• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of mbcLink to Publisher's site
Mol Biol Cell. Sep 15, 2009; 20(18): 3996–4009.
PMCID: PMC2743619

Role for RACK1 Orthologue Cpc2 in the Modulation of Stress Response in Fission Yeast

Daniel J. Lew, Monitoring Editor

Abstract

The receptor of activated C kinase (RACK1) is a protein highly conserved among eukaryotes. In mammalian cells, RACK1 functions as an adaptor to favor protein kinase C (PKC)-mediated phosphorylation and subsequent activation of c-Jun NH2-terminal kinase mitogen-activated protein kinase. Cpc2, the RACK1 orthologue in the fission yeast Schizosaccharomyces pombe, is involved in the control of G2/M transition and interacts with Pck2, a PKC-type protein member of the cell integrity Pmk1 mitogen-activated protein kinase (MAPK) pathway. Both RACK1 and Cpc2 are structural components of the 40S ribosomal subunit, and recent data suggest that they might be involved in the control of translation. In this work, we present data supporting that Cpc2 negatively regulates the cell integrity transduction pathway by favoring translation of the tyrosine-phosphatases Pyp1 and Pyp2 that deactivate Pmk1. In addition, Cpc2 positively regulates the synthesis of the stress-responsive transcription factor Atf1 and the cytoplasmic catalase, a detoxificant enzyme induced by treatment with hydrogen peroxide. These results provide for the first time strong evidence that the RACK1-type Cpc2 protein controls from the ribosome the extent of the activation of MAPK cascades, the cellular defense against oxidative stress, and the progression of the cell cycle by regulating positively the translation of specific gene products involved in key biological processes.

INTRODUCTION

Receptor of activated protein C kinase (RACK1) is a 36-kDa protein highly conserved in eukaryotic cells and a member of the family of proteins with WD repeats (McCahill et al., 2002 blue right-pointing triangle). This group includes a large number of proteins involved in the regulation of key biological functions such as signal transduction, cell cycle control, vesicular trafficking, chromatin organization, and programmed cell death (Smith et al., 1999 blue right-pointing triangle). Cryo-electron microscopy and x-ray crystallographic data indicate that RACK1 displays a β-propeller structure, with seven blades corresponding to the WD repeat domains, in a general conformation closely resembling the β-subunit structure of heterotrimeric G proteins (Sengupta et al., 2004 blue right-pointing triangle; Chaudhuri et al., 2008 blue right-pointing triangle; Coyle et al., 2009 blue right-pointing triangle). RACK1 was initially identified by its ability to interact with protein kinase C isoforms, but later studies demonstrated that also binds in vivo other proteins related to signal transduction pathways, leading to the suggestion that it might act as scaffold to recruit elements involved in cell signaling (McCahill et al., 2002 blue right-pointing triangle, Sengupta et al., 2004 blue right-pointing triangle). In particular, mammalian RACK1 seems relevant to the regulation of angiogenesis, tumor growth, neuronal response, and apoptosis (McCahill et al., 2002 blue right-pointing triangle). Recently, a direct relationship has been established between RACK1 and the c-Jun NH2-terminal kinase (JNK) signal transduction pathway because RACK1 favors the protein kinase C (PKC)-mediated Ser129 phosphorylation and subsequent activation of the mitogen-activated protein (MAP) kinase JNK induced by phorbol esters, tumor necrosis factor-α, and UV radiation (López-Bergami et al., 2005 blue right-pointing triangle).

Schizosaccharomyces pombe contains an orthologue of RACK1, named Cpc2, whose amino acid sequence shows ~70% identity with the human version (McLeod et al., 2000 blue right-pointing triangle). The cpc2+ gene was identified in fission yeast through its action on protein kinase Ran1/Pat1, which inhibits sexual development by regulating the transition from mitosis to meiosis (McLeod et al., 2000 blue right-pointing triangle). Mutants lacking Cpc2 show distinct phenotypes such as delayed G2/M transition with increased cell size, defective G1 arrest under nitrogen deprivation, and inability to grow at high temperature (McLeod et al., 2000 blue right-pointing triangle). Another relevant biological function of Cpc2/RACK1 is related to translation. This protein has been shown as a structural component of the 40S ribosomal subunit (Shor and McLeod, 2003 blue right-pointing triangle; Baum et al., 2004 blue right-pointing triangle; Coyle et al., 2009 blue right-pointing triangle). Recent analyses of the Cpc2 orthologue Asc1 in Saccharomyces cerevisiae indicate a location close to the exit tunnel for mRNAs through an interaction that is dependent on WD domain I (Coyle et al., 2009 blue right-pointing triangle). In S. pombe, the absence of Cpc2 decreases the synthesis of some proteins in a selective manner (Shor and McLeod, 2003 blue right-pointing triangle). However, the exact role of RACK1/Cpc2/Asc1 as a regulator in translation remains to be established (Nilsson et al., 2004 blue right-pointing triangle).

Similar to RACK1, Cpc2 associates in vivo with Pck2, one of the two C-type protein kinases present in the fission yeast (Won et al., 2001 blue right-pointing triangle). Also, it seems likely that Cpc2 may somehow regulate Pck2-dependent cell signaling in this yeast because the lethal effect of pck2+ overexpression is attenuated by simultaneous overexpression of cpc2+ (Won et al., 2001 blue right-pointing triangle). In this context, several researchers, including ourselves, have shown that Pck2 is a member of the cell integrity pathway that regulates morphogenesis, cell wall construction, cytokinesis, and ion homeostasis (Ma et al., 2006 blue right-pointing triangle; Barba et al., 2008 blue right-pointing triangle). The key element of this transduction pathway is MAP kinase Pmk1, which is activated during cell separation and in response to many adverse conditions such as hyper- and hypo-osmotic stress, glucose withdrawal, presence of compounds disturbing the cell wall, and oxidative stress induced by hydroperoxides or pro-oxidant stressors (Madrid et al., 2006 blue right-pointing triangle, 2007 blue right-pointing triangle). In addition, S. pombe shows an MAP kinase pathway activatable by stress (SAPK), homologue to the metazoan SAPK, whose central element is MAPK Sty1, which results activated under various stressing conditions (Millar et al., 1995 blue right-pointing triangle; Shiozaki and Russell, 1995 blue right-pointing triangle; Degols et al., 1996 blue right-pointing triangle; Soto et al., 2002 blue right-pointing triangle). Once activated, Sty1 associates in vivo and phosphorylates Atf1, a leucine zipper domain transcription factor orthologue to ATF-2 in higher cells, which regulates gene expression determining the adaptive response of S. pombe to different stresses (Degols et al., 1996 blue right-pointing triangle; Shiozaki and Russell, 1996 blue right-pointing triangle; Wilkinson et al., 1996 blue right-pointing triangle; Chen et al., 2003 blue right-pointing triangle). Among the various phosphatases able to dephosphorylate Sty1 are tyrosine phosphatases Pyp1 and Pyp2, and serine-threonine phosphatases Ptc1 and Ptc2 (Hohmann, 2002 blue right-pointing triangle). We have recently shown that Pyp1, Pyp2, and Ptc1, whose transcriptional activation is dependent on Sty1–Atf1 function, interact also with Pmk1 in vivo and may participate in its dephosphorylation, thus providing a first evidence for the existence of “cross-talk” between the two MAP kinase (MAPK) pathways in S. pombe (Madrid et al., 2007 blue right-pointing triangle).

Extensive experimental evidence supports a high functional homology among the intracellular signaling pathways of the fission yeast and higher eukaryotes. This feature endows S. pombe with advantages as a suitable experimental model to study control mechanisms of general significance carried out by RACK1/Cpc2. In this article, we characterize the involvement of Cpc2 in the regulation of key signaling pathways of the fission yeast.

