• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
J Cell Sci. Author manuscript; available in PMC Aug 25, 2009.
Published in final edited form as:
PMCID: PMC2731302
NIHMSID: NIHMS92016

IDENTIFICATION OF A DEVELOPMENTALLY-REGULATED PATHWAY OF MEMBRANE RETRIEVAL IN NEURONAL GROWTH CONES

Abstract

During axon navigation and upon target recognition the growth cone plasma membrane is constantly reconfigured as a result of changes in cytoskeletal and membrane dynamics. The identity and regulation of the membrane pathway(s) participating in remodeling of the growth cone surface remain elusive. Here, we identify a constitutive, high capacity plasma membrane recycling activity in the axonal growth cones which is mediated by a novel bulk endocytic pathway mechanistically related to macropinocytosis. This pathway, involving large compartments distributed at sites of intense actin-based membrane ruffling, requires phosphatidylinositol 3-kinase activity, the small GTPase Rac1 and the pinocytic chaperone Pincher. At early developmental stages, the synaptic vesicle and classical endosomal recycling pathways do not participate in the rapid retrieval of the growth cone plasma membrane. At later stages, during the onset of synaptogenesis, an intrinsic program of maturation leads to downregulation of basal bulk endocytosis and the emergence of depolarization-induced synaptic vesicle exo-endocytosis. We propose that the control of bulk membrane retrieval contributes to the homeostatic regulation of the axonal plasma membrane and growth cone remodeling during axonal outgrowth. In addition, we suggest that the downregulation of bulk endocytosis during synaptogenesis might contribute to the preservation of synaptic vesicle specificity.

Keywords: endocytosis, axolemma, synaptic vesicle, trafficking, fluorescence microscopy

INTRODUCTION

In the nervous system, axons are guided to their specific targets by highly motile growth cones, present at their distal tip, which exhibit a remarkable organization. Operationally, they include a peripheral (P) domain composed of actin-rich lamellipodia and filopodia, a central (C) domain containing microtubules and various organelles, and a transitional (T) domain, at the interface between the P and C domains, characterized by intense F-actin remodeling and membrane ruffling (Dailey and, 1989 Bridgman; Forscher and Smith, 1988; Schaefer et al.,2002). During axon navigation and synapse formation growth cones respond to environmental cues with drastic rearrangements of their membrane and cytoskeletal components (Dent and Gertler, 2003).

The growth cone is recognized as the major site of axonal membrane addition and recycling (Bray, 1970; Sinclair et al., 1988; Parton et al., 1992; Craig et al, 1995; Zakharenko and Popov, 2000); however, the control of its membrane dynamics during axon growth and retraction is still poorly understood. Earlier ultrastructural analyses reported in the C domain the localization of a plethora of organelles, still largely undefined in terms of identity (Yamada et al., 1971; Pfenninger and Maylié-Pfenninger, 1981; Tsui et al., 1983; Cheng and Reese, 1985). Some of these organelles, including clusters of synaptic vesicle (SV) precursors (Fletcher et al., 1991), are exocytic, subjected to regulatory mechanisms similar to those operative at mature synapses (Bonanomi et al., 2005). These precursors contribute to the formation of the presynaptic pool of vesicles at nascent synaptic contacts (Chow and Poo, 1985; Matteoli et al., 1992; Ahmari et al., 2000; for review, see Bonanomi et al 2006) but have no role in neurite outgrowth and in the expansion of the growth cone plasma membrane (Lockerbie et al., 1991; Leoni et al., 1999; Verhage et al., 2000).

Endocytosis in the growth cone has been shown to take place by at least two processes, one constitutive and one evoked, carried out by distinct populations of vesicles (Diefenbach et al., 1999). Interestingly, these processes do not operate independently, but coordinately with exocytosis and in strict interaction with cytoskeletal dynamics. As a consequence, endocytosis is enhanced during growth cone collapse induced by repulsive cues (Fournier et al., 2000; Jurney et al., 2002), but is also required for axon outgrowth (Kim and Wu, 1987; Torre et al., 1994; Mundigl et al., 1998; Albertinazzi et al., 2003). Counterintuitively, membrane retrieval at the newly formed growth cone is a main process associated with vigorous extension of axons after axotomy (Ashery et al., 1996). Rapid, bidirectional changes of surface membrane do therefore take place at growth cones during axon navigation. By combining imaging of endocytic tracers with interference and overexpression approaches we have investigated the nature and properties of the endocytic processes taking place at the growth cones of developing hippocampal neurons in culture.

MATERIALS AND METHODS

Materials

The following primary antibodies were used: mouse anti-synaptobrevin 2, rabbit anti-APP and rabbit anti-syntaxin13 (Synaptic Systems, Göttingen, Germany); mouse anti Tau-1 (MAB3420) (Millipore corporation, Billerica, MA); mouse anti clathrin heavy chain (clone X22) (ABR-Affinity BioReagents, Golden, CO); mouse anti-hemagglutinin (HA) (Roche Diagnostics, Indianapolis, IN); rabbit anti-panTrk (C-14) (Santa Cruz Biotechnology, Inc., Santa. Cruz, CA); mouse anti-FLAG M5 (Sigma-Aldrich, St. Louis, MO); rabbit anti L1 (a gift of F. Rathjen, Max-Delbrueck-Centrum fuer Molekulare Medizin, Berlin, Germany), rabbit anti Rabankyrin-5 (a gift of M. Zerial, MPI Molecular Cell Biology and genetics, Dresden, Germany); rabbit anti-β1 integrin (a gift from K. Rubin, Uppsala University, Uppsala, Sweden). TRITC and FITC-conjugated secondary antibodies were from Jackson ImmunoResearch (West Grove, PA). FITC-conjugated phalloidin, filipin III, Lucifer yellow CH, brefeldin A (BFA), LY294002, methyl-β-cyclodextrin (MβCD) were from Sigma-Aldrich (St. Louis, MO). FM4-64, yellow-green (505/515) carboxylate-modified FluoSpheres® beads, transferrin-Alexa488 Fluor, cholera toxin-Alexa488 Fluor were from Invitrogen-Molecular Probes (Carlsbad, CA). Cytochalasin D, was from Calbiochem (La Jolla, CA). All chemicals were diluted in Kreb’s-Ringer-HEPES (KRH) (in mM: 150 NaCl, 5 KCl, 1.2 MgSO4, 1.2 KH2PO4, 2 CaCl2, 10 glucose, and 10 HEPES, pH 7.4) at the indicated concentrations. For depletion of extracellular Ca2+, KRH was supplemented with 2 mM EGTA and CaCl2 was substituted with 2 mM MgCl2.

