|
|
J Cell Sci. 2009 April 1; 122(7): 937–946. Published online 2009 March 3. doi: 10.1242/jcs.034793. | PMCID: PMC2720929 |
KRAB zinc-finger proteins localise to novel KAP1-containing foci that are
adjacent to PML nuclear bodies Stephanie Briers,* Catherine Crawford,* Wendy A. Bickmore, and Heidi G. Sutherland‡ MRC Human Genetics Unit, Institute of Genetics and Molecular Medicine, University of Edinburgh, Crewe Road, Edinburgh EH4 2XU, UK Accepted November 19, 2008. The KRAB-zinc finger proteins (KRAB-ZFPs) represent a very large, but
poorly understood, family of transcriptional regulators in mammals. They are
thought to repress transcription via their interaction with KRAB-associated
protein 1 (KAP1), which then assembles a complex of chromatin modifiers to lay
down histone marks that are associated with inactive chromatin. Studies of
KRAB-ZFP/KAP1-mediated gene silencing, using reporter constructs and
ectopically expressed proteins, have shown colocalisation of both KAP1 and
repressed reporter target genes to domains of constitutive heterochromatin in
the nucleus. However, we show here that although KAP1 does indeed become
recruited to pericentric heterochromatin during differentiation of mouse
embryonic stem (ES) cells, endogenous KRAB-ZFPs do not. Rather, KRAB-ZFPs and
KAP1 relocalise to novel nucleoplasmic foci that we have termed KRAB- and
KAP1-associated (KAKA) foci. HP1s can also concentrate in these foci and there
is a close spatial relationship between KAKA nuclear foci and PML nuclear
bodies. Finally, we reveal differential requirements for the recruitment of
KAP1 to pericentric heterochromatin and KAKA foci, and suggest that KAKA foci
may contain sumoylated KAP1 – the form of the protein that is active in
transcriptional repression. Keywords: Chromatin, Heterochromatin, Histone methylation, HP1, Nuclear organisation, Transcriptional repression Zinc-finger proteins (ZFPs) that contain the Krüppel-associated box
(KRAB) domain comprise the largest single family of transcriptional regulators
in the mammalian genome ( Huntley et al.,
2006; Ravasi et al.,
2003; Urrutia,
2003). The basis for their rapid evolution and expansion in
mammalian lineages (there are ~400 members in the human or mouse genomes),
as well as the target genes that they may regulate, remain poorly understood
( Krebs et al., 2005;
O'Geen et al., 2007).
KRAB-ZFPs are thought to repress transcription via interaction with
KRAB-associated protein 1 (KAP1)/TIF1β/TRIM28. In turn, KAP1 is thought
to function as a co-repressor by assembling a complex with HP1
( Ryan et al., 1999) and the
chromatin modifying enzymes: SETDB1 H3-K9 histone methyltransferase (HMTase)
( Schultz et al., 2002), NuRD
( Schultz et al., 2001) and
histone deacetylases (HDACs) ( Nielsen et
al., 1999). Because of a paucity of known physiological targets of KRAB-ZFPs, most
progress towards understanding their mechanism of action has come from studies
using reporter genes. KRAB domains, which are tethered to a transgene, can
repress transcription via KAP1. KAP1 recruits SETDB1 and HP1α to a
region around the promoter, resulting in stable transgene silencing
( Ayyanathan et al., 2003). This
suggests that KRAB-ZFPs might repress gene expression by a localised
alteration of chromatin structure and H3K9 methylation. However, the silenced
reporter transgene was also seen to re-localise to domains of pericentromeric
heterochromatin in the nucleus, suggesting that KRAB-KAP1 repression mechanism
may also operate at the level of nuclear organisation. This latter idea is substantiated by reported changes in the subnuclear
distribution of KAP1. During the retinoic acid (RA)-induced differentiation of
F9 embryonal carcinoma (EC) and embryonic stem (ES) cells, KAP1 relocalises
from the nucleoplasm to the pericentromeric heterochromatin
( Cammas et al., 2002). It has
been suggested that this might also recruit target genes, and, by implication,
the KRAB-ZFPs, to these sites ( Cammas et
al., 2004). Epitope-tagged KRAB-ZFPs have indeed been reported to
be concentrated at pericentromeric heterochromatin in some cells
( Matsuda et al., 2001);
( Payen et al., 1998;
Sutherland et al., 2001).