MATERIALS AND METHODS

Strains, Plasmids, and Growth Conditions

The S. pombe strains (Table 1) were grown with shaking at 28°C in either yeast extract plus supplements (YES) medium or Edinburgh minimal medium 2 (EMM2) (Moreno et al., 1991 blue right-pointing triangle) with 2% of glucose, and supplemented with adenine, leucine, histidine, or uracil (100 mg/l; Sigma Aldrich, St. Louis, MO) depending on their particular requirements. Transformation of yeast strains was performed by the lithium acetate method (Moreno et al., 1991 blue right-pointing triangle). Mutant strains were obtained by transformation or by mating and selecting diploids in EMM2 medium without supplements. Spores were purified by glusulase treatment (Soto et al., 2002 blue right-pointing triangle) and allowed to germinate in EMM2 plus the appropriate requirements. Correct construction of strains was verified by polymerase chain reaction (PCR), and Western blot analyses (see below). Plasmid pREP3X-cpc2 was constructed to obtain strains expressing Cpc2 under the control of the full-strength thiamine repressible promoter. In brief, cpc2+ open reading frame (ORF) was amplified by PCR using genomic S. pombe DNA as template and the oligonucleotides CPC2–5X (TATATCTCGAGATGCCAGAACAACTTGTGCTC, XbaI site is underlined) and CPC2–3X (TATATGGATCCTTACTTGGTAACTTGCCAGAC, BamHI site is underlined). The resulting ~1.4-kbp DNA fragment was digested with XbaI and BamHI and cloned into plasmid pREP3X. In experiments employing pREP3X-cpc2, the transformants were grown in EMM2 with or without thiamine (5 mg/l) for 12–24 h. To visualize the localization of a GFP-Pap1 fusion in cultures treated with either hydrogen peroxide or diethylmaleate (DEM), we used strains EHH14 and AN050 (Table 1), which harbor an integrated copy of the wild-type green fluorescent protein (GFP)-Pap1 chimeric gene under the control of the mid-strength thiamine repressible promoter nmt1 (Madrid et al., 2004 blue right-pointing triangle), both in wild-type and cpc2Δ backgrounds, respectively.

Table 1.
S. pombe strains used in this study

Gene Disruption and Epitope Tagging

The cpc2+ null mutants were obtained by entire deletion of the corresponding coding sequence and its replacement with the KanMX6 cassette by PCR-mediated strategy using plasmid pFA6a-kanMX6 as template (Bahler et al., 1998 blue right-pointing triangle). To construct strains expressing C-terminal 13-myc or GFP-tagged versions of either pyp1+, pyp2+, ptc1+, ptc3+, pmp1+, ctt1+, and cpc2+, we used plasmids pFA6a-13Myc-kanMX6 and pFA6a-GFP-kanMX6, respectively (Bahler et al., 1998 blue right-pointing triangle). Primer sequences used in each case are available upon request. Strains expressing genomic versions of Pmk1 fused to HA6H epitope at its C terminus in different genetic backgrounds were constructed either by transformation with integrative plasmid pIH-pmk1-ura (Madrid et al., 2006 blue right-pointing triangle), or after random spore analysis of appropriate crosses. This procedure was also used to obtain strains expressing C-terminal HA6H-tagged versions of Sty1 or Atf1.

Site-directed Mutagenesis

A 2-kbp DNA fragment with the cpc2+ ORF plus regulatory sequences was amplified by PCR employing the 5′-oligonucleotide CPC2GFP-5 (sequence CCTTATCTAGACCATACTTTCATATACGG; which hybridizes at positions −585 to −567 upstream of the cpc2+ ATG start codon and contains a XbaI site), and the 3′-oligonucleotide CPC2GFP-3 (sequence CCTTAGGATCCCTCTTGGTAACTTGCCAGAC, which hybridizes at the 3′ end of cpc2+ ORF and incorporates a BamHI site upstream of the TAA stop codon). The DNA fragment was then digested with XbaI and BamHI and cloned into integrative plasmid pIL-GFP to generate pIL-Cpc2-GFP, which incorporates a Cpc2 C-terminal fusion with the GFP tag, and contains the S. pombe leu1+ gene as selectable marker. The Cpc2 R36D K38E mutant was created by the overlap extension method with the use of PCR (Higuchi et al., 1988 blue right-pointing triangle). Two separate amplification reactions were performed with plasmid pIL-Cpc2-GFP as template with the use of a first pair of primers, CPC2GFP-5 and DE-3 (ATGATGGACTCGTCATCAGAACCGGAAAG; the nucleotide substitutions are indicated in bold) and a second pair of primers, CPC2GFP-3 and DE-5 (CTTTCCGGTTCTGATGACGAGTCCATCAT; the nucleotide substitutions are indicated in bold). The two pairs of PCR products were purified by agarose gel electrophoresis, mixed, and subjected again to PCR with primers CPC2GFP-5 and CPC2GFP-3. The purified PCR product was purified, digested with XbaI and BamHI, and cloned into integrative plasmid pIL-GFP to generate pIL-Cpc2(DE)-GFP. Plasmids pIL-Cpc2-GFP and pIL-Cpc2(DE)-GFP were digested at the unique NruI site within leu1+, and the linear fragments transformed into cpc2-disrupted strains. Transformants leu1+ were obtained and the correct integration of the Cpc2-GFP fusion plus regulatory sequences was verified by sequencing and Western blot analysis.

Purification and Detection of Activated Pmk1-HA6H and Sty1-HA6H Proteins

To investigate Pmk1 activation under stress, we used log phase cell cultures (A600 of 0.5) growing at 28°C in YES medium that were then subjected to the appropriate treatment. In all cases, 30 ml of culture was harvested by centrifugation at 4°C, the cells washed with cold phosphate-buffered saline buffer, and the yeast pellets immediately frozen in liquid nitrogen for analysis. To analyze Pmk1 dual phosphorylation, total cell homogenates were prepared under native conditions employing chilled acid-washed glass beads and lysis buffer (10% glycerol, 50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.1% Nonidet P40, plus specific protease and phosphatase inhibitor cocktails for fungal and yeast extracts [obtained from Sigma-Aldrich]). The lysates were cleared by centrifugation at 20,000 × g for 20 min. HA6H-tagged Pmk1 was purified by using nickel-nitrilotriacetic acid (Ni2+-NTA)-agarose beads (QIAGEN, Valencia, CA), as reported previously (Soto et al., 2002 blue right-pointing triangle). The purified proteins were resolved in 10% SDS-polyacrylamide gel electrophoresis (PAGE) gels, transferred to Hybond-ECL membranes (GE Healthcare, Chalfont St. Giles, Buckinghamshire, United Kingdom), and incubated with either mouse polyclonal anti-phospho-p42/44 (Cell Signaling Technology, Danvers, MA) or mouse monoclonal anti-hemagglutinin (HA) antibodies (clone 12CA5, loading control; Roche Molecular Biochemicals, Mannheim, Germany). To analyze tyrosine phosphorylation status in both Pmk1 and Sty1, cells were lysed into denaturing lysis buffer (6 M guanidine HCl, 0.1 M sodium phosphate, and 50 mM Tris-HCl, pH 8.0) as described by Shiozaki and Russell (1997) blue right-pointing triangle, and HA6H-Pmk1 and HA6H-Sty1 fusions were purified after incubation with Ni2+-NTA-agarose beads. After processing the purified proteins for Western blot analysis as described above, the membranes were hybridized with either a mouse monoclonal anti-phosphotyrosine (PY99; Santa Cruz Biotechnology) or mouse monoclonal anti-HA (loading control) antibodies. In all cases the immunoreactive bands were revealed with an anti-mouse horseradish peroxidase (HRP)-conjugated secondary antibody (Sigma-Aldrich) and the ECL system (GE Healthcare). Densitometric quantification of Western blot signals was performed using Molecular Analyst software (Bio-Rad Laboratories, Hercules, CA).

Purification and Detection of Atf1-HA6H

Atf1 protein was isolated by affinity precipitation on Ni2+-NTA-agarose beads with cells extracts obtained under denaturing conditions as described above. The purified proteins were resolved in 6% SDS-PAGE gels, transferred to Hybond-ECL membranes, and incubated with a mouse anti-HA antibody (12CA5). In parallel, cell extracts were incubated with polyclonal rabbit anti-Cdc2 antibody (PSTAIR; Millipore, Billerica, MA) as a loading control.

Detection of Myc- and GFP-tagged Fusions

Cell extracts were prepared under native conditions (see above). The cleared lysates were resolved in 8 or 10% SDS-PAGE gels, depending on the relative size of the fusion protein, transferred to filters, and incubated with monoclonal mouse anti-c-myc antibody (clone 9E10; Roche Molecular Biochemicals) or polyclonal rabbit anti-GFP antibody (Cell Signaling Technology). Rabbit anti-Cdc2 antibody was used as loading control. Immunoreactive bands were detected using anti-mouse or anti-rabbit HRP-conjugated secondary antibodies (Sigma-Aldrich) and the SuperSignal system (Pierce Chemical, Rockford, IL).

Assays of Cell Sensitivity for Growth under Different Stresses

In plate assays, wild type and mutant strains of S. pombe were grown in YES liquid medium to an A600 of 0.6. Appropriate dilutions were spotted per duplicate on YES solid media containing 2% (wt/vol) bacto-agar (Difco, Detroit, MI) and supplemented with any of the following compounds: caspofungin (a kind gift from Merck, Darmstadt, Germany), MgCl2 (Sigma-Aldrich), FK506 (cyclosporin; Alexis Biochemicals, San Diego, CA), potassium chloride (Sigma-Aldrich), sorbitol (Sigma-Aldrich), or hydrogen peroxide (Sigma-Aldrich). Plates were incubated at 28°C for 3 d and then photographed. When determining cell survival in liquid cultures, cells were grown in YES liquid medium to an A600 of 0.6 and treated with 5 mM hydrogen peroxide for 30 min. Then, cell samples were collected, appropriately diluted, and spread in triplicate onto YES plates. The viability of the cells was measured by their ability to form colonies after incubation at 28°C for 5 d. The survival fraction was calculated as a percentage relative to control samples that received no treatment.