Plasmids and viral vectors

The pFLAG-N17-Rac1A plasmid coding for the dominant negative form of the avian Rac1A GTPase, and the pFLAG-V12-Rac1A plasmid coding for the constitutively active form of the Rac GTPases were a gift of Dr. Ivan de Curtis (DIBIT-San Raffaele Scientific Institute, Milan, Italy) (Albertinazzi et al., 1998). The pEYFP-N3 vector was from BD Biosciences Clontech, (Palo Alto, CA). Lentiviruses expressing ECFP-VAMP2 have been previously described (Bonanomi et al., 2005). Defective recombinant adenoviruses driving the simultaneous expression of GFP and either HA-Pincher or HA-PincherG68E were made using the Ad-Easy system (Valdez,et al, 2005). Adenoviruses expressing GFP have been produced at the AAV Vector Unit (AVU) of the International Centre for Genetic Engineering and Biotechnology (ICGEB) Trieste, Italy as previously described (Zentilin et al., 2001).

RNA interference

The clathrin heavy chain Stealth (Invitrogen, Carlsbad, CA) efficiently knock-down clathrin in mouse cells (Lampugnani et al., 2006). Stealth were designed with the BLOCK-iT™ RNAi Designer (Invitrogen, Carlsbad, CA), starting from Mus musculus clathrin, heavy polypeptide NM_001003908. The starting nucleotide is 1,284 bases downstream of the start codon (5’-3’ sequence GAAGAACUCUUUGCCCGGAAAUUUA, antisense UAAAUUUCCGGGCAAAGA-GUUCUUC). As a control, a Stealth siRNA-negative control duplex oligonucleotide with a C/G content equivalent to the positive oligonucleotide was used (5’-3’ sequence GAAUCAUUCCGUGC-CAAGUAGAUUA, antisense UAAUCUACUUGGCACGGAAUGAUUC). After dissection and trypsinization, mouse neurons were nucleofected as described below and cultured for 48 h before the experiments. Efficient silencing was verified by retrospective immunofluorescence.

Cell culture and Transduction of neurons

Primary neuronal cultures were prepared from the hippocampi of either Sprague-Dawley E18 rat embryos or E17 C57BL/6J mouse embryos (Charles River Italica, Calco, Italy) as previously described (Banker and Cowan, 1977). For infection, neurons were placed the day after plating in a clean dish containing glia-conditioned medium (MEM supplemented with 1% N2 supplement (Invitrogen), 2 mM glutamine (Biowhittaker Inc., Biggs Ford Rd. Walkersville, MD), 0.1% ovalbumin, 1 mM sodium pyruvate (Sigma-Aldrich), and 4 mM glucose) and incubated for 10–15 h at 37° C in a 5% CO2 humidified atmosphere in the presence of viral supernatant. After transduction, neurons were returned to the original dishes and maintained in culture in glia-conditioned medium. In some experiments, rat neurons (~1.5 × 106 cells) were nucleofected in suspension immediately after harvesting with 3 µg of DNA using the Basic Nucleofector Kit for primary neurons (Amaxa Biosystems, Cologne, Germany) (O-03 program). For RNAi experiments mouse neurons (~3 × 106 cells) were nucleofected with 3 µg of oligonucleotides together with 0.5 µg pEYFP-N3 plasmid using the O-05 program. After electroporation, neurons were diluted and plated at the standard low density.

Cell labeling protocols

For FM4-64 uptake experiments, neurons were incubated with FM4-64 (10 µM) diluted in either KRH (basal medium) or KRH containing 55 mM KCl (depolarizing solution) for 1 min at room temperature (RT), rinsed three times by complete medium substitution with KRH over a course of 2 min and live imaged. When indicated, FM4-64 uptake was carried out at 37° C. Since fixation does not result in noticeable loss of FM4-64 fluorescence (Diefenbach et al., 1999), in several experiments neurons were fixed after loading with FM4-64 in order to obtain large numbers of growth cones for analysis. Fixation was performed for 15 min at RT with 4% paraformaldehyde, 4% sucrose in 120 mM sodium phosphate buffer (pH 7.4) supplemented with 2 mM EGTA. In some cases, fixed neurons were processed for immunofluorescence as previously described (Menegon et al., 2002). As FM4-64 is lost upon cell permeabilization, a circle was inscribed on the bottom coverslip using a diamond-tip scribing objective (Zeiss, Oberkochen, Germany) and was used as a reference to relocate previously imaged growth cones. For loading of fluorescent polystyrene beads, neurons were incubated with 1 µl of an aqueous suspension containing 2% solids diluted in 1 ml KRH.

Videomicroscopy and Image Analysis

Specimens were viewed with an Axiovert 135 inverted microscope (Zeiss, Oberkochen, Germany) equipped with epifluorescence optics. Images were recorded with a C4742-98 ORCA II cooled charge-coupled device camera (Hamamatsu Photonics, Hamamatsu City, Japan) and processed using Image Pro Plus 4.5 (Media Cybernetics, Silver Spring, MD) and Adobe Photoshop 6.0 (Adobe System, San Jose, CA). For image deconvolution, Z-stacks of optical sections taken with an Olympus IX70 with DeltaVision RT Deconvolution System (Olympus, Hamburg, Germany) were analyzed by the WoRx Deconvolve software (Applied Precision, Issaquah, WA). In order to quantify the FM4-64 signal in individual growth cones, images were acquired at constant parameters of illumination and gain, and the specific fluorescence intensity, calculated by subtracting a fixed fluorescence background level from the total pixel intensity, was measured within the whole growth cone area determined by either differential interference contrast (DIC) or GFP/YFP fluorescence images. One-way ANOVA followed by either Dunnetts's or Tukey's multiple comparison tests were used and p values <0.05 were considered significant.

