![]() | ![]() |
Formats:
|
||||||||||||||||||||
Copyright Intemann et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Autophagy Gene Variant IRGM −261T Contributes to Protection from Tuberculosis Caused by Mycobacterium tuberculosis but Not by M. africanum Strains 1Department of Molecular Medicine, Bernhard Nocht Institute for Tropical Medicine, Hamburg, Germany 2Institute of Medical Biometry and Statistics, University Hospital Schleswig-Holstein, Campus Lübeck, Lübeck, Germany 3National Reference Center for Mycobacteria, Research Center Borstel, Borstel, Germany 4Department of Community Health, College of Health Sciences, Kwame Nkrumah University of Science and Technology, Kumasi, Ghana 5Health Research Unit, Ghana Health Service, Accra, Ghana 6Komfo Anokye Teaching Hospital, Kumasi, Ghana 7Kumasi Centre for Collaborative Research in Tropical Medicine, Kumasi, Ghana 8Department of Parasitology, Bernhard Nocht Institute for Tropical Medicine, Hamburg, Germany William Bishai, Editor Johns Hopkins School of Medicine, United States of America #Contributed equally. * E-mail: c.g.meyer/at/bni-hamburg.de Conceived and designed the experiments: TT ENLB MAC AE JOG IO EOD SRG RDH CGM. Performed the experiments: CDI TT SN SH. Analyzed the data: CDI TT SN CGM. Wrote the paper: CGM. Sample collection supervision Ghana: ENLB. Study design and phenotyping of patients and controls: ENLB MAC JOG IO EOD. Sample collection: MAC AE IO EOD. Sample collection supervision: JOG. Received March 9, 2009; Accepted August 14, 2009. Abstract The human immunity-related GTPase M (IRGM) has been shown to be critically involved in regulating autophagy as a means of disposing cytosolic cellular structures and of reducing the growth of intracellular pathogens in vitro. This includes Mycobacterium tuberculosis, which is in agreement with findings indicating that M. tuberculosis translocates from the phagolysosome into the cytosol of infected cells, where it becomes exposed to autophagy. To test whether IRGM plays a role in human infection, we studied IRGM gene variants in 2010 patients with pulmonary tuberculosis (TB) and 2346 unaffected controls. Mycobacterial clades were classified by spoligotyping, IS6110 fingerprinting and genotyping of the pks1/15 deletion. The IRGM genotype −261TT was negatively associated with TB caused by M. tuberculosis (OR 0.66, CI 0.52–0.84, Pnominal 0.0009, Pcorrected 0.0045) and not with TB caused by M. africanum or M. bovis (OR 0.95, CI 0.70–1.30. P 0.8). Further stratification for mycobacterial clades revealed that the protective effect applied only to M. tuberculosis strains with a damaged pks1/15 gene which is characteristic for the Euro-American (EUAM) subgroup of M. tuberculosis (OR 0.63, CI 0.49–0.81, Pnominal 0.0004, Pcorrected 0.0019). Our results, including those of luciferase reporter gene assays with the IRGM variants −261C and −261T, suggest a role for IRGM and autophagy in protection of humans against natural infection with M. tuberculosis EUAM clades. Moreover, they support in vitro findings indicating that TB lineages capable of producing a distinct mycobacterial phenolic glycolipid that occurs exclusively in strains with an intact pks1/15 gene inhibit innate immune responses in which IRGM contributes to the control of autophagy. Finally, they raise the possibility that the increased frequency of the IRGM −261TT genotype may have contributed to the establishment of M. africanum as a pathogen in the West African population. Author Summary Autophagy is a process in which cell components are degraded by the lysosomal machinery. It has recently been described that activation of autophagy reduces the viability of M. tuberculosis in phagosomes due to an intimate autophagy-phagocytosis interaction. M. tuberculosis may also be directly accessible to autophagy, as M. tuberculosis was found to translocate into the cytoplasm. The immunity-related GTPase IRGM is a mediator of innate immune responses and induces autophagy. We have studied genetic variants of the human IRGM gene in a Ghanaian tuberculosis case-control group and found that the IRGM variant −261T provides relative protection against disease when the infection is caused by the Euro-American lineage of M. tuberculosis. This lineage is characterized by the pks1/15 seven base-pair (bp) deletion. The product of an intact pks1/15 gene, phenolic glycolipid-tb, might contribute to mycobacterial virulence by suppressing innate immune responses. It is, therefore, conceivable that only the Euro-American lineage is exposed to IRGM-triggered innate defence mechanisms. Our observations suggest that the increased frequency of the IRGM −261TT genotype may have allowed the establishment of M. africanum as a pathogen in West Africa. Introduction Autophagy is induced by the formation of intracellular double-membrane structures which form autophagosomes to sequester and, after further maturation to autolysosomes, degrade cytosolic protein aggregates and corrupted cellular organelles. Thereby, it allows a re-cycling of amino acids, which is of particular importance during periods of cell starvation. Autophagy is also an efficient innate defense mechanism in that it may lead to deposition of intracellular pathogens into an autophagosome for subsequent autolysosomal acidification and peptidase-mediated degradation. The net effect of well functioning autophagy is protein degradation, optimized loading of Human Leukocyte Antigen (HLA) class II molecules and intensified antigen presentation [1]. The activation pathways of autophagy and phagocytosis are closely related in that they share phosphatidylinositol-3-phosphate (PI3P) and other factors in facilitating the fusion step and closure of the phagophore at the final stage of phagosome and autophagosome formation [2]. Among other factors, immunity-related GTPases exert significant effects on both autophagy and phagosome maturation [3]. It was recently shown in human U937 cells that inhibition of the immunity-related GTPase IRGM by siRNA caused impaired conversion of light chain 3 (LC3), an exclusive marker of the autophagy cascade, into its active form which is required for the elongation of the double membranes and eventual completion of the autophagosome [4]. In these experiments, impaired LC3 conversion resulted also in an extended survival of BCG in phagosomes. These experiments were based on earlier experiments in mice where Irgm1 (syn.: LRG-47; encoded by Irgm1), the murine homologue of IRGM, was critically involved through induction of autophagy in the control of several intracellular pathogens, including Mycobacterium bovis BCG and M. tuberculosis H37rv [1],[3],[5],[6]. Notably, phagosome development into phagolysosomes may alternatively be induced by the autophagic component LC3 even when the conventional PI3P dependent pathway of phagosome maturation is blocked by experimental infection with the M. tuberculosis H37rv strain [3]. IRGM (syn: LRG47, IFI1) is encoded by the immunity-related GTPase protein family, M gene (IRGM; 5q33.1; OMIM *608212). IRGM consists of a long first exon encoding 181 amino acids, and four shorter putative exons that span more than 50 kilobases (kb) downstream of the first exon [7]. Most recent evidence indicates that the IRGM gene was deactivated during evolution but has regained its function after the insertion of a retroviral ERV9 segment and an Alu repeat sequence (Figure 1