β-1,3-Glucanase Sensitivity Assay

To analyze resistance to β-1,3-glucanase in different mutants, we followed the method of Loewith et al. (2000) blue right-pointing triangle, with some modifications. Strains were grown in YES medium to an A600 of 0.6; washed with 10 mM Tris-HCl, pH 7.5, 1 mM EDTA, 1 mM β-mercaptoethanol; and incubated with vigorous shaking at 30°C in the same buffer supplemented with 100 μg/ml Zymolyase 20-T (Seikagaku America, Rockville, MD). Samples were taken every 15 min, and cell lysis monitored by measuring A600 decay.

Preparation and Fractionation of Polysomes

Polysomes were obtained as described previously (Shor and McLeod, 2003 blue right-pointing triangle), with some modifications. Strains grown in YES medium (OD600 = 0.5) were treated with 100 μg/ml cycloheximide before centrifugation. The pelleted cells were washed, resuspended in lysis buffer (10 mM Tris-HCl, pH 7.5, 100 mM NaCl, 30 mM MgCl2, and 100 μg/ml cycloheximide), and supplemented with a protease inhibitor cocktail (Sigma-Aldrich) and 0.5 U/μl RNAse inhibitor (RNasin; Ambion, Austin, TX). Total cell homogenates were obtained in a Fast-Prep instrument (Bio 101, Vista, CA) with chilled acid-washed glass beads, and the crude extracts clarified by centrifugation at 20,000 × g for 30 min. To show the polysome profile, 20 OD260 units of clarified extracts were applied to 11.2 ml of 7–47% (wt/vol) sucrose gradients in lysis buffer plus inhibitors and centrifuged in a SW41Ti rotor (Beckman Instruments, Fullerton, CA) at 4°C for 3.5 h at 40,000 rpm. Fractions of 600 μl were collected, and 50-μl aliquots were used to detect either Cpc2 or ribosomal protein L7 (internal control) by SDS-PAGE and Western blot analysis.

Northern Blot Analysis

Yeast cells grown in YES medium to an OD600 of 0.8, subjected to the appropriate stress treatment, and volumes of 50 ml of the cultures were recovered at different times. Total RNA preparations were obtained as described and resolved through 1.5% agarose-formaldehyde gels. Northern (RNA) hybridization analyses were performed as described previously (Soto et al., 2002 blue right-pointing triangle). The probes used were amplified by PCR and included: a 1.7-kbp fragment of the atf1+ gene that was amplified with the 5′-oligonucleotide ATGTCCCCGTCTCCCGT and the 3′-oligonucleotide CTAGTACCCTAAATTGA; a 0.4-kbp fragment of the gpx1+ gene amplified with the 5′-oligonucleotide TTCTACGACTTGGCT and the 3′-oligonucleotide ACACTCTCGATATCG; a 0.9-kbp fragment of the trr1+ gene amplified with the 5′-oligonucleotide GTGACTCACAACAAG and the 3′-oligonucleotide TAATCGGTATCTTCC; a 2.1-kbp fragment of the pyp2+ gene amplified with the 5′-oligonucleotide CCGAGAGCGTTTCTTGGA and the 3′-oligonucleotide AAGGGCTTGGAAGCCTGG; a 1-kbp fragment of the pyp1+ gene amplified with the 5′-oligonucleotide GCTCCTTCGGGTTCATGT and the 3′-oligonucleotide CCTTGGCAAGCGATGTAA; a 1.5-kbp fragment of the ctt1+ gene amplified with the 5′-oligonucleotide CGTCCCTGTTTACAC and the 3′-oligonucleotide GCTTCCTTGGAACAT; a 1.1-kbp fragment of the tpx1+ gene amplified with the 5′-oligonucleotide ATGAGTTTGCAAATCGGT and the 3′-oligonucleotide CATAAGTGCTTGGAAAAGTACT; and a 1-kbp fragment of the leu1+ gene amplified with the 5′-oligonucleotide TCGTCGTCTTACCAGGAG and the 3′-oligonucleotide CAACAGCCTTAGTAATAT. Ready-To-Go DNA labeling beads (GE Healthcare) was used for DNA labeling. To establish quantitative conclusions, the level of mRNAs was determined in a PhosphorImager (GE Healthcare) and compared with the internal control (leu1+ mRNA).

Fluorescence Microscopy

To determine cell size at division and percentage of multiseptated cells, yeast strains were grown in EMM2 medium to an OD600 of 0.5 and stained with calcofluor white, which specifically stains cell wall and septum (Alfa et al., 1993 blue right-pointing triangle). A minimum of 400 septated cells were scored for each mutant. To localize the Pap1-GFP fusion, yeast cultures grown in EMM2 medium to an OD600 of 0.5 and treated with hydrogen peroxide (final concentration, 1–5 mM) or DEM (final concentration, 4 mM). Small aliquots (10 μl) of the yeast cultures were loaded onto poly L-lysine coated slides, and the remaining suspension was withdrawn by aspiration. A DM 4000B fluorescence microscope (Leica, Wetzlar, Germany) with 40× and 100× objectives was used, and images were captured with a cooled DC 300F camera and IM50 software (Leica), and then imported into PhotoShop CS3 (Adobe Systems, Mountain View, CA).

Reproducibility of Results

All experiments were repeated at least three times with similar results. Representative results are shown.

RESULTS

Cross-Talk between Cpc2 and the Pmk1 Cell Integrity Pathway

To study a possible role for Cpc2 in the functional Pmk1 cell integrity pathway, we first explored cell size, morphology, and septation in different mutants. As described previously, exponentially growing cpc2Δ cells are elongated (McLeod et al., 2000 blue right-pointing triangle; Figure 1A) and pck2Δ cells are somewhat short, whereas pmk1Δ cells are slightly longer than control cells and display a mild multiseptate phenotype (Toda et al., 1996 blue right-pointing triangle; Zaitsevskaya-Carter and Cooper, 1997 blue right-pointing triangle; Figure 1A). Significantly, cpc2+ deletion increased cell size at division in both pck2Δ and pmk1Δ cells (Figure 1A) and enhanced the separation defect due to pmk1+ deletion (12% multiseptation in double cpc2Δ pmk1Δ cells vs. 3 and 1% in either single pmk1Δ and cpc2Δ mutants, respectively) (Figure 1B). Sensitivity of the cell wall to digestion with β-glucanase in cpc2Δ pck2Δ or cpc2Δ pmk1Δ double mutants was higher than in pck2Δ or pmk1Δ cells (Figure 1C). Moreover, whereas cpc2Δ cells displayed some sensitivity toward the β-glucan synthase inhibitor caspofungin, this compound strongly affected cell growth in pck2Δ or pmk1Δ cells and particularly, in cpc2Δ pck2Δ and cpc2Δ pmk1Δ mutants (Figure 1D). Together, these results suggest that Cpc2 participates in the regulation of cell size, septation and cell wall integrity in an alternative manner or in addition to the Pmk1 pathway.

Figure 1.
Role of Cpc2 in the regulation of cell size, septation, and cell wall integrity is independent of the Pmk1 MAPK pathway. (A) Cell morphology and size at division (micrometers ± SD) in strains MI200 (control), AN100 (cpc2Δ), GB3 (pck2Δ), ...

In human cells, RACK1 is required for PKC to phosphorylate JNK and increase its degree of activation (López-Bergami et al., 2005 blue right-pointing triangle). Because fission yeast Cpc2 is also able to interact with Pck2 (Won et al., 2001 blue right-pointing triangle), this precedent prompted us to perform a comparative analysis of basal MAPK activity in control versus cpc2Δ, pck2Δ, and pck2Δ cpc2Δ cells expressing a HA6H-tagged version of Pmk1, and by using an anti-p42/44 antibody that detects dual phosphorylation of Pmk1 at threonine and tyrosine residues (Madrid et al., 2006 blue right-pointing triangle). As shown in Figure 2A, a moderate but reproducible increase in basal Pmk1 phosphorylation was evident in cpc2Δ cells compared with control cells. As described previously (Barba et al., 2008 blue right-pointing triangle), pck2+ deletion induced a very strong decrease in basal Pmk1 phosphorylation (Figure 2A). Notably, the basal level of Pmk1 phosphorylation was higher in pck2Δ cpc2Δ cells than in the single pck2Δ mutant (Figure 2A), suggesting that Cpc2 negatively regulates Pmk1 downstream to Pck2.

