhar V, Smith DI, Kelly J, Durocher Y, Commissiong JW. MANF: a new mesencephalic, astrocyte-derived neurotrophic factor with selectivity for dopaminergic neurons. J Mol Neurosci. 2003;20:173–188. [PubMed]
15. Romero-Ramirez L, Cao H, Nelson D, Hammond E, Lee AH, Yoshida H, Mori K, Glimcher LH, Denko NC, Giaccia AJ, Le QT, Koong AC. XBP1 is essential for survival under hypoxic conditions and is required for tumor growth. Cancer Res. 2004;64:5943–5947. [PubMed]
16. Harpster MH, Bandyopadhyay S, Thomas DP, Ivanov PS, Keele JA, Pineguina N, Gao B, Amarendran V, Gomelsky M, McCormick RJ, Stayton MM. Earliest changes in the left ventricular transcriptome postmyocardial infarction. Mamm Genome. 2006;17:701–715. [PubMed]
17. Gude NA, Emmanuel G, Wu W, Cottage CT, Fischer K, Quijada P, Muraski JA, Alvarez R, Rubio M, Schaefer E, Sussman MA. Activation of Notch-Mediated Protective Signaling in the Myocardium. Circ Res. 2008 [PMC free article] [PubMed]
18. Thuerauf DJ, Morrison LE, Hoover H, Glembotski CC. Coordination of ATF6-mediated transcription and ATF6 degradation by a domain that is shared with the viral transcription factor, VP16. J Biol Chem. 2002;277:20734–20739. [PubMed]
19. Yoshida H, Haze K, Yanagi H, Yura T, Mori K. Identification of the cis-acting endoplasmic reticulum stress response element responsible for transcriptional induction of mammalian glucose-regulated proteins. Involvement of basic leucine zipper transcription factors. J Biol Chem. 1998;273:33741–33749. [PubMed]
20. Yoshida H, Okada T, Haze K, Yanagi H, Yura T, Negishi M, Mori K. ATF6 activated by proteolysis binds in the presence of NF-Y (CBF) directly to the cis-acting element responsible for the mammalian unfolded protein response. Mol Cell Biol. 2000;20:6755–6767. [PMC free article] [PubMed]
21. Yoshida H, Okada T, Haze K, Yanagi H, Yura T, Negishi M, Mori K. Endoplasmic reticulum stress-induced formation of transcription factor complex ERSF including NF-Y (CBF) and activating transcription factors 6alpha and 6beta that activates the mammalian unfolded protein response. Mol Cell Biol. 2001;21:1239–1248. [PMC free article] [PubMed]
22. Yamamoto K, Yoshida H, Kokame K, Kaufman RJ, Mori K. Differential contributions of ATF6 and XBP1 to the activation of endoplasmic reticulum stress-responsive cis-acting elements ERSE, UPRE and ERSE-II. J Biochem. 2004;136:343–350. [PubMed]
23. Kokame K, Kato H, Miyata T. Identification of ERSE-II, a new cis-acting element responsible for the ATF6-dependent mammalian unfolded protein response. J Biol Chem. 2001;276:9199–9205. [PubMed]
24. Mizobuchi N, Hoseki J, Kubota H, Toyokuni S, Nozaki J, Naitoh M, Koizumi A, Nagata K. ARMET is a soluble ER protein induced by the unfolded protein response via ERSE-II element. Cell Struct Funct. 2007;32:41–50. [PubMed]
25. Sheng Z, Knowlton K, Chen J, Hoshijima M, Brown JH, Chien KR. Cardiotrophin 1 (CT-1) inhibition of cardiac myocyte apoptosis via a mitogen-activated protein kinase-dependentpathway. Divergence from downstream CT-1 signals for myocardial cell hypertrophy. J Biol Chem. 1997;272:5783–5791. [PubMed]
26. Bendtsen JD, Nielsen H, von Heijne G, Brunak S. Improved prediction of signal peptides: SignalP 3.0. J Mol Biol. 2004;340:783–795. [PubMed]
27. Ellgaard L, Molinari M, Helenius A. Setting the standards: quality control in the secretory pathway. Science. 1999;286:1882–1888. [PubMed]
28. Raykhel I, Alanen H, Salo K, Jurvansuu J, Nguyen VD, Latva-Ranta M, Ruddock L. A molecular specificity code for the three mammalian KDEL receptors. J Cell Biol. 2007;179:1193–1204. [PMC free article] [PubMed]
29. Petrova PS, Raibekas A, Pevsner J, Vigo N, Anafi M, Moore MK, Peaire A, Shridhar V, Smith DI, Kelly J, Durocher Y, Commissiong JW. Discovering novel phenotype-selective neurotrophic factors to treat neurodegenerative diseases. Prog Brain Res. 2004;146:168–183. [PubMed]
30. Tarnavski O, McMullen JR, Schinke M, Nie Q, Kong S, Izumo S. Mouse cardiac surgery: comprehensive techniques for the generation of mouse models of human diseases and their application for genomic studies. Physiol Genomics. 2004;16:349–360. [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...