The phylogenetic tree of the M. tuberculosis complex contains two independent clades. Clade 1 represents all M. tuberculosis sensu strictu lineages that may be exclusively pathogenic for humans, while clade 2 comprises lineages that are pathogenic for both humans and animals (M. africanum, M. bovis) [12]. A major branch of M. tuberculosis sensu strictu is the M. tuberculosis Euro-American (EUAM) lineage that recently was shown to be prevalent and cause significant numbers of infections in West Africa as well [13]. While M. tuberculosis lineages occur throughout the world, M. africanum strains are almost exclusively restricted to West Africa [12],[14], suggesting the existence of factors favoring spread and preservation of M. africanum in West Africa. Based on the in vitro evidence on the role of IRGM and autophagy in experimental M. tuberculosis infections of murine and human cells [3],[4] we hypothesized that naturally occurring IRGM variants, including the large upstream 20.1 kb deletion, might also be relevant to the phenotype of in vivo human pulmonary tuberculosis (TB). We have, in a case-control design, re-sequenced fragments of the IRGM gene and genotyped distinct genetic variants. An influence exerted by these variants on susceptibility or resistance to TB should be reflected in a large sample of active sputum-positive cases with pulmonary TB that we collected in Ghana, West Africa, and compared it to a control group of notable size. Results Power of the association study, Hardy-Weinberg equilibrium A power of >90% of detection was achieved for multiplicative and additive models, assuming an approximative TB prevalence of 0.004 in West Africa, a frequency of 0.1 for high risk alleles, and a genotype relative risk of 1.3 (α = 0.05) with our sample size (case-control ratio = 1.18).All variants tested were in HWE in cases and controls except IRGM −261 and IRGM −71, where the distribution of alleles was in HWE among cases, but deviated in controls. The deviation could be traced to the subgroup of controls of Ewe ethnic background. As IRGM −261 and IRGM −71 are in strong LD but were determined by independent genotyping assays, a genotyping failure appears to be highly unlikely. The most plausible explanation is that the deviation results from the low number of Ewe controls (5%). Calculational exclusion of this subgroup from statistical analyses did not affect the significance of our results. As data on the frequency of the IRGM −261T variant in other ethnic groups are not available so far, we have typed this variant also in a small panel of 47 healthy Caucasian subjects. The genotypes CC, CT and TT were observed at frequencies of 0.81, 0.15 and 0.04, respectively, versus frequencies of 0.44, 0.43 and 0.13 in the Ghanaian study population. Although not representative due to the low number of Caucasian individuals and to the bias imposed by a non-randomly selected African study group, the data suggests that the IRGM −261T allele occurs by far more frequently among West Africans. Novel IRGM variants and genotypes identified by re-sequencing Re-sequencing revealed, in addition to previously recognized polymorphisms, ten yet unidentified IRGM variants which were submitted to the NCBI dbSNP database (Table 1). The positions and preliminary NCBI ss numbers of the novel variants are as follows: IRGM −908A>C (ss105106760), −797C>T (ss105106761), −420C>T (ss105106763), −284G>A (ss105106764), 281C>A (ss105106765), 370A>G (ss105106766), IRGM intron +2T>C (ss105106767), intron +106T>C (ss105106768) and a deletion of two bases at positions −386/−387delAG (ss105106769). A tetranucleotide polymorphism (rs60800371; repeats starting at nucleotide position −308) was newly recognized to appear as triple repeat. This variant is located at the 5′-end of the Alu segment (Figure 1
Mycobacterial genotypes Out of the total of 1567 isolates that were obtained and characterized, 1029 (65.7%) were M. tuberculosis Euro-American (EUAM) strains (pks1/15 7 base-pair [bp] deletion), 472 (30.1%) were M. africanum, and 10 (0.6%) were M. bovis (the latter two lineages exhibiting the RD9 deletion). Fifty-six (3.6%) isolates belonged to the M. tuberculosis East-African-Indian (EAI), Beijing or Delhi lineages. Allele, genotype and haplotype associations Genotyping of eight IRGM variants was performed in 2010 HIV-negative TB cases and 2346 controls. The genotyping detection rate was >94% for all variants. In the entire study group, no allelic or genotypic association with disease or resistance was observed. A trend for an association with resistance to TB was, however, seen for the distribution of the IRGM −261TT genotype (OR 0.79, CI 0.65–0.96, uncorrected nominal P value [Pnom] 0.017; Table 2). Stratification for the two major phylogenetic mycobacterial clades, M. tuberculosis sensu strictu and M. africanum/M. bovis, revealed a significant difference in the distribution of the IRGM −261 genotype among cases and controls. IRGM −261TT was significantly associated with protection from TB caused by M. tuberculosis, but not by M. africanum/M. bovis (OR 0.66, CI 0.52–0.84, Pnom 0.0009, Pcorr 0.0045 vs. OR 0.95, CI 0.70–1.30, Pnom 0.8). The association was confirmed in additive and recessive statistical models (ORadd 0.86, CI 0.77–0.95, Pcorr 0.025 and ORrec 0.68, CI 0.53–0.85, Pcorr 0.005, respectively; Table 3). Further stratification with respect to mycobacterial genotypes revealed that the association of the −261TT genotype applied exclusively to carriers of the M. tuberculosis Euro-American (EUAM) genotype, but not to individuals infected with M. tuberculosis East-African-Indian (EAI), Beijing or Delhi genotypes (OR 0.63, CI 0.49–0.81, Pnom 0.0004, Pcorr 0.0019 vs. OR 1.20, CI 0.57–2.52, Pnom 0.6). Again, the association was substantiated in the additive and recessive models (ORadd 0.85, CI 0.76–0.95, Pcorr 0.016 and ORrec 0.64, CI 0.50–0.82, Pcorr 0.0017, respectively; Table 4). No association was observed for carriers of the heterozygous IRGM −261CT genotype (OR 0.96, CI 0.82–1.13, P 0.6).