Figure 2.
Cpc2 regulates chloride homeostasis in fission yeast alternatively to Pmk1. (A) Increased Pmk1 phosphorylation in cpc2Δ cells. Strains MI200 (pmk1-HA6H, control), AN100 (pmk1-HA6H, cpc2Δ), GB3 (pmk1-HA6H, pck2Δ), and AN150 (pmk1-HA6H ...

In S. pombe, calcineurin and Pmk1 play antagonistic roles in chloride homeostasis, and Pmk1 hyperactivation leads to strong sensitivity to this anion (Sugiura et al., 1998 blue right-pointing triangle). Unexpectedly, cells lacking cpc2+ did not show growth inhibition in rich medium supplemented with 0.2 M MgCl2 (Figure 2B), whereas the vic-negative phenotype (vic, viable in the presence of FK506 and chloride; Ma et al., 2006 blue right-pointing triangle) of the cpc2+-deleted mutant was rescued by additional deletion of pck2+ or pmk1+genes (Figure 2B). These results point to Cpc2 as negative regulator of chloride homeostasis in a way that is independent of Pmk1 and/or calcineurin. In agreement with this prediction, a cpc2Δ pmp1Δ double mutant strain, which shows a higher Pmk1 activity than its parental single mutant counterparts (Figure 2C), displayed some growth in medium with higher concentration of MgCl2 than the pmp1Δ mutant (Figure 2D). Moreover, disruption of cpc2+ in a ppb1Δ strain (devoid of the catalytic subunit of calcineurin phosphatase; Yoshida et al., 1994 blue right-pointing triangle) clearly increased tolerance against chloride anion compared with the single ppb1Δ mutant strain (Figure 2D). Hence, Cpc2 plays a role as a negative regulator for chloride homeostasis alternatively to Pmk1 in fission yeast.

Cpc2 Is Important for Both Pmk1 and Sty1 Tyrosine Dephosphorylation in Growing Cells and under Stress

The level of Pmk1 phosphorylation increases in a quick and transient manner when S. pombe is subjected to a salt-induced osmostress with KCl (Madrid et al., 2006 blue right-pointing triangle). As shown in Figure 3A (top), the stress-induced Pmk1 activation in a strain deleted in cpc2+ was maintained for longer times than in control cells and, as described above, exhibited a moderate increase in basal Pmk1 phosphorylation (Figure 3A, top). On the contrary, ectopic expression of the cpc2+ gene in cpc2Δ cells caused a clear reduction in the levels Pmk1 phosphorylation both in growing cells and in response to hyperosmotic stress (Figure 3B). The positive role of Cpc2 in Pmk1 deactivation was also evident under other stressful situations such as oxidative stress with hydrogen peroxide (Figure 3C) or cell wall synthesis inhibition with caspofungin. Importantly, the basal and the stress induced Pmk1 phosphorylation levels were also higher in cpc2Δ than in control cells when using a specific anti-phosphotyrosine antibody (pY99) (Figure 3A, bottom). Moreover, deletion of cpc2+ also resulted in increased basal level of Sty1 tyrosine phosphorylation and delayed deactivation kinetics under osmostress (Figure 3D). Together, these results suggest that Cpc2 acts as a negative regulator of the tyrosine phosphorylation status of both Pmk1 and Sty1 MAPKs.

Figure 3.
Cpc2 negatively regulates phosphorylation of Pmk1 and Sty1 MAPKs in growing and stressed cells. (A) Top, Strains MI200 (pmk1-HA6H, control), and AN100 (pmk1-HA6H, cpc2Δ), were grown in YES medium to mid-log phase and treated with 0.6 M KCl. At ...

Cpc2 Positively Regulates the Protein Levels of Pyp1 and Pyp2 Tyrosine Phosphatases

Recently, we described that MAPK Sty1 is essential for proper deactivation of Pmk1 under hypertonic stress in a process regulated by transcription factor Atf1 through the action of tyrosine phosphatases Pyp1 and Pyp2, and serine/threonine phosphatase Ptc1 (Madrid et al., 2007 blue right-pointing triangle). Ptc3, another serine/threonine phosphatase, has been also involved in this control (Takada et al., 2007 blue right-pointing triangle), whereas Pmp1, a dual-specificity phosphatase, seems involved in Pmk1 inactivation only in growing cells and during cell separation (Madrid et al., 2007 blue right-pointing triangle). The results obtained so far strongly suggested that the observed increase in both the basal and the osmostress-induced phosphorylation of Pmk1 and Sty1 in cpc2Δ cells might be due to a deficit in the synthesis of any of the above-mentioned phosphatases. To test this interpretation, we undertook two experimental approaches on the bases of earlier findings. We showed previously that osmostress-induced Pmk1 activation/deactivation in a strain expressing a hyperactive version of Wis1 MAPKK (wis1DD), which prompts the constitutive activation of Sty1 (Shiozaki et al., 1998 blue right-pointing triangle), is lower than in control cells due to increased synthesis of Pyp1, Pyp2, and Ptc1 (Madrid et al., 2007 blue right-pointing triangle). Therefore, if somehow Cpc2 would positively regulate the levels of these phosphatases, then deletion of the cpc2+ gene in a wis1DD background should rescue the defective Pmk1 activation observed in stressed cultures of the single wis1DD mutant. Results shown in Figure 4A indicate this first prediction is correct, because Pmk1 activation by salt stress is much higher in cpc2Δ wis1DD cells than in wis1DD cells, although not as much as in cpc2Δ atf1Δ cells. Second, we analyzed Pyp1–13myc, Pyp2–13myc, Ptc1–13myc, Ptc3–13myc, and Pmp1-GFP protein levels in exponentially growing control and cpc2Δ cultures and after being subjected to a hypertonic stress. As shown in Figure 4B, Pyp1 protein levels during growth were lower in the cpc2Δ mutant than in the control strain, whereas Pyp2, Pmp1, Ptc1, and Ptc3 levels were unaffected by the absence of Cpc2. However, upon osmostress, both Pyp1 and Pyp2, but not Pmp1, Ptc1, or Ptc3, were down-regulated in cpc2Δ mutant compared with control cells (Figure 4B). Moreover, the positive role of Cpc2 in modulating Pyp2 protein levels was also proved in S. pombe cells subjected to other stresses like oxidative treatment with hydrogen peroxide or heat shock (Figure 4C). Importantly, Pmk1 basal phosphorylation in pyp1Δ cpc2Δ cells was very similar to that of the single pyp1Δ mutant, but higher than in cpc2Δ cells (Figure 4D). As a whole, these results strongly suggest that in fission yeast Cpc2 acts as a positive regulator of Pyp1 and Pyp2 protein levels. In this scenario, the hyperactivation of Pmk1 and Sty1 observed in growing cpc2Δ cells is a consequence of the defect in the protein levels of Pyp1, whereas defective Pyp1 and Pyp2 levels account for the slow MAPK deactivation observed under stress.

Figure 4.
Cpc2 acts as a positive regulator of Pyp1 and Pyp2 tyrosine phosphatases protein levels. (A) Deletion of the cpc2+ gene in a wis1DD background rescues the defective Pmk1 activation in single wis1DD mutant. Strains MI200 (pmk1-HA6H, control), MI709 (pmk1-HA6H ...

Atf1 Level Is Positively Regulated by Cpc2

In fission yeast the stress-induced expression of pyp1+ and pyp2+ genes is regulated by Sty1 through Atf1 forming a negative-feedback loop (Degols et al., 1996 blue right-pointing triangle; Shiozaki and Russell, 1996 blue right-pointing triangle; Wilkinson et al., 1996 blue right-pointing triangle). Hence, we considered the possibility that the decreased Pyp1 and Pyp2 synthesis in stressed-cpc2Δ cells might result from a defect in the synthesis of Atf1 itself. In this context, we determined Atf1 protein levels in control and cpc2Δ cells expressing a genomic copy of the atf1+ gene tagged with two copies of the HA epitope and six histidine residues, and after being subjected to a saline stress with KCl. As shown in Figure 5A (top), cpc2+ deletion prompted a clear decrease in Atf1 levels as compared with control cells in both growing and osmostressed cells. This defect was also evident in cultures under oxidative stress with hydrogen peroxide (Figure 5A, bottom). In contrast, because Atf1 positively regulates its own expression at a transcriptional level (Wilkinson et al., 1996 blue right-pointing triangle), the defective Atf1 levels observed in cpc2Δ cells might result from a deficit in the expression of atf1+ mRNA. To further investigate this approach we estimated atf1+mRNA levels in control versus cpc2Δ cells under saline stress. As Figure 5B shows, atf1+ mRNA levels were unaffected by the absence of Cpc2 in both cases. Remarkably, although Atf1 levels are lower in cpc2Δ cells, the salt induced expression of both pyp2+ and pyp1+ mRNAs was similar to control cells (Figure 5B).