RESULTS

The axonal growth cone is a site of intense constitutive plasma membrane endocytosis

To study constitutive membrane recycling in the growth cone, we used rat hippocampal neurons at 2–3 days in vitro (DIV) (stage 3; Dotti et al., 1988) displaying an unequivocally identifiable axon tipped with a growth cone. Neurons incubated in basal medium (KRH) were exposed to the styryl dye FM4-64, which binds reversibly to the outer surface of the plasma membrane and is internalized in endocytic vesicles (Betz and Bewick, 1992; Betz et al, 1996) (Fig. 1A). After brief (1 min) incubation, intense fluorescence appeared in 50–70% of growth cones, associated with large structures, often exhibiting a vacuolar organization, clustered at the distal edge of the C domain. In contrast, FM4-64 staining was undetectable in both the lamellar P domain of the growth cone and the axon shaft (Fig. 1A). The axonal specificity of this bulk endocytosis was confirmed by retrospective staining of the neurons with the marker dephospho-Tau1 (Fig 1B). Interestingly, at each axonal branching bulk endocytic accumulation of the dye was typically maintained in only one of the growth cones (Fig. 1C). Intense basal endocytosis in the C domain was also observed in neurons exposed for 1 min to either the membrane-impermeable fluid-phase fluorescent dye lucifer yellow or green fluorescent polystyrene beads, 20 nm in diameter (Fig. 1A). A similar pattern of endocytosis was observed after a 1 min-application of large fluid-phase markers, namely fluorescent beads, 200 nm in diameter, or 40 kDa dextran, which have restricted access to small vesicles (Fig. 1A and data not shown). In growth cones labeled with the 20 nm beads and subsequently exposed to FM4-64, the two tracers displayed largely overlapping patterns of internalization. It should be noted that in dendritic cells dextran and small latex beads (< 100 nm) have been shown to be preferentially internalized via macropinocytosis (Reece et al., 2001; Falcone et al., 2006; see Discussion). Consistently, we observed a partial degree of colocalization with rabankyrin-5, a Rab5 effector that modulates macropinocytosis in non-neuronal cells (Fig. 3D) (Schnatwinkel et al., 2004).

Figure 1
Constitutive bulk membrane retrieval in growth cones is distinct from the endosomal and synaptic vesicle recycling pathways
Figure 3
Bulk endocytosis in the growth cone is linked to membrane ruffling and depends on actin dynamics, PI3-kinase activity and cholesterol levels

The C domain of the growth cone is characterized by high density of organelles, including endosomes and SVs. In order to investigate the possible involvement of these vesicles in bulk endocytosis we carried out retrospective staining of FM4-64-loaded growth cones with the SV marker synaptobrevin 2/vesicle-associated membrane protein 2 (VAMP2) or the endosomal marker syntaxin13. In either case, virtually no colocalization with the compartments of constitutive plasma membrane uptake was observed (Fig. 1D).

The fast, efficient uptake of 200 nm-diameter beads was suggestive of a clathrin-independent endocytic pathway (Rejman et al. 2004). To test this possibility, we performed an RNAi-mediated clathrin heavy chain (CHC) knock-down (Lampugnani et al. 2006, Granseth et al. 2006) in cells later exposed to FM4-64 uptake (Fig. 2A,B). Effective down regulation of CHC, as assessed by retrospective immunofluorescence of growth cones, did not affect FM4-64 uptake, indicating that the bulk plasma membrane retrieval was indeed clathrin-independent. Consistently, Alexa488-conjugated transferrin, a marker of receptor-mediated, clathrin-dependent endocytosis, was internalized into endosomes in the cell body but not in the compartments of bulk FM4-64 uptake in the growth cone (Fig. 2C).

Figure 2
Inhibition of clathrin-mediated endocytosis does not impair bulk plasma membrane retrieval

Constitutive FM4-64 uptake was prevented by incubation of neurons at 4° C, a treatment which attenuates endocytic processes. In contrast, it was apparently unaffected by prolonged (30 min) incubation of neurons in Ca2+-free KRH, a maneuver leading to depletion of intracellular Ca2+ stores (Cohen and Fields, 2006), and by a 1 h incubation in the presence of BFA, an ADP-ribosylation factor-1 inhibitor that prevents traffic from the Golgi complex (Lippincott-Schwartz et al., 1989; Miller et al.,1992) and blocks axon growth (Jareb and Banker, 1997) (Fig. 3A,C). FM4-64 internalized for 1 min at rest was progressively released during 30 min washing (Fig. 3C and Fig. 5). In some instances, we obtained evidence for retrograde transport of dye-containing organelles along the axon (Supplementary Fig. 1). We conclude that, at early developmental stages, a rapid constitutive process of bulk plasma membrane internalization, independent of the SV and coated vesicle recycling, is associated with the axonal growth cone.

Figure 5
The pathway of bulk membrane retrieval is distinct from the pathway of cholera toxin internalization

Constitutive plasma membrane endocytosis takes place at the sites of membrane ruffling and depends on F-actin, cholesterol and phosphatidylinositol-3 kinase

Time-lapse DIC imaging of growth cones of stage 3 neurons exposed to FM4-64 in KRH for 1 min revealed a tight correlation between the sites of bulk constitutive endocytosis and the sites of plasma membrane ruffling, which is particularly intense in the T domain (see also Forscher et al., 1992; Schaefer et al., 2002) (Fig. 3B).

In the T zone, the compartments of bulk FM4-64 uptake overlapped with F-actin rich ruffling hotspots (Fig. 3E). F-actin disruption by cytochalasin D, which impairs the addition of actin monomers to filaments, significantly reduced basal FM4-64 uptake, indicating that actin polymerization is required for constitutive plasma membrane retrieval in the growth cone (Fig. 3A,C).

Phosphatidylinositol (PI) 3-kinase is localized at the tip of newly specified axons of stage 3 neurons (Shi et al., 2003). In other cell types this enzyme has been implicated in high-volume endocytosis (Lindmo and Stenmark, 2006). Application of the selective PI 3-kinase inhibitor, LY294002, significantly reduced constitutive FM4-64 uptake (Fig. 3A,C).

Staining of neurons with filipin, a fluorescent marker of cholesterol, revealed an enrichment of this lipid in the C domain, partially overlapping with the compartments of bulk FM4-64 internalization (Fig. 3F). Acute (3 min) cholesterol extraction with MβCD drastically affected FM4-64 uptake in the growth cones (Fig. 3A,C).

F-actin disruption, PI 3-kinase inhibition and cholesterol depletion also inhibited the constitutive internalization of 20 nm beads in the growth cone. Bead uptake was recovered 30 min after MβCD washout, in parallel to the normalization of cholesterol levels (Supplementary Fig. 2).

Selectivity of bulk endocytosis

We investigated whether at the growth cone bulk endocytosis mediated unselective internalization of plasma membrane proteins. Growth cones loaded with FM4-64 during a 1 min-incubation in resting solution were immediately fixed and retrospectively stained for Trk, L1, β1 integrin or APP, four proteins that undergo recycling at the axonal plasma membrane (Yamazaki et al., 1995; Condic and Letourneau, 1997; Kamiguchi and Lemmon, 2000; Chen et al., 2005) (Fig 4). None of these membrane proteins colocalized with the FM4-64-positive compartments.