For the low numbers of patients infected with mycobacteria of the EAI/Bejing/Delhi group, the statistical power might not allow to obtain significant results and a possible association could be easily overlooked. To rule out this possibility statistically, a supplementary test of interaction was performed [16]. This test permitted to verify complete independence of ORs and validation of the exclusive liability of the M. tuberculosis EUAM genotype for the observed association. Cluster analyses of cases were done as previously described [17]. The distribution of the two variants at IRGM position −261 among and within clusters of cases did not differ significantly. This applied also when stratifications for ethnicity were performed. Haplotypes and linkage disequilibria (LD) were reconstructed with the UNPHASED and Haploview softwares, respectively (Table 5, Figure 1
Reporter gene assay A two-tailed student's t-test revealed a significant difference in the normally distributed ratio of firefly Renilla luciferase activity of five independent transfections per IRGM variant in the luciferase reporter gene assay, indicating increased gene expression in cells transfected with pGL3-Control Vector carrying the mutant variant IRGM-261T than in cells transfected with the pGL3-Control Vector with the IRGM wild-type variant (−261C) (P = 0.013) (Figure 2
Discussion We found in a large Ghanaian study group of HIV-negative patients with pulmonary TB and healthy control individuals that a distinct IRGM genotype, IRGM −261TT, was as a trend associated with decreased susceptibility to TB. After stratification for the two major mycobacterial clades and molecular subtypes the trend observed in the entire study group could be traced back to an association of IRGM −261TT with tuberculosis exclusively when caused by the M. tuberculosis EUAM lineage. No association was observed in comparisons of cases caused by M. tuberculosis EAI, Beijing, Delhi and M. africanum/M. bovis with controls. The frequencies of the synonymous variant 313T>C, the variant at position −4299 and of the 20.1 kb deletion, all found to be associated with Crohn's disease in other studies [9]–[11], did not differ significantly between TB patients and controls. Upon infection of macrophages, M. tuberculosis initially resides in phagosomes. During their normal maturation, phagosomes fuse with lysosomes and establish a hostile environment for the pathogen, characterized by lysosomal enzymes, acid pH, reactive oxygen and nitrogen intermediates, and toxic peptides. Most macrophage mediated killing of intracellular pathogens occurs within the phagolysosome and pathogens have developed several mechanisms to avoid this vacuolar attack by escape and multiplication in the cytoplasm, inhibition of phagosome-lysosome fusion or circumventing the common endocytic pathway (reviewed in [18]). With regard to M. tuberculosis H37Rv, translocation of the bacteria from phagosomes to cytosolic compartments has been observed to occur in nonapoptotic cells [19]. Notably, escape into the cytosol has also been observed of the M. tuberculosis strain CDC1551 in laboratory infections of the amoeba Dictyostelium discoideum [20] and loss of phagosomal membranes with release of mycobacteria has been observed in an in vitro system five days post infection [21]. Autophagy induced by IRGM can efficiently interfere with cytosolic replication of pathogens by trapping and recapture and subsequent degradation of bacteria [22],[23]. In the LC3 dependent activation pathway, induction of autophagy contributes not only to the degradation of cytosolic components, but also to the maturation of mycobacterial phagosomes [3],[4]. While M. tuberculosis can impair phagosome maturation by blocking the normal PI3P dependent pathway, this effect is restored and outbalanced by the alternate activation mode triggered by LC3. This is consistent with the finding in mice and in human U937 cells that murine Irgm1 and human IRGM, respectively, play an important role in the containment of M. tuberculosis through efficient induction of autophagy [4]. The polymorphism that is associated with relative resistance to TB, IRGM −261T, in particular when occurring homozygously as TT genotype, might enhance expression of the mature IRGM protein which triggers autophagic degradation of translocated bacteria. The transcription factor AHR is expressed in the monocytic cell line THP1 that we used in our transfection experiments and inhibits differentiation of monocytes in vitro [24],[25]. This suggests that an unaffected AHR/ARNT transcription factor complex that is likely to occur in the IRGM wild-type gene promoter, may decrease innate immune responses mediated by macrophages. Inversely, and based on our luciferase reporter gene assays, the loss of the potential PAX5, AHR and ARNT transcription factor binding sites predicted for the IRGM variant −261T upstream of the coding region is likely to contribute to increased IRGM gene expression and, thus, enhanced innate responses. The fact that IRGM is not inducible by IFN-γ as are Irg genes in mice [4],[7],[26] but initiates successfully autophagy as does IFN-γ, argues for additional resistance mechanisms in individuals carrying the IRGM −261T variant homozygously, independent of other Th1-mediated immune responses. The association that we observed was restricted to infections caused by the M. tuberculosis EUAM lineage. The major characteristic of that lineage is the pks1/15 7 bp deletion which does not occur in M. africanum, M. bovis and in the other M. tuberculosis lineages identified in our study, EAI, Beijing, and Dehli. Why relative protection by IRGM −261TT is exclusively provided against disease caused by the lineage that exhibits the pks1/15 deletion remains to be explained further. One may hypothesize that absence or presence of the pks1/15 deletion may contribute to a modulation of the pathogenic potential of infecting strains in different ethnicities, leading to an adaption of mycobacterial lineages to their sympatric host population. Inhibition of innate immune responses and a tendency of increased spread of bacteria by phenolic glycolipid TB (PGL-tb), the product of undamaged pks1/15 gene, has been demonstrated [27],[28]. It is, therefore, reasonable to assume that lineages which do not produce PGL-tb as a suppressor of the innate immune response are more susceptible to IRGM-triggered innate immune mechanisms, namely phagosome maturation and autophagy. However, a more recent report indicates that PGL-tb itself does not confer hypervirulence, but rather differentially may modulate early cytokine response of the host [29]. As such, variable PGL-tb levels in conjunction