Figure 5.
The protein level of Atf1 is positively regulated by Cpc2. (A) Strains JM1821 (atf1-HA6H, control) and AN300 (atf1-HA6H, cpc2Δ) were grown in YES medium to mid-log phase and treated with either 0.6 M KCl (top) or 1 mM H2O2 (bottom). Aliquots were ...

The decreased Atf1 protein levels in cpc2Δ cells might result from a decreased stability. To address this point we determined the half-life of Atf1 in control versus cpc2Δ mutant strains growing in rich medium after the addition of cycloheximide, which blocks translation. As shown in Figure 5C, the half-life of Atf1 was very similar in control and cpc2Δ cells (~2 h). These results indicate that Cpc2 likely exerts a positive regulation on Atf1, Pyp1, and Pyp2 expression at a translational level by inducing the translation of their correspondent mRNAs.

In fission yeast, phosphorylation of the initiation factor EIF2-α at Ser-52 (Ser-51 in other eukaryotic cells) is critical for the inhibition of general protein synthesis by down-regulating the initiation of translation in response to multiple stresses (Zhan et al., 2002 blue right-pointing triangle). To investigate a possible cross-talk between Cpc2 and EIF2-α phosphorylation for the control of Atf1 translation under stress conditions, we disrupted the cpc2+ gene in a strain bearing a nonphosphorylatable alanine instead of Ser-52 in EIF2-α (EIF2-αS52A; Tvegård et al., 2007 blue right-pointing triangle). As can be seen in Figure 5D, the absence of phosphorylation at Ser52 in EIF2-α did not noticeably affect Atf1 translation in response to either osmotic or oxidative stress, which remained similar to that of control cells. Moreover, both the basal and stress-induced synthesis of Atf1 was similarly compromised in cpc2Δ and cpc2Δ EIF2-αS52A cells (Figure 5D). Therefore, these data support a role for Cpc2 as positive regulator of Atf1 translation which is independent on EIF2-α function.

Cellular Response against Hydrogen Peroxide Stress Is Partially Compromised in cpc2Δ Cells

S. pombe strains lacking Sty1 or Atf1 are strongly sensitive to various stresses (Millar et al., 1995 blue right-pointing triangle; Shiozaki and Russell, 1995 blue right-pointing triangle; Shiozaki and Russell, 1996 blue right-pointing triangle; Wilkinson et al., 1996 blue right-pointing triangle). We examined the growth of control, sty1Δ, atf1Δ, and cpc2Δ strains on solid media supplemented with either KCl (saline osmostress), sorbitol (nonsaline osmostress), or hydrogen peroxide (oxidative stress), to ascertain whether defective synthesis of Atf1 in cpc2Δ mutant affected cell survival under stress. Contrary to sty1Δ or atf1Δ mutants, cpc2Δ cells did not show enhanced growth inhibition by KCl or sorbitol, although a mild growth defect was observed in the presence of 1, 5, 2 mM hydrogen peroxide that was less severe than in atf1Δ cells (Figure 6A). A similar result was observed when liquid cultures treated with 5 mM hydrogen peroxide were used (Figure 6B).

Figure 6.
Cellular defense against hydrogen peroxide is defective in the absence of Cpc2. (A) Cell viability assays in solid medium were performed for strains MI200 (control), AN100 (cpc2Δ), TK107 (sty1Δ), and MI103 (atf1Δ). After growth ...

Transcription factor Pap1 is required for cell survival of fission yeast under oxidative stress (Vivancos et al., 2006 blue right-pointing triangle), and its activity is regulated at the level of cellular localization. In growing cells Pap1 resides mainly in the cytoplasm but, in response to hydrogen peroxide, undergoes a reversible oxidation of critical cysteine residues and accumulates into the nucleus to favor the increased transcription of essential genes for defense against oxidative stress (Vivancos et al., 2006 blue right-pointing triangle). Under moderate to high concentrations of hydrogen peroxide (naturally occurring, for example, in response to glucose arrest) nuclear accumulation of Pap1 is delayed until the expression of Atf1-dependent genes promotes its conversion to the active oxidized conformation that translocates into the nucleus and enhances Pap1-dependent gene expression (Madrid et al., 2004 blue right-pointing triangle; Vivancos et al., 2006 blue right-pointing triangle). Consequently, we analyzed the cellular location of Pap1 in strains EHH14 (control) and AN050 (cpc2Δ) after being treated with 1 mM hydrogen peroxide. These strains express a genomic copy of an N-terminal GFP-tagged version of Pap1 under the control of a mid-strength thiamine repressible promoter (Vivancos et al., 2004 blue right-pointing triangle). As described previously (Vivancos et al., 2004 blue right-pointing triangle), nuclear accumulation of activated Pap1 was maximal after 40–50 min of treatment and slowly decreased thereafter (Figure 6C). However, cpc2+ disruption provoked a clear delay in nuclear translocation of Pap1 (~30 min as average of three independent experiments; Figure 6C), and the same effect was also observed when using higher doses of the oxidant (5 mM; Figure 6D). This defect was not due to a difference in protein expression, because Pap1 levels were similar in control and in cpc2Δ cells. Moreover, the kinetics of Pap1 nuclear accumulation was identical in both types of cells after treatment with pro-oxidant DEM, which induces a nonreversible Pap1 structural modification unrelated to that induced by hydrogen peroxide (Castillo et al., 2002 blue right-pointing triangle; Figure 6D). Hence, the timing for nuclear accumulation of Pap1 results specifically delayed in cpc2Δ cells by oxidative stress with hydrogen peroxide. To further investigate this effect, we analyzed by Northern blot experiments the comparative expression of several genes which are induced in a Sty1-Atf1 and/or Pap1-dependent manner in response to hydrogen peroxide in control and in cpc2Δ cells. As shown in Figure 7, the transcriptional induction of Atf1-dependent genes like atf1+ itself, pyp2+, or gpx1+ (encoding H2O2 scavenger glutathione peroxidase; Yamada et al., 1999 blue right-pointing triangle) was not significantly affected by cpc2+ deletion in exponentially growing cultures treated with 1 mM hydrogen peroxide, indicating that the moderate levels of Atf1 present in cpc2Δ cells support a correct transcriptional response. Under such conditions, a very slight decrease was observed in cpc2Δ cells compared with control cells in the transcriptional activation of genes like srx1+ (sulfiredoxin; Quinn et al., 2002 blue right-pointing triangle) and ctt1+ (cytoplasmic catalase; Degols and Russell, 1997 blue right-pointing triangle), whose expression is dependent on the activity of both Atf1 and Pap1 transcription factors (Quinn et al., 2002 blue right-pointing triangle) (Figure 7A). In contrast, the induction kinetics of Pap1-dependent genes, like tpx1+ (encoding thioredoxin peroxidase, Vivancos et al., 2006 blue right-pointing triangle) and, most notably trr1+ (thioredoxin reductase; Benko et al., 1998 blue right-pointing triangle), was significantly retarded in a cpc2Δ background (Figure 7A), which is congruent with the delay in nuclear translocation of Pap1 (Figure 6C). However, such delay in H2O2-treated cpc2Δ cells remained unexplained on the bases of a transcriptional defect in the induced expression of Atf1-dependent genes. Thus, we analyzed the cellular levels of cytoplasmic catalase (Ctt1), which is involved in the detoxifying activity against oxidative stress in eukaryotic cells, in control and cpc2Δ cultures treated with 1 mM H2O2. As shown in Figure 7B, the increased Ctt1 synthesis observed in H2O2-treated control cells was absent in the cpc2Δ mutant, indicating a role for Cpc2 in the modulation of the intracellular level of cytoplasmic catalase under these conditions. These results suggest that Cpc2 is important in S. pombe to positively regulate the cellular defense against high doses of hydrogen peroxide at a translational level by favoring the synthesis of enzymes such as Ctt1, whose detoxifying activity is essential to allow Pap1-dependent gene expression.

Figure 7.
Cpc2 modulates S. pombe response to oxidative stress at both transcriptional and translational levels. (A) Induced expression of Pap1-dependent genes in response to hydrogen peroxide is delayed in cpc2Δ cells. Strains MI200 (control) and AN100 ...