Figure 4
Exclusion of membrane proteins from bulk endocytosis

Next, we monitored over time the internalization of FM4-64 applied to the same growth cone together with another marker, Alexa488-conjugated cholera toxin B subunit (CTB), which binds the lipid raft component ganglioside GM1 (Fig. 5). In other cell types CTB is internalized via clathrin-coated pits, caveolae (Torgersen et al., 2001) or clathrin-independent pathways (Kirkham et al., 2005). After a 1 min-incubation, when FM4-64 was already internalized in large compartments at the T domain of the growth cone, CTB was still associated with the plasma membrane. During the following 30 min, fluorescent CTB was redistributed into puncta, most probably corresponding to endocytic vesicles enriched at the T domain. At no time points did the pattern of CTB overlap with the FM4-64-positive compartments. These results document the existence, at the growth cone, of one (or more) sorting processes which exclude most specific plasma membrane components from the bulk endocytic organelles.

Rac1 controls bulk plasma membrane retrieval in the growth cone

Rac1 has been implicated in the stimulation of membrane ruffling and bulk fluid-phase uptake (i.e., macropinocytosis) in non-neuronal cells (Symons and Rusk, 2003). Thus, we reasoned that Rac1 might participate in the process of constitutive plasma membrane internalization in the growth cone. Neurons coexpressing soluble YFP and FLAG-tagged either constitutively active or dominant negative versions of Rac1 (Rac1-N17 and Rac1-V17, respectively) were exposed to FM4-64 in basal medium. The expression of Rac1 mutants in YFP-positive cells was confirmed by retrospective staining with anti- FLAG antibody. Remarkably, expression of dominant-negative Rac1 dramatically impaired bulk FM4-64 uptake in growth cones. In contrast, the constitutively active Rac1 form did not affect FM4-64 internalization compared to control growth cones expressing only soluble YFP (Fig. 6 and Supplementary Fig. 3). Of note, dye loading into smaller endocytic organelles was not prevented by Rac1-N17 expression. Rac1-N17 expression led to a reduction in growth cone size, which could result from a combined action of this protein on the actin cytoskeleton and membrane trafficking (see also Kuhn et al., 1998; Ruchhoeft et al., 1999; Woo and Gomez, 2006).

Figure 6
Rac1 activity is required for bulk plasma membrane endocytosis in the growth cones

Constitutive bulk plasma membrane endocytosis is regulated by Pincher

Pincher is the first regulator of a recently described process of macroendocytosis that underlies ligandinduced internalization and signaling of neurotrophin receptors (Shao et al., 2002; Valdez et al., 2005; Valdez et al., 2007). The involvement of Pincher in constitutive bulk plasma membrane retrieval in the growth cone was studied by infecting neurons with adenoviruses independently driving expression of GFP and HA-tagged either wild-type or dominant-negative Pincher (Valdez et al., 2005). In a first set of experiments aimed at determining the localization of Pincher in the growth cone, we expressed the exogenous proteins at low levels by reducing both virus concentration and infection times. Infected neurons were exposed for 1 min to FM4-64 in resting medium and stained with anti-HA antibody to detect either HA-Pincher or HA-Pincher G68E (Fig. 7A). Pincher showed a partial colocalization with the compartments of FM4-64 uptake. Similar results were obtained when constitutive endocytosis was assayed in HA-Pincher-expressing growth cones by internalization of fluorescent beads (Fig. 7B). In contrast, Pincher G68E displayed a diffuse distribution throughout the growth cone, likely resulting from its irreversible binding to the plasma membrane (Shao et al., 2002; Fig. 7A). Next, we increased the expression levels of Pincher or Pincher G68E. In growth cones overexpressing either wild-type or the G68E Pincher mutant the constitutive FM4-64 uptake was prevented compared to either uninfected neurons used as an internal control (Fig. 7C) or neurons infected with adenoviruses expressing only GFP (Fig. 7D,E). As observed with Rac1-N17, smaller endocytic organelles were still loaded with FM4-64 upon overexpression of wild-type/G68E Pincher (Fig. 7D), pointing to the coexistence of at least two mechanistically distinct pathways of constitutive endocytosis in the growth cones.

Figure 7
The marker of neuronal macroendocytosis Pincher regulates constitutive plasma membrane retrieval at the growth come

Developmental control of plasma membrane endocytosis in the axonal growth cone

To investigate the development-related changes in the membrane recycling properties at growth cones, we took advantage of the stereotyped and well-characterized sequence of events followed by hippocampal neurons differentiating in culture (Dotti et al., 1988). The effects on growth cone endocytosis of a depolarizing solution (55 mM KCl) were first investigated at early stages of neuronal differentiation (3 DIV). Growth cones were loaded for 1 min with FM4-64 in basal medium and subsequently exposed for an additional min to a high K+-containing solution devoid of FM4-64 prior to fixation and staining for VAMP2 (Fig. 8A). K+ application neither elicited unloading of the dye nor promoted membrane transfer from the compartments of bulk endocytosis to the SV recycling pathway, as indicated by the lack of FM4-64 in the VAMP2-positive SVs. In a second set of experiments, neurons infected with lentiviruses expressing ECFP-tagged VAMP2 (ECFP-VAMP2) were stimulated with high K+ for 1 min in the presence of FM4-64. The intensity and pattern of FM4-64 fluorescence after depolarization was remarkably similar to the pattern observed at this stage after constitutive uptake of the dye, being associated with large structures at the distal area of the C domain (Fig. 3Cand Fig. 8B, compare with Fig. 1). Importantly, also in this case no ECFP-VAMP2-positive SVs were labeled by the dye. These results indicate that at early developmental stages both bulk plasma membrane endocytosis and SV recycling are insensitive to depolarizing stimuli.

Figure 8
Plasma membrane endocytosis in growth cones at early developmental stages is insensitive to depolarizing stimuli

Growth cones of ECFP-VAMP2-expressing neurons at 4–5 DIV (stage 4, characterized by prominent dendrite outgrowth; Dotti et al., 1988) were incubated in KRH containing FM4-64 for 1 min. After a 15 min interval in basal medium (to unload the internalized dye) followed by photobleaching of the residual fluorescence, the neurons were exposed for 1 min to a high K+-containing solution containing FM4-64. The same growth cones where, under resting conditions, uptake FM4-64 occurred via bulk plasma membrane internalization separate from SV recycling, after application of the depolarizing stimulus displayed a punctate pattern selectively associated with endocytosis of VAMP2-positive SVs (Fig. 9A). Remarkably, bulk endocytosis ceased in growth cones during depolarizing stimuli which induced SV recycling.