However, the subcellular localisation of endogenous KRAB-ZFP proteins has not
been extensively studied. Here, we have investigated the nuclear distribution of gene-trapped
KRAB-ZFPs during the RA-induced differentiation of embryonic stem (ES) cells.
We show that, upon differentiation, these fusion proteins, which all retain a
KRAB domain, but have lost their zinc fingers, are recruited to
pericentromeric heterochromatin in a KAP1-dependent manner. However, we show
that these gene-trapped KRAB-ZFPs are mislocalised. Endogenous KRAB-ZFPs,
Zfp647 and NT2 do not localise to the domains of pericentric heterochromatin,
but, rather, they locate at discrete foci in the nuclei of differentiated ES
cells, and these overlap with non-pericentromeric foci of KAP1 and with HP1
proteins. We have termed these KRAB and KAP1-associated (KAKA) foci. We demonstrate that, whereas the pericentromeric localisation of KAP1 is
dependent on trimethylation of H3-K9 that is catalysed by Suv39h1/h2, the
formation of KAKA foci is not. We also establish that there is close spatial
proximity between KAKA foci and PML-nuclear bodies (PML-NBs). We suggest that
KAKA foci represent a novel nuclear domain involved in the post-translational
modification of KRAB-ZFPs and KAP1 by sumoylation, and that they may also be
the sites of KRAB-ZFP-mediated gene silencing in the nucleus. Gene-trapped KRAB-ZFPs relocate to pericentric heterochromatin upon
differentiation We have previously described how a gene-trap screen (which uses an ATG- and
promoter-less gene-trap vector, and relies on in-frame splicing into an
endogenous gene transcript) can be used to identify proteins that reside in
different sub-nuclear compartments
( Sutherland et al., 2001). One
of the genes trapped in a continuation of this screen was Zfp647 in
the cell line ES492. Sequence analysis indicated that the protein encoded by
Zfp647 is a KRAB A+B family member
( Shannon et al., 2003), which
is separated by a linker region of 96 amino acids from 13
C 2H 2 zinc fingers. Although the majority of gene-traps
do integrate into introns, in the ES492 cell line the vector has inserted into
the 5′ end of the final ZF-encoding exon (after amino acid 147) of
Zfp647, and uses a cryptic splice donor. A schematic representation
of Zfp647 and the trapping of this locus, is shown in
. Our previously
described gene-trapped KRAB-domain containing proteins showed a nuclear
diffuse localisation in ES cells. However, these gene-trapped proteins were
also found concentrated at domains of constitutive heterochromatin (which is
pericentromeric in mouse) in a subset of ES cells, the morphology of which
suggested they may be differentiated
( Sutherland et al., 2001). To determine whether gene-trapped KRAB proteins do relocalise in the
nucleus upon differentiation, we used immunofluorescence with an antibody
(α-β-gal) that recognises the β-galactosidase (β-gal)
region of the gene-trapped KRAB proteins to analyse their nuclear distribution
before and after differentiation with retinoic acid (RA). Undifferentiated
cells were identified by co-immunofluorescence with an antibody that detects
stage-specific embryonic antigen-1 (SSEA-1) on the cell surface
( Matsui et al., 1992) [data
not shown]. In undifferentiated ES492 gene-trapped cells, the
Zfp647-β-gal fusion protein was found in fine speckles distributed across
the nucleus, but excluded from pericentric heterochromatin, and mostly
excluded from nucleoli (). However, with differentiation, Zfp647-βgal was found to
concentrate at pericentric heterochromatin (brightly staining DAPI foci) in a
significant proportion of cells (). We observed (data not shown) a similar relocalisation of
β-gal fusion proteins to heterochromatin upon RA-induced differentiation
for five other ES cell lines with gene-traps of different KRAB-ZFPs
( Sutherland et al., 2001). This is reminiscent of the differentiation-dependent relocalisation of KAP1
to heterochromatin reported in EC and ES cells
( Cammas et al., 2002). To
determine whether KAP1 and KRAB-β-gal fusion proteins moved to
heterochromatin together, we analysed their subnuclear distribution by
co-immunofluorescence, both before and after RA-induced differentiation. In
undifferentiated ES cells, KAP1 also showed staining in fine speckles
distributed across the nucleus, but excluded from pericentric heterochromatin
and nucleoli, although no colocalisation with Zfp647-β-gal speckles was
detected (, top panel).