with other yet inadequately defined mycobacterial virulence factors might result in a lineage-specific immunogenicity and/or degree of virulence that is related to the occurrence of human genetic variants in a particular population (14,29). Since translocation of bacteria from the phagosome has only been observed for M. tuberculosis H37rv and M. leprae, but not for M. bovis BCG [19], and was not tested for other lineages it is also conceivable that distinct pathogenic strains are subjected to mechanisms preventing translocation to cytosolic compartments and allowing escape from autophagy, a hypothesis that awaits further substantiation. This would support the view of increased virulence of lineages carrying intact pks1/15 genes such as M. tuberculosis Beijing and other lineages, but also underline the equivalent pathogenic potential of M. africanum compared to M. tuberculosis as has been observed in our study group [17]. It is intriguing to speculate that the high prevalence of IRGM −261TT in our Ghanaian study population and the relative protection that it confers from TB caused by M. tuberculosis EUAM might reflect one of multiple selection factors which promote the preferential and virtually exclusive propagation of M. africanum in West Africa, an assumption to be verified in other data sets of mycobacterial and human genotypes which are not yet available. The phylogeography of mycobacteria implies that lineages have become differentially adapted to different ethnicities with allelic variations conferring traits associated with certain infection phenotypes [14]. While the association of the IRGM polymorphism that we found cannot unquestionably confirm the role of IRGM in tuberculosis, it adds evidence to the in vivo experiments in mice and human cells [3],[4] and supports the relevance of autophagy in the control of tuberculosis. Unfortunately, genetic replication data on the role of human IRGM polymorphism in infections caused by M. tuberculosis subtypes that have unambiguously been determined by mycobacterial genotyping are not available so far, neither for Caucasian nor for African or Asian study groups. Data of functional experiments on the effect of IRGM in tuberculosis caused by strains that produce PGL-tb are not available. The inhibition of the innate immune mediators TNF-alpha and other interleukins by PGL-tb has been described earlier [26]. A corresponding inhibition of IRGM would explain our findings and contribute to understanding the role of PGL-tb as a factor of virulence and modulator of innate immune responses. Materials and Methods Ethics statement The study protocol was approved by the Committee on Human Research, Publications and Ethics, School of Medical Sciences, Kwame Nkrumah University, Kumasi, and the Ethics Committee of the Ghana Health Service, Accra. Patients were treated according to the “Directly Observed Treatment, Short-course” (DOTS) strategy organized by the Ghanaian National Tuberculosis Programme. Blood samples for genetic analyses and HIV testing were taken only after a detailed explanation of the study aims and written or thumb-printed consent for participation provided, including HIV testing. Patients and controls Study participants were recruited in Ghana, West Africa, between September 2001 and July 2004. The recruitment area and the enrollment procedure have previously been described [17],[30]. Patients were enrolled at the two Teaching Hospitals in Accra and Kumasi and at additional hospitals or policlinics in Accra, Tema, Kumasi, Obuasi, Agona, Mampong, Agogo, Konongo and Nkawie (Ashanti Region), Nkawkaw and Atibie (Eastern Region), and Assin Fosu and Dunkwa (Central Region). Characterization of patients included i) the documentation of the medical history on standardized structured questionnaires, including self-reported duration of cough and symptoms of TB (dyspnea, chest pain, night sweats, fever, hemoptysis, weight loss), ii) two independent examinations of non-induced sputum specimens for acid-fast bacilli, iii) serological determination of the HIV status and confirmation of positive results by an alternative test system, iv) culturing and molecular differentiation of phylogenetic mycobacterial lineages, and v) a posterior-anterior chest radiography. Inclusion criteria were two sputum smears positive for acid-fast bacilli, no history of previous TB or anti-mycobacterial treatment and an age between 6 and 60 years. Two sputum smears were examined in order to corroborate and confirm the phenotype. Patients were also included if only one smear and the culture for mycobacterial growth was positive. Exclusion criteria were incomplete information provided on the questionnaire, HIV positivity, evidence of alcoholism, drug addiction and other apparent generalized disease. A total of 2010 patients fulfilling the criteria for participation were enrolled. Unrelated personal contacts of cases and community members from neighboring houses of cases and public assemblies were recruited as controls. The leading criterion for enrollment as a control was no history of TB or previous anti-mycobacterial treatment. Characterization of controls included a medical history, posterior-anterior chest X-ray radiography and a tuberculin skin test (Tuberculin Test PPD Mérieux, bioMérieux, Nürtingen, Germany). 1211 personal contacts and 1135 community members fulfilled the criteria for participation and were available as controls. Study participants belonged to the following ethnic groups (cases/controls): Akan including Ashanti, Fante, Akuapem (63.6%/59.1%), Ga-Adangbe (14.5%/19.8%), Ewe (7.1%/9.3%) and ethnic groups of northern Ghana including Dagomba, Sissala, Gonja, and Kusasi (12.9%/10.4%). The proportions of ethnicities among patients and controls did not differ significantly. Disclosure of HIV test results was dependent on the documented willingness of participants to be informed and included for HIV-positive patients their prompt referral to counseling and treatment provided by the Ghanaian AIDS Control Programme. Typing of mycobacterial isolates The firm diagnosis of pulmonary TB was made as described previously [13],[17],[30]. M. tuberculosis complex isolates were cultured on Löwenstein-Jensen (LJ) media and shipped to the German National Reference Centre for Mycobacteria (Borstel, Germany) for minute analyses of biochemical, growth and molecular characteristics. Molecular differentiation of 1567 mycobacterial isolates included spoligotyping, IS6110 fingerprinting and typing of the pks1/15 deletion as described previously [31]–[33]. Mycobacterial strains were for further stratification grouped according to the major phylogenetic lineages [12]. The stepwise