Figure 9
Developmental control of endocytic activities in the growth cone

Neurons at 7 DIV display a complex dendritic arbor and a long axon with various branches (stage 5: full maturation; Dotti et al., 1988). Typically, the growth cone associated with the main axonal process has already encountered several potential targets, and synaptic contacts have started to be established. Moreover, at this developmental stage the distinctive morphological compartmentalization and dynamics of growth cones are less obvious (our unpublished observations). Upon 1 min exposure of 7 DIV neurons to KRH containing FM4-64, the axonal growth cone was largely devoid of FM4-64 labeling, whereas the dye was internalized throughout the soma and neuronal arborization in punctuate endocytic structures not overlapping with synaptic terminals (Fig. 9B and data not shown). When neurons at 7 DIV were exposed to FM4-64 during a 1 min depolarization with high K+, the dye was loaded in ECFP-VAMP2-positive SVs at both growth cones and synapses (Fig. 9C and data not shown).

The extent of the developmental suppression of bulk membrane retrieval was measured in neurons at 3, 5 and 7 DIV exposed to FM4-64 in basal medium (1 min) and subsequently depolarized to exclude any contribution of activity-dependent endocytic pathways. These studies showed that bulk constitutive plasma membrane retrieval associated with growth cones is progressively down-regulated during neuronal differentiation (Fig. 9D and Fig. 10). In addition, SVs, which appear to be reluctant to undergo both spontaneous and evoked exo-endocytosis at early developmental stages, become competent for depolarization-induced recycling at later stages.

Figure 10
Developmental changes in the endocytic properties of the growth cone

DISCUSSION

In this study we identify a novel process of bulk plasma membrane retrieval as the main pathway of constitutive endocytosis in growth cones at early stages of neuronal differentiation. Neither the classical endosomal system nor SVs participate in high-volume endocytosis of the growth cone plasmalemma, which involves large compartments associated with sites of intense actin-based membrane ruffling. Our results provide an explanation for the previous identification of the growth cone as the major site of axonal endocytosis (Sinclair et al., 1988; Parton et al., 1992; Zakharenko and Popov, 2000; Pfenninger and Maylié-Pfenninger, 1981; Cheng and Reese, 1987). In addition, we have shown that basal endocytosis at the growth cone is subjected to developmental control, being down regulated at the onset of synaptogenesis, concomitantly with the appearance of depolarization-induced SV recycling.

Constitutive membrane retrieval in the growth cone appears to be mechanistically related to macropinocytosis, a form of high-volume, clathrin-independent endocytosis described in various cell types and particularly well-characterized in macrophages and dendritic cells (Swanson and Watts, 1995; Johannes and Lamaze, 2002; Kirkham and Parton, 2005). Macropinosomes are generated when membrane protrusions that form during actin-based ruffling fuse back with the plasma membrane trapping fluid-phase material. Striking similarities between bulk membrane retrieval in the growth cone and macropinocytosis include the association with membrane ruffling, the involvement of pleiomorphic endocytic structures of large size, the dependence on actin dynamics, the requirement of PI3-kinase activity, the sensitivity to cholesterol depletion, and the involvement of the small GTPase Rac1 (Swanson and Watts, 1995; Johannes and Lamaze, 2002; Kirkham and Parton, 2005; Lindmo and Stenmark, 2006). In the growth cone, the role of PI3-kinase and Rac1 in bulk plasma membrane retrieval is plausibly linked to the remodeling of the subcortical actin cytoskeleton, controlled by PI3-kinase via PI(3,4,5)P3 effectors, including the small GTPases Rac1, Cdc42 and Arf6 (Govek et al., 2005; Lindmo and Stenmark, 2006). Yet, the compartments of bulk endocytosis in the growth cone do not overlap with the distribution of GM1, which is enriched in macropinosomes in non-neuronal cells (Watarai et al, 2001), and show only partial colocalization with rabankyrin-5 (Schnatwinkel et al., 2004). Of note, various integral proteins of the growth cone plasma membrane are excluded from bulk endocytosis, in analogy with the sorting process that accompanies macropinosome formation (Mercanti et al., 2006). Sorting is conceivably required to preserve the specific composition of both the plasma membrane and intracellular compartments.

Our results extend the role of the chaperone Pincher to the control of constitutive membrane retrieval at the growth cone. Pincher mediates ligand-stimulated, clathrin-independent endocytosis of neurotrophin receptors through macroendosomes generated at sites of plasma membrane ruffling (Shao et al., 2002; Valdez et al., 2005 and 2007). Overexpression of either wild-type or dominant-negative Pincher interfered with bulk FM4-64 uptake. It is possible that the effect of high doses of wild-type Pincher reflects the exhaustion of basal endocytic activity following an early phase of accelerated membrane retrieval that might have escaped detection in our assay.

During development, an intrinsic program of maturation appears to contribute to changing the endocytic properties of growth cones (Fig. 10). Remarkably, depolarization of mature (stage 4) growth cones induces selective internalization of the dye in SVs but not in the large compartments labeled at rest. This situation is reminiscent of the spatial and temporal dissociation between bulk compensatory endocytosis and SV recycling previously reported at the ribbon synapse of retinal bipolar cells (Holt et al., 2003). While the switch in the sensitivity of growth cones to depolarization is likely to reflect developmental changes in the Ca2+-sensing apparatus (Pravettoni et al., 2000; Menegon et al., 2002), dissociation of basal bulk endocytosis from depolarization-induced SV endocytosis could represent a way to uncouple major rearrangements of the plasma membrane from ongoing SV recycling, thus preserving the molecular identity of the SV pool. Indeed, both bulk membrane endocytosis and SV recycling take place preferentially in the T zone of growth cones (Bonanomi et al., 2005).

The mechanism(s) targeted to occlude bulk membrane retrieval in mature neurons is (are) unknown. One attractive possibility is that during synaptogenesis spontaneous network activity generates ‘maturation’ signals that locally repress the PI3-kinase/Rac1/F-actin machinery in the growth cone. This control may be exerted at different levels, for instance involving guanine-nucleotide exchange factors (GEFs) and/or GTPase activating proteins (GAPs), which tune Rac1 activity. A similar working model might explain the effect of depolarization on isolated stage 4 growth cones. At this stage growth cones, which appear to have already acquired the molecular apparatus to sense developmental signals and repress bulk uptake, still lack actual maturation inputs from the forming network. Interestingly, constitutive macropinocytosis, which is down regulated in mature dendritic cells that have initiated the processing of an acquired antigen, can be restored upon expression of active forms of Rac and Cdc42 (Garrett et al., 2000). In an alternative model, during neuronal differentiation bulk membrane retrieval might be replaced by selective retrieval directed by factors, such as the neurotrophins, via a similar Rac- and Pincher-dependent pathway (Valdez et al., 2007).