With differentiation, both KAP1 and KRAB-β-gal fusion proteins localised
together at heterochromatin in many cells
(, bottom panel). We
never saw KRAB-fusion proteins concentrated at heterochromatin unless KAP1 was
present there, suggesting that the relocalisation of KRAB-fusion proteins to
pericentric heterochromatin upon differentiation may be dependent on the prior
nuclear re-localisation of KAP1 there
( Cammas et al., 2002). Re-localisation of KRAB-ZFPs and KAP1 to heterochromatin after addition of
RA could result from differentiation per se, or from changes in the cell cycle
as rapidly dividing ES cells differentiate. Therefore, we analysed the
localisation of gene-trapped KRAB-ZFPs in BrdU pulse-labelled cells. Before
and after differentiaton, we could see KRAB-β-gal fusion proteins
concentrated at heterochromatin in both BrdU-positive and negative cells (data
not shown). Therefore, KRAB-ZFP movement to heterochromatin is not just a
consequence of withdrawal from the cell cycle. Localisation of GFP-tagged Zfp647 All of our gene-trapped KRAB-ZFPs retain the KAP1-interacting KRAB domain,
but lack the zinc fingers (ZFs) of the endogenous protein. As the ZFs probably
target the proteins to specific genes, or are responsible for interaction with
other proteins, the gene-trapped proteins may mislocalise relative to their
wild-type counterparts. We therefore generated constructs of GFP fused with
full-length Zfp647, as well as deletion constructs to investigate domains
responsible for subcellular localisation. A construct consisting of GFP fused to Zfp647 lacking the ZFs
(GFP-Zfp647ΔZF), thus similar to the gene-trapped protein, could
localise to pericentric heterochromatin cells
(, double arrowheads)
when transiently expressed in NIH3T3 cells, but also showed some cytoplasmic
localisation. The ZFs of Zfp647 alone (GFP-Zfp647ΔKRAB) were distributed
diffusely throughout the cell, with no concentration at heterochromatin
(). This indicates
that amino acids 1 to 147, which comprise the KRAB domain and some of the
linker region, are necessary for retention of Zfp647 in the nucleus and its
recruitment to domains of heterochromatin. Full-length Zfp647 tagged with GFP
at either the N or C terminus (GFP-Zfp647 or Zfp647-GFP) produced a nuclear
diffuse staining pattern, but in up to 20% of cells the fusion protein also
colocalised with foci of pericentric heterochromatin
(, double arrowhead).
This is consistent with data for other transfected epitope-tagged KRAB ZFPs
( Matsuda et al., 2001). Interestingly, in some transfected cells, the GFP-Zfp647 or Zfp647-GFP
fusion proteins were also concentrated in smaller foci, which were not at
pericentric heterochromatin (arrowed in
and quantified in
). Generation of antibodies against endogenous Zfp647 The subnuclear localisation of GFP-tagged Zfp647 is generally consistent
with that of the gene-trapped KRAB-ZFPs, and with previous studies of KAP1
( Cammas et al., 2002), except
that the smaller foci seen with GFP-tagged protein were not apparent in the
gene-trapped cells. Therefore, we wished to examine the subcellular
localisation of endogenous Zfp647. We raised antibodies specific to amino
acids 90-174 in the linker region (broken line above linker of Zfp647 protein
diagrammed in ), as this
is the region that is most divergent between different KRAB-ZFPs. By western
blot, the affinity-purified antibody (α-Zfp647) raised in sheep detected
a band close to the expected size of 60 kDa in extracts from wild-type 12.5
days postcoitum (dpc) mouse embryos, and this band was much reduced in
intensity in homozygous mutant animals (–/–) generated from the
ES492 gene-trap ES cells (). We believe that the residual band may represent some splicing
around the gene-trap integration, rather than crossreaction with any another
KRAB ZFPs, as Zfp647 is not in a cluster of closely related KRAB ZFPs
and there is little homology between Zfp647 and any other KRAB ZFPs
across the linker. However, as the antibody raised in sheep was unable to
detect the Zfp647 epitope in cells by immunofluorescence (data not shown), we
also analysed affinity-purified (α-Zfp647) antibody raised in rabbit.