Localization of Cpc2 at the Ribosome Is Essential to Regulate Pyp1, Pyp2, and Atf1 Protein Levels

A work by Coyle et al. (2009) blue right-pointing triangle has recently demonstrated that two evolutionary conserved charged amino acids on one side of the β-propeller structure of Asc1, the S. cerevisiae RACK1 orthologue, Arg38 and Lys40 (Arg36 and Lys38 in fission yeast), are responsible for RACK1 association with the 40S subunit of the ribosome in vivo. To analyze the biological significance of the ribosome localization of Cpc2 in fission yeast we constructed strains expressing either wild type or R36D K38E variant of Cpc2 fused to the green fluorescent protein at its C terminus, in a cpc2Δ background (see Materials and Methods). As shown in Figure 8A, both Cpc2-GFP and Cpc2(DE)-GFP fusions localized at the cell cytoplasm, similarly to a genomic Cpc2-GFP version expressed from is natural locus, and were expressed at nearly the same level (Figure 8B). However, the cytoplasmic distribution of Cpc2(DE)-GFP was more diffuse, and some punctate spots were visible throughout the cells (Figure 8A). Regardless, analysis of the distribution of both Cpc2-GFP and Cpc2(DE)-GFP by sucrose gradient fractionation of polyribosomes isolated from growing cells indicated that, contrary to wild-type cells, R36D K38E mutation in Cpc2 disrupted almost completely its ability to associate with ribosomes in vivo, with >95% of free, unbound protein (Figure 8C). Importantly, an increase in basal Pmk1 phosphorylation was evident in cpc2Δ cells expressing Cpc2(DE)-GFP compared with those expressing Cpc2-GFP (Figure 9A). These results suggest that Cpc2 localization at the ribosome is critical to negative regulate of Pmk1 activity in growing cells. Indeed, similar to cpc2Δ cells, a strain expressing Cpc2(DE)-GFP fusion was defective in Pmk1 deactivation under stress (Figure 9A), due to a decrease in the protein levels of both Pyp1 and Pyp2 tyrosine phosphatases (Figure 9B). Atf1 protein levels in both growing cells and in cultures subjected to either osmotic saline or oxidative stresses were also down-regulated in the Cpc2(DE) mutant (Figure 9C). As a whole, these results confirm that in fission yeast ribosome binding of Cpc2 is essential to positively regulate the translation efficiency of Pyp1, Pyp2, and Atf1. Finally, we also noticed that cpc2Δ cells expressing wild-type Cpc2-GFP, but not Cpc2(DE)-GFP, recovered their normal cell size at division (Figure 9D), indicating that Cpc2 binding to the ribosome is important to control the G2/M transition of the cell cycle in fission yeast.

Figure 8.
Construction of a S. pombe strain expressing a Cpc2 version unable to bind the ribosome in vivo. (A) Subcellular localization of Cpc2 variants. Mid-log phase cells of strains AN070 (cpc2-GFP, control), AN071 (leu1:cpc2-GFP, cpc2Δ), and AN072 ( ...
Figure 9.
Ribosome binding of Cpc2 is essential to positively regulate the translation efficiency of Pyp1, Pyp2, and Atf1 in fission yeast. (A) Increased Pmk1 phosphorylation in cells expressing a Cpc2(DE) version. Strains AN071 (pmk1-HA6H leu1:cpc2-GFP, cpc2Δ) ...

DISCUSSION

In eukaryotic cells, RACK1 is a scaffold protein involved in a myriad of signal transduction pathways. However, the role of the fission yeast orthologue Cpc2 as a modulator of the signal transduction machinery had not been investigated in detail earlier. Similar to RACK1, Cpc2 was reported to interact in vivo with the PKC orthologue Pck2 (Won et al., 2001 blue right-pointing triangle). Also, others and ourselves showed that Pck2 is a member of the Pmk1 cell integrity MAPK pathway in fission yeast (Ma et al., 2006 blue right-pointing triangle; Barba et al., 2008 blue right-pointing triangle), suggesting that Cpc2 might be an integral part of this MAPK cascade. However, several lines of evidence obtained in this work indicate that, contrary to our initial prediction, Cpc2 is not a member of the Pmk1 signaling pathway. First, the cell separation and cell wall integrity defects described previously as associated to deletion of members of the cell integrity MAPK module (Toda et al., 1996 blue right-pointing triangle; Zaitsevskaya-Carter and Cooper, 1997 blue right-pointing triangle) are exacerbated in a cpc2Δ background. Second, the fact that cell size at division is higher in both cpc2Δ pck2Δ and cpc2Δ pmk1Δ double mutants than in pck2Δ or pmk1Δ single mutants supports that the role of Cpc2 in the control of G2/M transition in the fission yeast is independent on Pmk1 activity. Third, and most important, whereas RACK1 functions in mammalian cells as an adaptor for MAPK JNK phosphorylation at Ser129 by PKC, which is required for JNK activation in response to several agents (López-Bergami et al., 2005 blue right-pointing triangle), in cpc2Δ cells of fission yeast both the basal and the stress induced activation of MAPK Sty1 and MAPK Pmk1 are increased. Furthermore, in striking contrast with the mammalian model, cpc2+ deletion triggers Pmk1 basal activity even in a pck2Δ background, suggesting that Cpc2 negatively regulates MAPK activity in fission yeast by a mechanism distinct from a role as Pck2 adaptor.

Which is the mechanism used by Cpc2 to regulate MAPK activity and to modulate cellular response against stress? In both human, budding and fission yeast cells RACK1/Asc1/Cpc2 associates with the 40S ribosomal subunit (Shor and McLeod, 2003 blue right-pointing triangle; Baum et al., 2004 blue right-pointing triangle; Coyle et al., 2009 blue right-pointing triangle). Also, the study by Shor and McLeod (2003) blue right-pointing triangle demonstrated that the loss of cpc2+ in S. pombe elicits a decreased steady state level of various proteins, some of which (like ribosomal protein L25) are probably regulated at the level of translation. The results presented in our work strongly support the interpretation that Cpc2 modulates the translation of a specific subset of mRNAs (Shor and McLeod, 2003 blue right-pointing triangle). Probably, Cpc2 exerts its function as a positive translational regulator of mRNAs encoding Pyp1 and Pyp2 tyrosine phosphatases, which deactivate both Sty1 and Pmk1 (Madrid et al., 2007 blue right-pointing triangle). Consistent with this hypothesis, Pyp1 and Pyp2 protein levels diminished in cpc2Δ cells growing exponentially or subjected to different stresses, although the expression of the corresponding mRNAs was not significantly affected by cpc2+ deletion. Importantly, this translational control was specific for pyp1+ and pyp2+ mRNAs, because the protein levels of other phosphatases known to be involved in Sty1 and/or Pmk1 deactivation, such as Pmp1, Ptc1, or Ptc3, remained unchanged in the absence of Cpc2.

Alternatively, Cpc2 also regulates positively the translation of mRNA encoding the transcription factor Atf1. Atf1 is phosphorylated and stabilized by Sty1 MAPK to play a critical role in the response of S. pombe against a variety of stress conditions (Chen et al., 2003 blue right-pointing triangle). Our results support, however, that the low levels of Atf1 protein observed in cpc2Δ cells do not compromise its function as a transcriptional activator in response to stress, because the induced expression of Atf1-dependent genes (including pyp1+ and pyp2+) in response to osmotic or oxidative stress was not significantly affected by cpc2+ deletion. These data agree with previous work showing that there is still a robust transcriptional activation of Atf1-dependent genes in response to stress in a mutant strain expressing low levels of an unstable version of the transcription factor devoid of Sty1-phosphorylation sites (Lawrence et al., 2007 blue right-pointing triangle). In this context, we have found that although the transcriptional induction of Atf1-dependent genes in cpc2Δ cells is not affected, Cpc2 regulates the cellular defense against hydrogen peroxide at a translational level by favoring the synthesis of detoxifying enzymes such as cytoplasmic catalase Ctt1. Probably, the synthesis of other detoxifying proteins may be also compromised in cpc2Δ cells.