What is the role of constitutive bulk membrane retrieval in the growth cone? The absence of specific molecular markers and regulators hampers selective experimental manipulations of this endocytic pathway. The most parsimonious view is that the continuous uptake of plasma membrane via a high-volume/high-capacity pathway counterbalances the addition of new membrane at the axon tip, required for axon outgrowth, keeping the growth cone in a highly dynamic state necessary for navigation and response to attractive/repulsive cues. However, FM4-64 uptake is not affected by prolonged incubation of neurons in the presence of BFA, which arrests trafficking of Golgi-derived vesicles and axon elongation but not growth cone motility (Craig et al., 1995; Jareb and Banker, 1997). Hence, bulk constitutive endocytosis appears to reflect a local recycling activity of the growth cone, which can occur independently of the supply of new membrane from the cell body, contributing to homeostasis of the axonal plasma membrane.

The bulk endocytic process described in this study might provide the growth cone with a reservoir of ready-to-use membrane to be added to the cell surface to rapidly reconfigure and update the plasma membrane make-up during pathfinding and establishment of contacts with targets. In addition, it is possible that such bulk endocytosis enables the growth cone to sample extracellular proteins in a non-specific fashion to be retrogradely transported to the cell body (von Bartheld, 2004). As growth cones undergo constant morphological remodeling during guidance and target recognition (Mason and Erskine, 2000), and the axonal sensor apparatus needs continuous renewal by insertion and removal of proteins to adjust its sensitivity to environmental cues (Vogt et al., 1996; van Horck et al., 2004), the new membrane retrieval pathway described here may power a highly efficient membrane remodeling mechanism that can be essential during the early stages of neural development.

Supplementary Material

01

ACKNOWLEDGMENTS

We wish to thank Drs. Ivan de Curtis and Jacopo Meldolesi (S. Raffaele Scientific Institute/Vita-Salute University, Milano, Italy) for critical reading of the manuscript. We also thank Dr. Lorena Zentilin and the Telethon AVU Core Facility for the generous gift of the GFP-adeno-associated virus and Dr. Ivan de Curtis for the Rac1 constructs. This work was supported by grants from the Italian Ministry of University (Cofin 2005 and 2006 to F.V. and F.B., respectively), from the CARIPLO Foundation and the Mariani Foundation for Infantile Neurology (to F.V. and F.B). The financial support of Telethon-Italy (grant n. GGP05134 to F.B and F.V.) is gratefully acknowledged.