This antibody worked in immunofluorescence and was also able to detect Zfp647
by western blot in extracts from wild-type, but not mutant, animals
(). However, this
antibody also recognises a smaller band (~40 kDa), which is non-specific
(present in –/–). Subcellular fractionation of NIH3T3 cells
reveals that this non-specific band is cytoplasmic, whereas Zfp647 is in the
nuclear fraction (), and
therefore it does not interfere with our analysis of Zfp647 staining in the
nucleus. Protein loading of the samples for
is shown in
, which also confirms
the subcellular fractionation of NIH3T3 cells as histones are detected only in
the total and nuclear samples, not the cytoplasmic fraction. Endogenous Zfp647 does not associate with pericentric
heterochromatin We examined the subcellular distribution of endogenous Zfp647 during ES
cell differentiation using our rabbit α-Zfp647 antibody. In
undifferentiated ES cells (–RA in
), endogenous Zfp647 is
dispersed in the nucleoplasm with no obvious overlap with KAP1 staining. In a
proportion of ES cells differentiated with RA (+RA), Zfp647 relocalised, but
unlike the gene-trapped protein, this relocalisation was never to domains of
pericentric constitutive heterochromatin (DAPI-bright foci indicated by double
arrowheads in ). This
may be due to epitope masking of the endogenous protein when it associates
with heterochromatin, although we think this is unlikely as α-Zfp647 can
detect the same epitope on Zfp647-βgal at heterochromatin in ES492 cells
(supplementary material Fig. S1). Instead, in differentiated cells we observed
that Zfp647 was recruited to multiple foci (arrowed in
). These are reminiscent
of the foci detected with GFP-Zfp647 in transiently transfected cells
(). In the cells in
which they appeared, the number of distinct foci of Zfp647 varied from 5 to 40
(average of 14). Colocalisation of KRAB-ZFPs and KAP1 defines a new nuclear body Co-staining of ES cells, with antibody that recognises KAP1, showed the
relocalisation of KAP1 to sites of constitutive heterochromatin upon
differentiation (,
double arrowheads), as has previously been seen by ourselves
() and others
( Cammas et al., 2002). While
Cammas et al. ( Cammas et al.,
2002) found KAP1 to re-localise in a maximum of ~50% cells,
and that this was transient in F9 cells, in ES cells we find KAP1 at
pericentric heterochromatin increases during differentiation and reaching
>90% cells by 7 days of differentiation
(). However, we also
detected small nucleoplasmic foci of KAP1, not associated with pericentric
heterochromatin, that were coincident with the foci detected by α-Zfp647
(arrowed in ). In
deconvolved single image planes, taken at 0.25 μm steps through the
z-axis of ES cells, both Zfp647 and KAP1 are in fine nuclear speckles
in undifferentiated cells that show no obvious overlap (–RA in
). In differentiated
cells (+RA), it was apparent that one or more foci of KAP1 may be juxtaposed
to, or associated with, each focus of Zfp647. The foci of Zfp647 foci (and
their association with KAP1) first appeared around day 4 of ES cell
differentiation and are present in a maximum of 44% of cells at day 6
(). At each time point,
in the majority of cells containing Zfp647 foci, they are also associated with
KAP1. We tested whether similar foci exist in other cell types.