The recent demonstration of the existence of conserved charged amino acids that are responsible for the in vivo Asc1/RACK1 association with the ribosome (Coyle et al., 2009 blue right-pointing triangle) allowed our demonstration that the function of Cpc2 as a modulator of both the MAPK activity and the cellular response against oxidative stress relies on its ability for binding to the 40S subunit of the S. pombe ribosome. In addition, the putative role of Cpc2 in regulating the G2/M transition of the cell cycle seems to depend also on its function as a ribosomal protein. These results raise several important questions. One refers to the mechanism whereby Cpc2 regulates the recruitment and translation of specific mRNAs. Considering that Cpc2 lacks evident RNA binding motifs and taking into account the versatility of RACK1 as a platform to bind different proteins, it seems likely that one or several Cpc2 binding partners might be involved in the recruitment of specific mRNAs to the ribosome, as depicted in Figure 10. In S. cerevisiae, it has been described that Scp160, an mRNA binding protein orthologue to vertebrate vigilin, associates with ribosomes in an Asc1/RACK1-dependent manner, thus supporting that the Scp160-Asc1 complex mediates the translation activity of ribosomes programmed with specific mRNAs (Baum et al., 2004 blue right-pointing triangle). The Scp160 orthologue in fission yeast is Vgl1, a putative mRNA binding protein with 12 KH domains. However, Vgl1-null cells do not display any of the phenotypes associated to Cpc2 deletion, such as increased cell length at G2/M transition or Pmk1 hyperactivation (unpublished data). Hence, it seems plausible that other unknown RNA binding protein(s) might be involved in this process. Another candidate to perform such role is RNA binding protein Msa2/Nrd1, which interacts in vivo with Cpc2 and whose deletion causes initiation of sexual development without nutrient starvation (Tsukahara et al., 1998 blue right-pointing triangle; Jeong et al., 2004 blue right-pointing triangle). Also, Msa2/Nrd1 binds and stabilizes Cdc4 mRNA, encoding myosin II light chain, and Nrd1 phosphorylation by Pmk1 negatively regulates its binding activity to Cdc4 mRNA (Satoh et al., 2009 blue right-pointing triangle). However, the opposite roles described for Cpc2 and Msa2/Nrd1 in sexual differentiation (Jeong et al., 2004 blue right-pointing triangle), together with the absence in Msa2-null cells of the main phenotypes associated to Cpc2 deletion, makes unlikely that this RNA-binding protein will be the Cpc2 binding partner involved in mRNA recruitment to the ribosome. A similar conclusion can be drawn in the case of Rnc1, another RNA-binding protein which is phosphorylated by Pmk1 and binds and stabilizes Pmp1 dual-specificity MAPK phosphatase involved in Pmk1 dephosphorylation (Sugiura et al., 2003 blue right-pointing triangle). Our results clearly show that Pmk1-Rnc1 control of Pmp1 is independent on Cpc2, because the protein levels of Pmp1 remained unchanged in the absence of Cpc2. Regardless, the identification of the complete subset of mRNAs whose translation is positively regulated by Cpc2 (besides those described here), may deserve follow-up investigation. Our results provide for the first time strong evidence that a RACK1-type protein functions from the ribosome to control the magnitude of the activation of MAPK cascades, the cellular defense against oxidative stress, and the progression of the cell cycle, by regulating positively the translation of specific genes whose products are involved in key biological processes. On the basis of these data, we anticipate that some of the previously described biological functions of RACK1 in mammalian cells might be linked to its function as a putative translational regulator.

Figure 10.
Proposed functional role for RACK orthologue Cpc2 in fission yeast. The Cpc2 protein regulates important biological processes at the ribosome level by favoring the translation of genes whose products may inactivate MAPK cascades (Pyp1 and Pyp2 MAPK phosphatases), ...

ACKNOWLEDGMENTS

We thank P. Pérez (Consejo Superior de Investigaciones Cientificas/University of Salamanca, Spain) for helpful discussions and comments on the manuscript; E. Boye (Institute for Cancer Research, Norway), T. Kato (ERATO, Japan), J. B. Millar (University of Warwick, United Kingdom), P. Pérez, M. A. Rodriguez-Gabriel (Universidad Autónoma, Madrid, Spain), and T. Toda (London Research Institute, United Kingdom) for kind supply of yeast strains; and F. Garro for technical assistance. Thanks to Javier Campoy (University of Murcia) for help and advice with polysome fractionation. A. N. is a predoctoral fellow from Fundación Séneca (Región de Murcia), Spain. A. F. is a postdoctoral fellow from the University of Murcia. This work was supported by grants BFU2008-01653 from Ministerio de Ciencia e Innovación and 08725/PI/08 from Fundación Séneca (Región de Murcia), Spain.

Abbreviations used:

EMM2
Edinburgh minimal medium 2
GFP
green fluorescent protein
HA6H
epitope comprising hemagglutinin antigen plus six histidine residues
HA
hemagglutinin
MAPK
mitogen-activated protein kinase
PKC
protein kinase C
SAPK
stress-activated protein kinase
YES
yeast extract plus supplements.

Footnotes

This article was published online ahead of print in MBC in Press (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E09-05-0388) on July 22, 2009.