REFERENCES

  • Ahmari SE, Buchanan J, Smith SJ. Assembly of presynaptic active zones from cytoplasmic transport packets. Nat. Neurosci. 2000;3:445–451. [PubMed]
  • Albertinazzi C, Gilardelli D, Paris S, Longhi R, de Curtis I. Overexpression of a neural-specific rho family GTPase, cRac1B, selectively induces enhanced neuritogenesis and neurite branching in primary neurons. J. Cell Biol. 1998;142:815–825. [PMC free article] [PubMed]
  • Albertinazzi C, Za L, Paris S, de Curtis I. ADP-ribosylation factor 6 and a functional PIX/p95-APP1 complex are required for Rac1B-mediated neurite outgrowth. Mol. Biol. Cell. 2003;14:1295–1307. [PMC free article] [PubMed]
  • Ashery U, Penner R, Spira ME. Acceleration of membrane recycling by axotomy of cultured aplysia neurons. Neuron. 1996;16:641–651. [PubMed]
  • Banker GA, Cowan WM. Rat hippocampal neurons in dispersed cell culture. Brain Res. 1977;126:397–342. [PubMed]
  • Betz WJ, Bewick GS. Optical analysis of synaptic vesicle recycling at the frog neuromuscular junction. Science. 1992;255:200–203. [PubMed]
  • Betz WJ, Mao F, Smith CB. Imaging exocytosis and endocytosis. Curr. Opin. Neurobiol. 1996;6:365–371. [PubMed]
  • Bonanomi D, Benfenati F, Valtorta F. Protein sorting in the synaptic vesicle life cycle. Prog. Neurobiol. 2006 [PubMed]
  • Bonanomi D, Menegon A, Miccio A, Ferrari G, Corradi A, Kao HT, Benfenati F, Valtorta F. Phosphorylation of synapsin I by cAMP-dependent protein kinase controls synaptic vesicle dynamics in developing neurons. J. Neurosci. 2005;25:7299–7308. [PubMed]
  • Bray D. Surface movements during the growth of single explanted neurons. Proc. Natl. Acad. Sci. U. S. A. 1970;65:905–910. [PMC free article] [PubMed]
  • Chen ZY, Ieraci A, Tanowitz M, Lee FS. A novel endocytic recycling signal distinguishes biological responses of trk neurotrophin receptors. Mol. Biol. Cell. 2005;16:5761–5772. [PMC free article] [PubMed]
  • Cheng TP, Reese TS. Polarized compartmentalization of organelles in growth cones from developing optic tectum. J. Cell Biol. 1985;101:1473–1480. [PMC free article] [PubMed]
  • Cheng TP, Reese TS. Recycling of plasmalemma in chick tectal growth cones. J. Neurosci. 1987;7:1752–1759. [PubMed]
  • Chow I, Poo MM. Release of acetylcholine from embryonic neurons upon contact with muscle cell. J. Neurosci. 1985;5:1076–1082. [PubMed]
  • Cohen JE, Fields RD. CaMKII inactivation by extracellular ca(2+) depletion in dorsal root ganglion neurons. Cell Calcium. 2006;39:445–454. [PMC free article] [PubMed]
  • Condic ML, Letourneau PC. Ligand-induced changes in integrin expression regulate neuronal adhesion and neurite outgrowth. Nature. 1997;389:853–856. [PubMed]
  • Craig AM, Wyborski RJ, Banker G. Preferential addition of newly synthesized membrane protein at axonal growth cones. Nature. 1995;375:592–594. [PubMed]
  • Dailey ME, Bridgman PC. Dynamics of the endoplasmic reticulum and other membranous organelles in growth cones of cultured neurons. J. Neurosci. 1989;9:1897–1909. [PubMed]
  • Dent EW, Gertler FB. Cytoskeletal dynamics and transport in growth cone motility and axon guidance. Neuron. 2003;40:209–227. [PubMed]
  • Diefenbach TJ, Guthrie PB, Stier H, Billups B, Kater SB. Membrane recycling in the neuronal growth cone revealed by FM1-43 labeling. J. Neurosci. 1999;19:9436–9444. [PubMed]
  • Dotti CG, Sullivan CA, Banker GA. The establishment of polarity by hippocampal neurons in culture. J. Neurosci. 1988;8:1454–1468. [PubMed]
  • Falcone S, Cocucci E, Podini P, Kirchhausen T, Clementi E, Meldolesi J. Macropinocytosis: Regulated coordination of endocytic and exocytic membrane traffic events. J. Cell. Sci. 2006;19:4758–4769. [PubMed]
  • Fletcher TL, Cameron P, De Camilli P, Banker G. The distribution of synapsin I and synaptophysin in hippocampal neurons developing in culture. J. Neurosci. 1991;11:1617–1626. [PubMed]
  • Forscher P, Lin CH, Thompson C. Novel form of growt h cone motility involving site-directed actin filament assembly. Nature. 1992;357:515–518. [PubMed]
  • Forscher P, Smith SJ. Actions of cytochalasins on the organization of actin filaments and microtubules in a neuronal growth cone. J. Cell Biol. 1988;107:1505–1516. [PMC free article] [PubMed]
  • Fournier AE, Nakamura F, Kawamoto S, Goshima Y, Kalb RG, Strittmatter SM. Semaphorin3A enhances endocytosis at sites of receptor-F-actin colocalization during growth cone collapse. J. Cell Biol. 2000;149:411–422. [PMC free article] [PubMed]
  • Garrett WS, Chen LM, Kroschewski R, Ebersold M, Turley S, Trombetta S, Galan JE, Mellman I. Developmental control of endocytosis in dendritic cells by Cdc42. Cell. 2000;102:325–334. [PubMed]
  • Govek EE, Newey SE, Van Aelst L. The role of the rho GTPases in neuronal development. Genes Dev. 2005;19:1–49. [PubMed]
  • Granseth B, Odermatt B, Royle SJ, Lagnado L. Clathrin-mediated endocytosis is the dominant mechanism of vesicle retrieval at hippocampal synapses. Neuron. 2006;51:773–786. [PubMed]
  • Holt M, Cooke A, Wu MM, Lagnado L. Bulk membrane retrieval in the synaptic terminal of retinal bipolar cells. J. Neurosci. 2003;23:1329–1339. [PubMed]
  • Jareb M, Banker G. Inhibition of axonal growth by brefeldin A in hippocampal neurons in culture. J. Neurosci. 1997;17:8955–8963. [PubMed]
  • Johannes L, Lamaze C. Clathrin-dependent or not: Is it still the question? Traffic. 2002;3:443–451. [PubMed]
  • Jurney WM, Gallo G, Letourneau PC, McLoon SC. Rac1-mediated endocytosis during ephrin-A2- and semaphorin 3A-induced growth cone collapse. J. Neurosci. 2002;22:6019–6028. [PubMed]
  • Kamiguchi H, Lemmon V. Recycling of the cell adhesion molecule L1 in axonal growth cones. J. Neurosci. 2000;20:3676–3686. [PMC free article] [PubMed]
  • Kim YT, Wu CF. Reversible blockage of neurite development and growth cone formation in neuronal cultures of a temperature-sensitive mutant of drosophila. J. Neurosci. 1987;7:3245–3255. [PubMed]
  • Kirkham M, Fujita A, Chadda R, Nixon SJ, Kurzchalia TV, Sharma DK, Pagano RE, Hancock JF, Mayor S, Parton RG. Ultrastructural identification of uncoated caveolin-independent early endocytic vehicles. J. Cell Biol. 2005;168:465–476. [PMC free article] [PubMed]
  • Kirkham M, Parton RG. Clathrin-independent endocytosis: New insights into caveolae and non-caveolar lipid raft carriers. Biochim. Biophys. Acta. 2005;1745:273–286. [PubMed]
  • Kuhn TB, Brown MD, Bamburg JR. Rac1-dependent actin filament organization in growth cones is necessary for beta1-integrin-mediated advance but not for growth on poly-D-lysine. J. Neurobiol. 1998;37:524–540. [PubMed]
  • Lampugnani MG, Orsenigo F, Gagliani MC, Tacchetti C, Dejana E. Vascular endothelial cadherin controls VEGFR-2 internalization and signaling from intracellular compartments. J. Cell Biol. 2006;174:593–604. [PMC free article] [PubMed]
  • Leoni C, Menegon A, Benfenati F, Toniolo D, Pennuto M, Valtorta F. Neurite extension occurs in the absence of regulated exocytosis in PC12 subclones. Mol. Biol. Cell. 1999;10:2919–2931. [PMC free article] [PubMed]
  • Lindmo K, Stenmark H. Regulation of membrane traffic by phosphoinositide 3-kinases. J. Cell. Sci. 2006;119:605–614. [PubMed]