Non-heterochromatic foci containing both Zfp647 and KAP1 were also seen in the
nuclei of primary mouse embryonic fibroblasts (MEFs) from 12.5 dpc embryos
() and in NIH3T3 cells
(data not shown). To determine whether these foci are specific to Zfp647, or
whether they might also contain concentrations of other KRAB-ZFPs, we analysed
the sub-nuclear localisation of NT2, one of the few other KRAB-ZFPs for which
an antibody to the endogenous protein is available
( Tanaka et al., 2002). In
undifferentiated ES cells, NT2 showed a nucleoplasmic distribution of fine
speckles, although a stronger patch of staining was also observed in most
cells; we have not identified what this structure is. Upon differentiation
with RA, NT2, like Zfp647, relocalised to nucleoplasmic foci that were
associated with KAP1 in a subset of cells (arrowed in
) and not to pericentric
heterochromatin (,
double arrowheads). Unfortunately, as both antibodies were raised in rabbit we
were not able to co-stain with Zfp647 and NT2 to determine whether these two
proteins were present in the same foci. We conclude that multiple KRAB-ZFPs
can form foci that associate with non-heterochromatic foci of KAP1 in
differentiated cells. We propose that these constitute a novel sub-nuclear
compartment that we refer to as KRAB and KAP1 associated (KAKA) foci. KAKA foci also contain concentrations of HP1 KAP1 interacts, through its PxVxL motif, with HP1 proteins
( Nielsen et al., 1999;
Ryan et al., 1999) and this is
an integral part of the mechanism of transcriptional silencing mediated by
KRAB-ZFPs/KAP1( Ayyanathan et al.,
2003; Sripathy et al.,
2006). HP1α and β are concentrated at the domains of
heterochromatin where KAP1 is also colocalised
( Gilbert et al., 2003);
indeed, HP1 has been shown to be required for the localisation of KAP1 to
sites of constitutive heterochromatin during differentiation
( Cammas et al., 2002).
Interestingly, recent FRET data suggest differential interaction between KAP1
and different HP1 isoforms ( Cammas et al.,
2007). However, as well as being located at domains of constitutive
heterochromatin (,
double arrowheads), we noticed small nucleoplasmic foci of HP1 staining with
antibodies that detect HP1α and β. These are associated with the
foci demarked by Zfp647 (arrowed in ). Closer examination of the morphology of Zfp647 foci with
respect to HP1α and β shows that, similar to KAP1, they are often
juxtaposed and also that multiple foci may be linked
(, insets).
shows deconvolved
single optical sections of differentiated ES cells, but the association of
Zfp647 and HP1α in punctate foci was also confirmed in NIH3T3 cells by
confocal microscopy ().
We also co-stained Zfp647 with HP1γ in differentiated ES cells, but as
HP1γ stained the euchromatic compartment so strongly, we were unable to
detect whether it is specifically in KAKA foci (data not shown). Another protein that can interact with KAP1 and contribute to
KRAB-ZFP-mediated transcriptional repression is the H3K9 histone
methyltransferase (HMTase) SETDB1
( Ayyanathan et al., 2003;
Schultz et al., 2002;
Sripathy et al., 2006). By
immunofluorescence, we observed that, although in some cells SETDB1
co-localises with KAP1 at pericentric heterochromatin (~40% of cells in
day 10 differentiated ES cells, data not shown), most of the protein appears
to be located in foci in the nucleoplasm
(). Occasionally, we
could detect SETDB1 foci that overlapped with, or were associated with, the
KAKA foci detected by immunostaining for KAP1
(, inset). However, this
was not observed with all KAKA foci, suggesting that SETDB1 may not always be
present, or that the resident concentration of SETDB1 is not high. Co-staining
with antibodies that detect SETDB1 together with Zfp647 was not possible as
both antibodies were raised in rabbit. We suggest that KAKA foci contain
complexes of KAP1 with HP1s associated with KRAB-ZFPs, and that SETDB1 may be
present. KAKA foci are often adjacent to PML nuclear bodies Our data suggest that KRAB-ZFPs and the KAP1/HP1 repression machinery