procedure of typing of mycobacteria included an initial cluster analysis of IS6110 fingerprinting data and lineage identification according to specific spoligotype signatures. Assignment of lineages was based on the MIRU-VNTRplus webpage (www.miru-vntrplus.org; [34]) and a reference strain collection using the Bionumerics 5.1 software (Applied Maths, Sint-Martens-Latem, Belgium). Classification was confirmed by random selection of 20 strains of each group and testing for the presence of lineage-specific deletions as follows: pks1/15 for M. tuberculosis Euro-American, region of difference (RD) 239 for M. tuberculosis East African Indian (EAI), RD9 and RD711 for M. africanum West African 1, RD9 and RD702 for M. africanum West African 2, and RD9 and RD4 for M. bovis. All M. tuberculosis strains with ambiguous lineage identification were confirmed as belonging to the Euro-American lineage by identifying the presence of the pks1/15 7 bp deletion. Deletion typing was performed using protocols available at the MIRU-VNTRplus webpage [34]. Clusters were defined as groups of affected individuals infected with mycobacterial strains exhibiting the same IS6110 fingerprinting patterns. If less than 5 bands were identified, analyses were supplemented by spoligotyping. Identical strains isolated from 2 or more patients were regarded as a cluster and strains found in 1 patient only were considered unique. HIV testing For HIV-1/-2 testing of TB cases, a capillary test system (Capillus, Trinity Biotech, Bray, Co Wicklow, Ireland) was applied. HIV positivity was confirmed by the Organon Teknika Vironostika HIV-1/-2 EIA system (Organon Teknika, Turnhout, Belgium). The rate of confirmation was 100%. HIV-positive TB patients were excluded from further genetic analyses. DNA re-sequencing of IRGM DNA was isolated from peripheral blood samples of participants (AGOWA® mag Maxi DNA Isolation Kit, Macherey & Nagel, Germany) following the instructions of the manufacturer. The reference sequence was derived from the chromosome 5 contig, GenBank NW_922784.1, region 23935681…23938058. In order to reliably identify the IRGM variants occurring in our study population and to select variants for genotyping, a segment containing 1053 bp of the 5′UTR region upstream of the ATG start codon including the intron and the Alu segment, the open reading frame (ORF) of 546 coding bp and 250 bp of the 3′ region distal of the ORF of the IRGM gene were sequenced. Sequence analysis was performed in 23 TB patients, 23 PPD-positive and in 23 PPD-negative controls. Sequencing reactions were run on an automated ABI 3100 DNA sequencer (Applied Biosystems, Foster City, USA). Forward (F) and reverse (R) primers for re-sequencing were IRGM_pro1000F ccttgaaaaagagcagagcatt and IRGM_pro1000R tagcatccccagccctca (598 bp), IRGM_pro500F ttgctccctgaagaaatgtg and IRGM_pro500R ctcaacattcatggcttcca (599 bp), IRGM_p1F aatatctgcgtccagggttc and IRGM_p1R tgaactgcatttccatcagg (572 bp) and IRGM_p2F tgtgcctcctatttctcttcc and IRGM_p2 tgatataatcttgcatccattttaag (600 bp). IRGM variants selected for genotyping Based on the results of re-sequencing and evidence of association of with other conditions, eight IRGM variants were selected for genotyping (Table 6). The variant at position −566G/C (rs17111379) was chosen for genotyping, as this variant was by re-sequencing identified in the groups of TB cases and PPD-positive controls only. Notably, IRGM −566 allele frequencies are unevenly distributed between Caucasians and the West African ethnicity of Yoruba (Caucasians: G 1.0; Yoruba, originating from Nigeria: G 0.74, C 0.26; www.hapmap.org/cgi-perl/snp_details?name=rs17111379&source=hapmap_B35). The variant at position −420C/T (ss105106763) was included as it was identified as a novel variant in our study population and was not in strong linkage with other polymorphisms. The IRGM variant −261 (rs9637876) was selected for genotyping, because, according to an in silico prediction of transcription factor binding properties, the allele causes loss of several binding sites (PAX5, ARNT, AHR; http://alggen.lsi.upc.es/recerca/menu_recerca.html). IRGM −71 (rs9637870) and the microsatellite repeat (rs60800371; repeats starting at position −308) are in LD with IRGM −261 and were included in genotyping to more reliably identify a potentially causative variant. The synonymous exonic variant 313C/T (L105L; rs10065172), the 20.1 kb deletion and the variant located 124 bp downstream of the 20.1 kb deletion (rs13361189; position −4299) were included in the genotyping panel due to their proven association with Crohn's disease [9]–[11].
Further variants that were identified by DNA re-sequencing were not subjected to genotyping, as they were either in perfect LD with +313 (−964A/C, −787C/T, +87A/G), or too low in their frequencies to allow for reasonable statistical calculations (−908A/C, −844C/T, −797C/T, −386/7delAG, −284G/A, 281C/A, 370A/G, +2T/C, +106C/T). Genotyping of IRGM variants IRGM variants were analyzed by dynamic allele-specific hybridization with fluorescence resonance energy transfer (FRET) in a LightTyper device (Roche Diagnostics, Mannheim, Germany). Primer pairs, sensor- and anchor-oligonucleotides utilized are listed in Table 6. As no frequency information was available for the occurrence of the IRGM −261 polymorphism among Caucasians, this variant was also genotyped in 47 healthy voluntary German individuals (employees of the Bernhard Nocht Institute for Tropical Medicine, Hamburg; informed consent obtained). For the microsatellite repeat, a FRET-based LightTyper method was developed using a sensor nucleotide that covered the entire tetranucleotide repeat with adjacent 5′- and 3′-nucleotides [15]. Depending on the actual number of the repeats, distinct melting temperatures allow explicit specification of the number of repeats. For the 20.1 kb deletion upstream of the IRGM promoter, the LightTyper design was combined with a gap-PCR comprising two forward primers matching upstream and within the region of deletion. The assay enabled the determination of gene fragments with and without the 20.1 kb deletion. Plasmid construction and reporter gene assay All plasmid constructions were based on the pGL3-Control Vector (Promega, Mannheim, Germany) which contains the SV40 promoter driving the firefly luciferase gene. Two fragments, each of 0.4 kb, comprising the Alu-repeat sequence and, thus, including the IRGM variants of interest, −261C or −261T, were PCR-amplified with oligonucleotide primers 5′-cgaagctttcacactctattagctgcatccttaac-3′ and 5′-cgccatggctttctcaacattcatggcttccat-3′ from 10 ng of genomic human DNA (Biomers.net GmbH, Ulm Germany). PCR conditions were: Initial denaturation (98°C, 30′), 30 amplification cycles (98°C, 7′; 64°C 20′; 72°C, 35′) and final elongation (72°C, 7′). HindIII and NcoI restriction sites at the 5′ and 3′ end, respectively, were engineered on each PCR product. Fragments were then ligated into the HindIII-NcoI digested pGL3-Control Vector to generate plasmids pGL3 −261C and pGL3 −261T. Enzymatic digestions and ligations were performed according to the instructions of the manufacturer. Small-scale preparations were done applying the NucleoSpin Plasmid Kit (Macherey and Nagel, Düren, Germany). Plasmid DNAs were propagated in E. coli XL1- Blue cells (Stratagene, La Jolla, CA, USA) and prepared using the EndoFree Plasmid Maxi Kit (Quiagen, Hilden, Germany). DNA sequences of the final constructs were confirmed by sequencing. 