REFERENCES

  • Alfa C., Fantes P., Hyams J., Mcleod M., Warbrick E. Experiments with Fission Yeast. A Laboratory Course Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1993.
  • Bahler J., Wu J. Q., Longtine M. S., Shah N. G., McKenzie A., 3rd, Steever A. B., Wach A., Philippsen P., Pringle J. R. Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe. Yeast. 1998;14:943–951. [PubMed]
  • Barba G., Soto T., Madrid M., Núñez A., Vicente J., Gacto M., Cansado J. Activation of the cell integrity pathway is channelled through diverse signalling elements in fission yeast. Cell. Signal. 2008;20:748–757. [PubMed]
  • Baum S., Bittins M., Frey S., Seedorf M. Asc1p, a WD40-domain containing adaptor protein, is required for the interaction of the RNA-binding protein Scp160p with polysomes. Biochem. J. 2004;380:823–830. [PMC free article] [PubMed]
  • Benko Z., Sipiczki M., Carr A. M. Cloning of caf1+, caf2+ and caf4+ from Schizosaccharomyces pombe: their involvement in multidrug resistance, UV and pH sensitivity. Mol. Gen. Genet. 1998;260:434–443. [PubMed]
  • Castillo E. A., Ayté J., Chiva C., Moldón A., Carrascal M., Abián J., Jones N., Hidalgo E. Diethylmaleate activates the transcription factor Pap1 by covalent modification of critical cysteine residues. Mol. Microbiol. 2002;45:243–254. [PubMed]
  • Chaudhuri I., Soding J., Lupas A. N. Evolution of the beta-propeller fold. Proteins. 2008;71:795–803. [PubMed]
  • Chen D., Toone W. M., Mata J., Lyne R., Burns G., Kivinen K., Brazma A., Jones N., Bähler J. Global transcriptional responses of fission yeast to environmental stress. Mol. Biol. Cell. 2003;14:214–229. [PMC free article] [PubMed]
  • Coyle S. M., Gilbert W. V., Doudna J. A. Direct link between RACK1 function and localization at the ribosome in vivo. Mol. Cell. Biol. 2009;29:1626–1634. [PMC free article] [PubMed]
  • Degols G., Shiozaki K., Russell P. Activation and regulation of the Spc1 stress-activated protein kinase in Schizosaccharomyces pombe. Mol. Cell. Biol. 1996;16:2870–2877. [PMC free article] [PubMed]
  • Degols G., Russell P. Discrete roles of the Spc1 kinase and the Atf1 transcription factor in the UV response of Schizosaccharomyces pombe. Mol. Cell. Biol. 1997;17:3356–3363. [PMC free article] [PubMed]
  • Higuchi R., Krummel B., Saiki R. K. A general method of in vitro preparation and specific mutagenesis of DNA fragments: study of protein and DNA interactions. Nucleic Acids Res. 1988;16:7351–7367. [PMC free article] [PubMed]
  • Hohmann S. Osmotic stress signaling and osmoadaptation in yeasts. Microbiol. Mol. Biol. Rev. 2002;66:300–372. [PMC free article] [PubMed]
  • Jeong H. T., Oowatari Y., Abe M., Tanaka K., Matsuda H., Kawamukai M. Interaction between a negative regulator (Msa2/Nrd1) and a positive regulator (Cpc2) of sexual differentiation in Schizosaccharomyces pombe. Biosci. Biotechnol. Biochem. 2004;68:1621–1626. [PubMed]
  • Lawrence C. L., Maekawa H., Worthington J. L., Reiter W., Wilkinson C. R., Jones N. Regulation of Schizosaccharomyces pombe Atf1 protein levels by Sty1-mediated phosphorylation and heterodimerization with Pcr1. J. Biol. Chem. 2007;282:5160–5170. [PubMed]
  • Loewith R., Hubberstey A., Young D. Skh1, the MEK component of the mkh1 signaling pathway in Schizosaccharomyces pombe. J. Cell Sci. 2000;113:153–160. [PubMed]
  • López-Bergami P., Habelhah H., Bhoumik A., Zhang W., Wang L. H., Ronai Z. RACK1 mediates activation of JNK by protein kinase C. Mol Cell. 2005;19:309–320. [PMC free article] [PubMed]
  • Ma Y., Kuno T., Kita A., Asayama Y., Sugiura R. Rho2 is a target of the farnesyltransferase Cpp1 and acts upstream of Pmk1 mitogen-activated protein kinase signaling in fission yeast. Mol. Biol. Cell. 2006;17:5028–5037. [PMC free article] [PubMed]
  • Madrid M., Núñez A., Soto T., Vicente-Soler J., Gacto M., Cansado J. Stress-activated protein kinase-mediated down-regulation of the cell integrity pathway mitogen-activated protein kinase Pmk1 by protein phosphatases. Mol. Biol. Cell. 2007;18:4405–4419. [PMC free article] [PubMed]
  • Madrid M., Soto T., Franco A., Paredes V., Vicente J., Hidalgo E., Gacto M., Cansado J. A cooperative role for Atf1 and Pap1 in the detoxification of the oxidative stress induced by glucose deprivation in Schizosaccharomyces pombe. J. Biol. Chem. 2004;279:41594–41602. [PubMed]
  • Madrid M., Soto T., Khong H. K., Franco A., Vicente J., Pérez P., Gacto M., Cansado J. Stress-induced response, localization, and regulation of the Pmk1 cell integrity pathway in Schizosaccharomyces pombe. J. Biol. Chem. 2006;281:2033–2043. [PubMed]
  • McCahill A., Warwicker J., Bolger G. B., Houslay M. D., Yarwood S. J. The RACK1 scaffold protein: a dynamic cog in cell response mechanisms. Mol. Pharmacol. 2002;62:1261–1273. [PubMed]
  • McLeod M., Shor B., Caporaso A., Wang W., Chen H., Hu L. Cpc2, a fission yeast homologue of mammalian RACK1 protein, interacts with Ran1 (Pat1) kinase to regulate cell cycle progression and meiotic development. Mol. Cell. Biol. 2000;20:4016–4027. [PMC free article] [PubMed]
  • Millar J. B., Buck V., Wilkinson M. G. Pyp1 and Pyp2 PTPases dephosphorylate an osmosensing MAP kinase controlling cell size at division in fission yeast. Genes Dev. 1995;9:2117–2130. [PubMed]
  • Moreno S., Klar A., Nurse P. Methods in Enzymology. Vol. 283. New York: Academic Press; 1991. Molecular genetic analysis of fission yeast Schizosaccharomyces pombe; pp. 506–520.
  • Nilsson J., Sengupta J., Frank J., Nissen P. Regulation of eukaryotic translation by the RACK1 protein: a platform for signalling molecules on the ribosome. EMBO Rep. 2004;5:1137–1141. [PMC free article] [PubMed]
  • Quinn J., Findlay V. J., Dawson K., Millar J. B., Jones N., Morgan B. A., Toone W. M. Distinct regulatory proteins control the graded transcriptional response to increasing H(2)O(2) levels in fission yeast Schizosaccharomyces pombe. Mol. Biol. Cell. 2002;13:805–816. [PMC free article] [PubMed]
  • Satoh R., Morita T., Takada H., Kita A., Ishiwata S., Doi A., Hagihara K., Taga A., Matsumura Y., Tohda H., Sugiera R. Role of the RNA-binding protein Nrd1 and Pmk1 mitogen-activated protein kinase in the regulation of myosin mRNA stability in fission yeast. Mol. Biol. Cell. 2009;20:2473–2485. [PMC free article] [PubMed]
  • Sengupta J., Nilsson J., Gursky R., Spahn C. M., Nissen P., Frank J. Identification of the versatile scaffold protein RACK1 on the eukaryotic ribosome by cryo-EM. Nat. Struct. Mol. Biol. 2004;11:957–962. [PubMed]
  • Shiozaki K., Russell P. Cell-cycle control linked to extracellular environment by MAP kinase pathway in fission yeast. Nature. 1995;378:739–743. [PubMed]
  • Shiozaki K., Russell P. Conjugation, meiosis, and the osmotic stress response are regulated by Spc1 kinase through Atf1 transcription factor in fission yeast. Genes Dev. 1996;10:2276–2288. [PubMed]
  • Shiozaki K., Russell P. Methods in Enzymology. Vol. 283. New York: Academic Press; 1997. Stress-activated protein kinase pathway in cell cycle control of fission yeast; pp. 506–520. [PubMed]
  • Shiozaki K., Shiozaki M., Russell P. Heat Stress activates fission yeast Spc1/Sty1 MAPK by a MEKK-independent mechanism. Mol. Biol. Cell. 1998;9:1339–1349. [PMC free article] [PubMed]
  • Shor B., McLeod M. Cpc2/RACK1 is a ribosome-associated protein that promotes efficient translation in Schizosaccharomyces pombe. J. Biol. Chem. 2003;278:49119–49128. [PubMed]
  • Smith T. F., Gaitatzes C., Saxena K., Neer E. J. The WD repeat: a common architecture for diverse functions. Trends Biochem. Sci. 1999;24:181–185. [PubMed]
  • Soto T., Beltrán F .F., Paredes V., Madrid M., Millar J.B.A., Vicente-Soler J., Cansado J., Gacto M. Cold induces stress-activated protein kinase-mediated response in the fission yeast Schizosaccharomyces pombe. Eur. J. Biochem. 2002;269:1–10. [PubMed]
  • Sugiura R., Toda T., Shuntoh H., Yanagida M., Kuno T. pmp1+, a suppressor of calcineurin deficiency, encodes a novel MAP kinase phosphatase in fission yeast. EMBO J. 1998;17:140–148. [PMC free article] [PubMed]
  • Sugiura R., Kita A., Shimizu Y., Shuntoh H., Sio S. O., Kuno T. Feedback regulation of MAPK signalling by an RNA-binding protein. Nature. 2003;424:961–965. [PubMed]
  • Takada H., et al. Atf1 is a target of the mitogen-activated protein kinase Pmk1 and regulates cell integrity in fission yeast. Mol. Biol. Cell. 2007;18:4794–4802. [PMC free article] [PubMed]
  • Toda T., Dhut S., Superti-Furga G., Gotoh Y., Nishida E., Sugiura R., Kuno T. The fission yeast pmk1+ gene encodes a novel mitogen-activated protein kinase homolog which regulates cell integrity and functions coordinately with the protein kinase C pathway. Mol. Cell. Biol. 1996;16:6752–6764. [PMC free article] [PubMed]
  • Tsukahara K., Yamamoto H., Okayama H. An RNA binding protein negatively controlling differentiation in fission yeast. Mol. Cell. Biol. 1998;18:4488–4498. [PMC free article] [PubMed]
  • Tvegård T., Soltani H., Skjølberg H. C., Krohn M., Nilssen E. A., Kearsey S. E., Grallert B., Boye E. A novel checkpoint mechanism regulating the G1/S transition. Genes Dev. 2007;15:649–654. [PMC free article] [PubMed]
  • Vivancos A. P., Castillo E. A., Jones N., Ayté J., Hidalgo E. Activation of the redox sensor Pap1 by hydrogen peroxide requires modulation of the intracellular oxidant concentration. Mol. Microbiol. 2004;52:1427–1435. [PubMed]
  • Vivancos A. P., Jara M., Zuin A., Sansó M., Hidalgo E. Oxidative stress in Schizosaccharomyces pombe: different H2O2 levels, different response pathways. Mol. Genet. Genomics. 2006;276:495–502. [PubMed]
  • Wilkinson M. G., Samuels M., Takeda T., Toone W. M., Shieh J. C., Toda T., Millar J. B., Jones N. The Atf1 transcription factor is a target for the Sty1 stress-activated MAP kinase pathway in fission yeast. Genes Dev. 1996;10:2289–2301. [PubMed]
  • Won M., Park S. K., Hoe K. L., Jang Y. J., Chung K. S., Kim D. U., Kim H. B., Yoo H. S. Rkp1/Cpc2, a fission yeast RACK1 homolog, is involved in actin cytoskeleton organization through protein kinase C, Pck2, signaling. Biochem. Biophys. Res. Commun. 2001;282:10–15. [PubMed]
  • Yamada K., Nakagawa C. W., Mutoh N. Schizosaccharomyces pombe homologue of glutathione peroxidase, which does not contain selenocysteine, is induced by several stresses and works as an antioxidant. Yeast. 1999;15:1125–1132. [PubMed]
  • Yoshida T., Toda T., Yanagida M. A calcineurin-like gene ppb1+ in fission yeast: mutant defects in cytokinesis, cell polarity, mating and spindle pole body positioning. J. Cell Sci. 1994;107:1725–1735. [PubMed]
  • Zaitsevskaya-Carter T., Cooper J. A. Spm1, a stress-activated MAP kinase that regulates morphogenesis in S. pombe. EMBO J. 1997;16:1318–1331. [PMC free article] [PubMed]
  • Zhan K., Vattem K. M., Bauer B. N., Dever T. E., Chen J. J., Wek R. C. Phosphorylation of eukaryotic initiation factor 2 by heme-regulated inhibitor kinase-related protein kinases in Schizosaccharomyces pombe is important for resistance to environmental stresses. Mol. Cell. Biol. 2002;22:7134–7146. [PMC free article] [PubMed]

Articles from Molecular Biology of the Cell are provided here courtesy of American Society for Cell Biology
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...