  • Lippincott-Schwartz J, Yuan LC, Bonifacino JS, Klausner RD. Rapid redistribution of golgi proteins into the ER in cells treated with brefeldin A: Evidence for membrane cycling from golgi to ER. Cell. 1989;56:801–813. [PubMed]
  • Lockerbie RO, Miller VE, Pfenninger KH. Regulated plasmalemmal expansion in nerve growth cones. J. Cell Biol. 1991;112:1215–1227. [PMC free article] [PubMed]
  • Mason C, Erskine L. Growth cone form, behavior, and interactions in vivo: Retinal axon pathfinding as a model. J. Neurobiol. 2000;44:260–270. [PubMed]
  • Matteoli M, Coco S, Schenk U, Verderio C. Vesicle turnover in developing neurons: How to build a presynaptic terminal. Trends Cell Biol. 2004;14:133–140. [PubMed]
  • Menegon A, Verderio C, Leoni C, Benfenati F, Czernik AJ, Greengard P, Matteoli M, Valtorta F. Spatial and temporal regulation of Ca2+/calmodulin-dependent protein kinase II activity in developing neurons. J. Neurosci. 2002;22:7016–7026. [PubMed]
  • Mercanti V, Charette SJ, Bennett N, Ryckewaert JJ, Letourneur F, Cosson P. Selective membrane exclusion in phagocytic and macropinocytic cups. J. Cell. Sci. 2006;119:4079–4087. [PubMed]
  • Miller SG, Carnell L, Moore HH. Post-golgi membrane traffic: Brefeldin A inhibits export from distal golgi compartments to the cell surface but not recycling. J. Cell Biol. 1992;118:267–283. [PMC free article] [PubMed]
  • Mundigl O, Ochoa GC, David C, Slepnev VI, Kabanov A, De Camilli P. Amphiphysin I antisense oligonucleotides inhibit neurite outgrowth in cultured hippocampal neurons. J. Neurosci. 1998;18:93–103. [PubMed]
  • Parton RG, Simons K, Dotti CG. Axonal and dendritic endocytic pathways in cultured neurons. J. Cell Biol. 1992;119:123–137. [PMC free article] [PubMed]
  • Pfenninger KH, Maylie-Pfenninger MF. Lectin labeling of sprouting neurons. II. relative movement and appearance of glycoconjugates during plasmalemmal expansion. J. Cell Biol. 1981;89:547–559. [PMC free article] [PubMed]
  • Pravettoni E, Bacci A, Coco S, Forbicini P, Matteoli M, Verderio C. Different localizations and functions of L-type and N-type calcium channels during development of hippocampal neurons. Dev. Biol. 2000;227:581–594. [PubMed]
  • Reece JC, Vardaxis NJ, Marshall JA, Crowe SM, Cameron PU. Uptake of HIV and latex particles by fresh and cultured dendritic cells and monocytes. Immunol. Cell Biol. 2001;79:255–263. [PubMed]
  • Rejman J, Oberle V, Zuhorn IS, Hoekstra D. Size-dependent internalization of particles via the pathways of clathrin- and caveolae-mediated endocytosis. Biochem. J. 2004;377:159–169. [PMC free article] [PubMed]
  • Ruchhoeft ML, Ohnuma S, McNeill L, Holt CE, Harris WA. The neuronal architecture of xenopus retinal ganglion cells is sculpted by rho-family GTPases in vivo. J. Neurosci. 1999;19:8454–8463. [PubMed]
  • Schaefer AW, Kabir N, Forscher P. Filopodia and actin arcs guide the assembly and transport of two populations of microtubules with unique dynamic parameters in neuronal growth cones. J. Cell Biol. 2002;158:139–152. [PMC free article] [PubMed]
  • Schnatwinkel C, Christoforidis S, Lindsay MR, Uttenweiler-Joseph S, Wilm M, Parton RG, Zerial M. The Rab5 effector rabankyrin-5 regulates and coordinates different endocytic mechanisms. PLoS Biol. 2004;2:E261. [PMC free article] [PubMed]
  • Shao Y, Akmentin W, Toledo-Aral JJ, Rosenbaum J, Valdez G, Cabot JB, Hilbush BS, Halegoua S. Pincher, a pinocytic chaperone for nerve growth factor/TrkA signaling endosomes. J. Cell Biol. 2002;157:679–691. [PMC free article] [PubMed]
  • Shi SH, Jan LY, Jan YN. Hippocampal neuronal polarity specified by spatially localized mPar3/mPar6 and PI 3-kinase activity. Cell. 2003;112:63–75. [PubMed]
  • Sinclair GI, Baas PW, Heidemann SR. Role of microtubules in the cytoplasmic compartmentation of neurons. II. endocytosis in the growth cone and neurite shaft. Brain Res. 1988;450:60–68. [PubMed]
  • Swanson JA, Watts C. Macropinocytosis. Trends Cell Biol. 1995;5:424–428. [PubMed]
  • Symons M, Rusk N. Control of vesicular trafficking by rho GTPases. Curr. Biol. 2003;13:R409–R418. [PubMed]
  • Torgersen ML, Skretting G, van Deurs B, Sandvig K. Internalization of cholera toxin by different endocytic mechanisms. J. Cell. Sci. 2001;114:3737–3747. [PubMed]
  • Torre E, McNiven MA, Urrutia R. Dynamin 1 antisense oligonucleotide treatment prevents neurite formation in cultured hippocampal neurons. J. Biol. Chem. 1994;269:32411–32417. [PubMed]
  • Tsui HC, Ris H, Klein WL. Ultrastructural networks in growth cones and neuritis of cultured central nervous system neurons. Proc. Natl. Acad. Sci. U. S. A. 1983;80:5779–5783. [PMC free article] [PubMed]
  • Valdez G, Akmentin W, Philippidou P, Kuruvilla R, Ginty DD, Halegoua S. Pincher-mediated macroendocytosis underlies retrograde signaling by neurotrophin receptors. J. Neurosci. 2005;25:5236–5247. [PubMed]
  • Valdez G, Philippidou P, Rosenbaum J, Akmentin W, Shao Y, Halegoua S. Trk-signaling endosomes are generated by rac-dependent macroendocytosis. Proc. Natl. Acad. Sci. U. S. A. 2007;104:12270–12275. [PMC free article] [PubMed]
  • van Horck FP, Weinl C, Holt CE. Retinal axon guidance: Novel mechanisms for steering. Curr. Opin. Neurobiol. 2004;14:61–66. [PMC free article] [PubMed]
  • Verhage M, Maia AS, Plomp JJ, Brussaard AB, Heeroma JH, Vermeer H, Toonen RF, Hammer RE, van den Berg TK, Missler M, et al. Synaptic assembly of the brain in the absence of neurotransmitter secretion. Science. 2000;287:864–869. [PubMed]
  • Vogt L, Giger RJ, Ziegler U, Kunz B, Buchstaller A, Hermens WTJMC, Kaplitt MG, Rosenfeld MR, Pfaff DW, Verhaagen J, et al. Continuous renewal of the axonal pathway sensor apparatus by insertion of new sensor molecules into the growth cone membrane. Curr. Biol. 1996;6:1153–1158. [PubMed]
  • von Bartheld CS. Axonal transport and neuronal transcytosis of trophic factors, tracers, and pathogens. J. Neurobiol. 2004;58:295–314. [PubMed]
  • Watarai M, Derre I, Kirby J, Growney JD, Dietrich WF, Isberg RR. Legionella pneumophila is internalized by a macropinocytotic uptake pathway controlled by the Dot/Icm system and the mouse Lgn1 locus. J. Exp. Med. 2001;194:1081–1096. [PMC free article] [PubMed]
  • Woo S, Gomez TM. Rac1 and RhoA promote neurite outgrowth through formation and stabilization of growth cone point contacts. J. Neurosci. 2006;26:1418–1428. [PubMed]
  • Yamada KM, Spooner BS, Wessells NK. Ultrastructure and function of growth cones and axons of cultured nerve cells. J. Cell Biol. 1971;49:614–635. [PMC free article] [PubMed]
  • Yamazaki T, Selkoe DJ, Koo EH. Trafficking of cell surface beta-amyloid precursor protein: Retrograde and transcytotic transport in cultured neurons. J. Cell Biol. 1995;129:431–442. [PMC free article] [PubMed]
  • Zakharenko S, Popov S. Plasma membrane recycling and flow in growing neurites. Neuroscience. 2000;97:185–194. [PubMed]
  • Zentilin L, Marcello A, Giacca M. Involvement of cellular double-stranded DNA break binding proteins in processing of the recombinant adeno-associated virus genome. J. Virol. 2001;75:12279–12287. [PMC free article] [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...