1×106 cells of the human monocytic cell line THP1 (German Resource Centre for Biological Material, DMSZ, Braunschweig, Germany) were transfected with either 0.5 µg of the two plasmid constructs, with the addition of 0.5 µg of the plasmid phRL-CMV which contains the gene encoding Renilla luciferase (Promega, Mannheim, Germany) in order to normalize results. Transfectiosn with 0.5 µg of the unmodified pGL3-Control Vector and 0.5 µg phRL-CMV, as well as a mock transfection, were performed for control and to minimize effects of reagents on the cells. All transfections were performed with the Amaxa Cell Line Nucleofector Kit V (Lonza, Cologne, Germany). Four hours after transfection, cells were harvested and luciferase activities were measured (Dual-Luciferase Reporter Assay System; Promega, Mannheim, Germany). Firefly luminescence was measured using a single tube Junior LB9509 luminometer (Berthold Technologies, Bad Wildbad, Germany). After a 10 second measurement period, 100 µl 1× Stop & Glo Reagent were added for the detection of Renilla luminescence. Measurements of luminescence are expressed as relative light units (RLU). For each variant, five independent transfections were performed. Databases, statistics Demographic data, self-reported signs and symptoms as documented on structured questionnaires as well as laboratory results were double-entered into a Fourth Dimension database (San Jose, CA, USA). Bacteriological data were provided as Excel datasheets. Data were locked before using them in a pseudonymized form for statistical analyses. Power calculations were performed with the public CATS software (http://www.sph.umich.edu/csg/abecasis/CaTS/). Multivariate logistic regression analyses were calculated for different models to determine odds ratios (OR) for allele and genotype distributions (STATA 10.0MP software; Stata Corporation, College Station, TX, USA). As age, sex and ethnicity were significant confounders, they were appropriately adjusted for. Analyses of allele distributions and Hardy-Weinberg equilibria (HWE) were calculated with a public STATA module (www-gene.cimr.cam.ac.uk/clayton/software/stata/genassoc; David Clayton, Cambridge, UK). Haplotypes were estimated with the UNPHASED software (version 3.0.13; Frank Dudbridge, http://www.mrc-bsu.cam.ac.uk/personal/frank/software/unphased/), whereby incomplete haplotypes were subjected to simulations comprising all possible haplotypic completions of available data. In order to verify the independence of ORs that were obtained for associations of different mycobacterial clades/genotypes with phenotypes, ORs were subjected to tests of interaction according to the method described in [16]. Corrections of nominal P values (Pnom) for multiple testing applied to the number of variants tested and when stratifications by mycobacterial lineages were made. Bonferroni corrected P values (Pcorr)<0.05 were considered significant and correction values are indicated where applicable. The tetranucleotide repeat rs60800371 and SNPs at positions −261 (rs9637876) and −71 (rs9637870) are in strong LD (r2~0.8) and were, therefore, combined as a single correction entity. Global P values of haplotype associations and of distinct haplotypes were subjected to 1000 permutations (UNPHASED software). Shapiro-Wilk tests and a two-tailed student's t-test were calculated to confirm a normal distribution and differences in the ratio of firefly Renilla luciferase activity in the reporter gene assay.Accession numbers Genes and genomic contig Immunity-related GTPase family, M; IRGM (NCBI BC128168.1); Homo sapiens chromosome 5 genomic contig (NCBI NW_922784.1). Protein Immunity-related GTPase family, M; IRGM (NCBI NP_001139277). Transcription factors Aryl hydrocarbon receptor nuclear translocator; ARNT; (HUGO Gene Nomenclature Committee, [HGNC] HGNC:700); Aryl hydrocarbon receptor; AHR (HGNC HGNC:348); Paired box 5; PAX5 (HGNC HGNC:8619); Forkhead box P3; FOXP3 (HGNC HGNC:6106); Nuclear receptor subfamily 3, group C, member 1/glucocorticoid receptor; GR (HGNC HGNC:7978); Progesterone receptor/PGR; PR A/PR B (HGNC HGNC:8910). Single nucleotide polymorphisms Deletion (not available); −4299 C>T (NCBI rs13361189); −964 A>C (NCBI rs10059011); −908 A>C (NCBI ss105106760); −844 T>C (NCBI rs10052068); −797 C>T (NCBI ss105106761); −787 T>C (NCBI rs17111376); −566 G>C (NCBI rs17111379); −420 C>T (NCBI ss105106763); −386/387 AG>del (NCBI ss105106769); −308 1, 3 or 4 ‘GTTT’ (NCBI rs60800371); −284 G>A (NCBI ss105106764); −261 C>T (NCBI rs9637876); −71 G>A (NCBI rs9637870); 281 C>A (NCBI ss105106765); 313 C>T (NCBI rs10065172); 370 A>G (NCBI ss105106766); +2 T>C (NCBI ss105106767); +87 G>A (NCBI rs7705542); +106 T>C (NCBI ss105106768). Acknowledgments The participation of patients and the volunteers who served as controls is gratefully acknowledged, also the contributions of field workers, nurses and physicians involved in the recruitment of participants, the staff of the Kumasi Centre for Collaborative Research in Tropical Medicine (KCCR) and the excellent assistance of Emmanuel Abbeyquaye, Lincoln Gankpala, Sonja Burmester, Birgit Muntau, Gerd Ruge, Jürgen Sievertsen. Susanne Homolka and Birgit Förster were involved in genotyping of mycobacteria and the reporter gene assays, respectively. Volker Heussler was helpful with the reporter gene assays and provided laboratory reagents. Footnotes The authors have declared that no competing interests exist. This work was supported by the German Federal Ministry of Education and Research (BMBF), German National Genome Research Network (NGFN1; Project 01GS0162; NGFN2, NIE-S17T20) and the BMBF Tuberculosis Research Network (Project 01KI0784). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. References 1. Deretic V. Autophagy as an immune defense mechanism. Curr Opin Immunol. 2006;18:375–382. [PubMed] 2. Walker S, Chandra P, Manifava M, Axe E, Ktistakis NT. Making autophagosomes: localized synthesis of phosphatidylinositol 3-phosphate holds the clue. Autophagy. 2008;4:1093–1096. [PubMed] 3. Gutierrez MG, Master SS, Singh SB, Taylor GA, Colombo MI, et al. Autophagy is a defense mechanism inhibiting BCG and Mycobacterium tuberculosis survival in infected macrophages. Cell. 2004;119:753–766. [PubMed] 4. Singh SB, Davis AS, Taylor GA, Deretic V. Human IRGM induces autophagy to eliminate intracellular mycobacteria. Science. 2006;313:1438–1441. [PubMed] 5. Butcher BA, Greene RI, Henry SC, Annecharico KL, Weinberg JB, et al. p47 GTPases regulate Toxoplasma gondii survival in activated macrophages. Infect Immun. 2005;73:3278–3286. [PubMed] 6. Wang Y, Weiss LM, Orlofsky A. Host cell autophagy is induced by Toxoplasma gondii and contributes to parasite growth. J Biol Chem. 2009;284:1694–1701. [PubMed] 7. Bekpen C, Hunn JP, Rohde C, Parvanova I, Guethlein L, et al. The interferon-inducible p47 (IRG) GTPases in vertebrates: loss of the cell autonomous resistance mechanism in the human lineage. Genome Biol. 2005;6:R92. [PubMed] 8. Bekpen C, Marques-Bonet T, Alkan C, Antonacci F, Leogrande MB, et al. Death and resurrection of the human IRGM gene. PLoS Genet. 2009;5:e1000403. doi: 10.1371/journal.pgen.1000403. [PubMed] 9. Parkes M, Barrett JC, Prescott NJ, Tremelling M, Anderson CA, et al. Sequence variants in the autophagy gene IRGM and multiple other replicating loci contribute to Crohn's disease susceptibility. Nat Genet. 2007;39:830–832. [PubMed] 10. Massey DC, Parkes M. Genome-wide association scanning highlights two autophagy genes, ATG16L1 and IRGM, as being significantly associated with Crohn's disease. Autophagy. 2007;3:649–651. [PubMed] 11. McCarroll SA, Huett A, Kuballa P, Chilewski SD, Landry A, et al. Deletion polymorphism upstream of IRGM associated with altered IRGM expression and Crohn's disease. Nat Genet. 2008;40:1107–1112. [PubMed] 12. Wirth T, Hildebrand F, Allix-Béguec C, Wölbeling F, Kubica T, et al. Origin, Spread and Demography of the Mycobacterium tuberculosis complex. PLoS Pathogens. 2008;4:e1000160. doi: 10.1371/journal.ppat.1000160. [PubMed] 13. Herb F, Thye T, Niemann S, Browne EN, Chinbuah MA, et al. ALOX5 variants associated with susceptibility to human pulmonary tuberculosis. Hum Mol Genet. 2008;17:1052–1060. [PubMed] 14. Gagneux S, Small PM. Global phylogeography of Mycobacterium tuberculosis and implications for tuberculosis product development. Lancet Infect Dis. 2007;7:328–337. [PubMed] 15. Intemann CD, Thye T, Sievertsen J, Owusu-Dabo E, Horstmann RD, et al. Genotyping of IRGM tetranucleotide promoter oligorepeats by fluorescence resonance energy transfer. BioTechniques. 2008;46:58–60. [PubMed] 16. Altman DG, Bland JM. Interaction revisited: the difference between two estimates. BMJ. 2003;326:219. [PubMed] 17. Meyer CG, Scarisbrick G, Niemann S, Browne EN, Chinbuah MA, et al. Pulmonary tuberculosis: virulence of Mycobacterium africanum and relevance in HIV co-infection. Tuberculosis (Edinb). 2008;88:482–489. [PubMed] 18. Smith I. Mycobacterium tuberculosis pathogenesis and molecular determinants of virulence. Clin Microbiol Rev. 2003;16:463–496. [PubMed] 19. van der Wel N, Hava D, Houben D, Fluitsma D, van Zon M, et al. M. tuberculosis and M. leprae translocate from the phagolysosome to the cytosol in myeloid cells. Cell. 2007;129:1287–1298. [PubMed] 20. Hagedorn M, Rohde KH, Russell DG, Soldati T. Infection by tubercular mycobacteria is spread by nonlytic ejection from their amoeba hosts. Science. 2009;323:1729–1733. [PubMed] 21. Lee BY, Clemens DL, Horwitz MA. The metabolic activity of Mycobacterium tuberculosis, assessed by use of a novel inducible GFP expression system, correlates with its capacity to inhibit phagosomal maturation and acidification in human macrophages. Mol Microbiol. 2008;68:1047–1060. [PubMed] 22. Nakagawa I, Amano A, Mizushima N, Yamamoto A, Yamaguchi H, et al. Autophagy defends cells against invading group A Streptococcus. Science. 2004;306:1037–1040. [PubMed] 23. Ogawa M, Yoshimori T, Suzuki T, Sagara H, Mizushima N, et al. Escape of intracellular Shigella from autophagy. Science. 2005;307:727–731. [PubMed] 24. Hayashi S, Okabe-Kado J, Honma Y, Kawajiri K. Expression of Ah receptor (TCDD receptor) during human monocytic differentiation. Carcinogenesis. 1995;16:1403–1409. [PubMed] 25. Platzer B, Richter S, Kneidinger D, Waltenberger D, Woisetschläger M, Strobl H. Aryl hydrocarbon receptor activation inhibits in vitro differentiation of human monocytes and langerhans dendritic cells. J Immunol. 2009;183:66–74. [PubMed] 26. MacMicking JD, Taylor GA, McKinney JD. Immune control of tuberculosis by IFN-gamma-inducible LRG-47. Science. 2003;302:654–659. [PubMed] 27. Reed MB, Domenech P, Manca C, Su H, Barczak AK, et al. A glycolipid of hypervirulent tuberculosis strains that inhibits the innate immune response. Nature. 2004;431:84–87. [PubMed] 28. Tsenova L, Ellison E, Harbacheuski R, Moreira AL, Kurepina N, et al. Virulence of selected Mycobacterium tuberculosis clinical isolates in the rabbit model of meningitis is dependent on phenolic glycolipid produced by the bacilli. J Infect Dis. 2005;192:98–106. [PubMed] 29. Sinsimer D, Huet G, Manca C, Tsenova L, Koo MS, et al. The phenolic glycolipid of Mycobacterium tuberculosis differentially modulates the early host cytokine response but does not in itself confer hypervirulence. Infect Immun. 2008;76:3027–3036. [PubMed] 30. Thye T, Browne EN, Chinbuah MA, Gyapong J, Osei I, et al. No associations of human pulmonary tuberculosis with Sp110 variants. J Med Genet. 2006;43:e32. [PubMed] 31. Kamerbeek J, Schouls L, Kolk A, van Agterveld M, van Soolingen D, et al. Simultaneous detection and strain differentiation of Mycobacterium tuberculosis for diagnosis and epidemiology. J Clin Microbiol. 1997;35:907–914. [PubMed] 32. van Embden JD, Cave MD, Crawford JT, Dale JW, Eisenach KD, et al. Strain identification of Mycobacterium tuberculosis by DNA fingerprinting: recommendations for a standardized methodology. J Clin Microbiol. 1993;31:406–409. [PubMed] 33. Niemann S, Kubica T, Bange FC, Adjei O, Browne EN, et al. The species Mycobacterium africanum in the light of new molecular markers. J Clin Microbiol. 2004;42:3958–3962. [PubMed] 34. Allix-Béguec C, Harmsen D, Weniger T, Supply P, Niemann S. Evaluation and strategy for use of MIRU-VNTRplus, a multifunctional database for online analysis of genotyping data and phylogenetic identification of Mycobacterium tuberculosis complex isolates. J Clin Microbiol. 2008;46:2692–2699. [PubMed] |
PubMed related articles
Your browsing activity is empty. Activity recording is turned off. |
|||||||||||||||||||
Curr Opin Immunol. 2006 Aug; 18(4):375-82.
[Curr Opin Immunol. 2006]Autophagy. 2008 Nov 16; 4(8):1093-6.
[Autophagy. 2008]Cell. 2004 Dec 17; 119(6):753-66.
[Cell. 2004]Science. 2006 Sep 8; 313(5792):1438-41.
[Science. 2006]Curr Opin Immunol. 2006 Aug; 18(4):375-82.
[Curr Opin Immunol. 2006]Infect Immun. 2005 Jun; 73(6):3278-86.
[Infect Immun. 2005]Genome Biol. 2005; 6(11):R92.
[Genome Biol. 2005]PLoS Genet. 2009 Mar; 5(3):e1000403.
[PLoS Genet. 2009]Nat Genet. 2007 Jul; 39(7):830-2.
[Nat Genet. 2007]Nat Genet. 2008 Sep; 40(9):1107-12.
[Nat Genet. 2008]Biotechniques. 2009 Jan; 46(1):58-60.
[Biotechniques. 2009]PLoS Pathog. 2008 Sep 19; 4(9):e1000160.
[PLoS Pathog. 2008]Hum Mol Genet. 2008 Apr 1; 17(7):1052-60.
[Hum Mol Genet. 2008]Lancet Infect Dis. 2007 May; 7(5):328-37.
[Lancet Infect Dis. 2007]Cell. 2004 Dec 17; 119(6):753-66.
[Cell. 2004]Science. 2006 Sep 8; 313(5792):1438-41.
[Science. 2006]Biotechniques. 2009 Jan; 46(1):58-60.
[Biotechniques. 2009]BMJ. 2003 Jan 25; 326(7382):219.
[BMJ. 2003]Tuberculosis (Edinb). 2008 Sep; 88(5):482-9.
[Tuberculosis (Edinb). 2008]Nat Genet. 2007 Jul; 39(7):830-2.
[Nat Genet. 2007]Nat Genet. 2008 Sep; 40(9):1107-12.
[Nat Genet. 2008]Clin Microbiol Rev. 2003 Jul; 16(3):463-96.
[Clin Microbiol Rev. 2003]Cell. 2007 Jun 29; 129(7):1287-98.
[Cell. 2007]Science. 2009 Mar 27; 323(5922):1729-33.
[Science. 2009]Mol Microbiol. 2008 May; 68(4):1047-60.
[Mol Microbiol. 2008]Science. 2004 Nov 5; 306(5698):1037-40.
[Science. 2004]Science. 2005 Feb 4; 307(5710):727-31.
[Science. 2005]Cell. 2004 Dec 17; 119(6):753-66.
[Cell. 2004]Science. 2006 Sep 8; 313(5792):1438-41.
[Science. 2006]Carcinogenesis. 1995 Jun; 16(6):1403-9.
[Carcinogenesis. 1995]J Immunol. 2009 Jul 1; 183(1):66-74.
[J Immunol. 2009]Science. 2006 Sep 8; 313(5792):1438-41.
[Science. 2006]Genome Biol. 2005; 6(11):R92.
[Genome Biol. 2005]Science. 2003 Oct 24; 302(5645):654-9.
[Science. 2003]Nature. 2004 Sep 2; 431(7004):84-7.
[Nature. 2004]J Infect Dis. 2005 Jul 1; 192(1):98-106.
[J Infect Dis. 2005]Infect Immun. 2008 Jul; 76(7):3027-36.
[Infect Immun. 2008]Cell. 2007 Jun 29; 129(7):1287-98.
[Cell. 2007]Tuberculosis (Edinb). 2008 Sep; 88(5):482-9.
[Tuberculosis (Edinb). 2008]Lancet Infect Dis. 2007 May; 7(5):328-37.
[Lancet Infect Dis. 2007]Cell. 2004 Dec 17; 119(6):753-66.
[Cell. 2004]Science. 2006 Sep 8; 313(5792):1438-41.
[Science. 2006]Science. 2003 Oct 24; 302(5645):654-9.
[Science. 2003]Tuberculosis (Edinb). 2008 Sep; 88(5):482-9.
[Tuberculosis (Edinb). 2008]J Med Genet. 2006 Jul; 43(7):e32.
[J Med Genet. 2006]Hum Mol Genet. 2008 Apr 1; 17(7):1052-60.
[Hum Mol Genet. 2008]Tuberculosis (Edinb). 2008 Sep; 88(5):482-9.
[Tuberculosis (Edinb). 2008]J Med Genet. 2006 Jul; 43(7):e32.
[J Med Genet. 2006]J Clin Microbiol. 1997 Apr; 35(4):907-14.
[J Clin Microbiol. 1997]J Clin Microbiol. 2004 Sep; 42(9):3958-62.
[J Clin Microbiol. 2004]J Clin Microbiol. 2008 Aug; 46(8):2692-9.
[J Clin Microbiol. 2008]Nat Genet. 2007 Jul; 39(7):830-2.
[Nat Genet. 2007]Nat Genet. 2008 Sep; 40(9):1107-12.
[Nat Genet. 2008]Biotechniques. 2009 Jan; 46(1):58-60.
[Biotechniques. 2009]BMJ. 2003 Jan 25; 326(7382):219.
[BMJ. 2003]