colocalise together at multiple nucleoplasmic foci that we have termed KAKA
foci. To determine whether these foci represent a novel nuclear
sub-compartment, we analysed their spatial relationship to other nuclear
bodies that have a superficial resemblance in size and number. First, co-staining with CREST antisera, which recognise centromere
components, revealed that KAKA foci are distinct from centromeres/kinetochores
(). As KAP1 has been
found to colocalise with numerous damage response factors at DNA legions
( White et al., 2006), we
tested whether foci demarcated by Zfp647 were in fact damage foci using an
antibody against γ-H2AX. Although we could not co-stain γ-H2AX
with Zfp647 because both antibodies were raised in rabbit, in parallel
experiments the foci detected with each antibody were different in appearance
and number. Moreover, when we induced DNA damage with UV-C, whereas the number
of γ-H2AX foci increased as expected, no change in Zfp647 foci was
observed (data not shown). HP1s, together with MacroH2A, have been found to accumulate in
senescence-associated heterochromatin foci (SAHF)
( Zhang et al., 2005), but no
SAHF bodies were detected with an antibody that recognises MacroH2A during our
ES cell differentiation (data not shown). KAP1 is a member of the TRIM/RBCC (tripartite motif/Ring finger, B-box,
coiled-coil) family of proteins, many of which have been described as
localised to discrete cellular subcompartments
( Meroni and ez-Roux, 2005;
Reymond et al., 2001). A
prominent such example of an RBCC protein is PML – the principal
component and the organiser of PML nuclear bodies (PML-NBs). Co-staining of
differentiated ES cells with α-ZFP-647, and with antibody that
recognises PML and decorates PML-NBs, revealed that KAKA foci are not
coincident with PML-NBs. However, KAKA foci show a spatial relationship with
PML-NBs in the majority of the cells in which they are present (arrowed in
). A proportion of
Zfp647-containing KAKA foci are in closely apposed pairs with PML-NBs in
~77% of cells in which KAKA foci were detected (varying between 74 and 81%
on days 4 to 10 of OS25 ES cell differentiation). PML was one of the first substrates identified that is subject to
modification by the small ubiquitin-like modifier (SUMO)
( Sternsdorf et al., 1997) and
both SUMOs, and the machinery involved in both the addition and removal of
SUMO from substrates, are found concentrated in PML-NBs
( Boddy et al., 1996)
( http://npd.hgu.mrc.ac.uk/index.html).
Indeed, we observed that KAKA foci were also indeed juxtaposed to PML-NBs
detected by antibodies that recognise either SUMO1 or SUMO2/3
(). Targeting of KAP1 to pericentric heterochromatin, but not to KAKA
foci, is dependent on Suv39h HMTases To understand the factors that contribute to the differential targeting of
KAP1, HP1 and KRAB-ZFPs to pericentric heterochromatin or to KAKA foci, we
took advantage of mouse ES cells that lack the factors responsible for
epigenetic marks characteristic of heterochromatin. The highest concentration
of methylated CpGs in mouse cells is at pericentric heterochromatin, and the
DNA methyltransferases (DNMTs) Dnmt3a and Dnmt3b also concentrate there
( Bachman et al., 2001). In the
absence of these DNMTs, and with the consequent loss of DNA methylation, there
is an altered nuclear organisation and histone modification profile at
pericentric heterochromatin ( Gilbert et
al., 2007). Transgene studies have also implicated DNA methylation
and recruitment to domains of pericentric heterochromatin in the KRAB-mediated
repression mechanism ( Ayyanathan et al.,
2003). However, in late passage
Dnmt3a/b–/– cells, which we have previously
shown have no detectable remaining CpG methylation
( Gilbert et al., 2007), we
found that KAP1 was still concentrated at heterochromatin (data not shown).
Therefore, DNA methylation at pericentromeric heterochromatin is not needed to
sequester KAP1 there. Another chromatin mark characteristic of pericentric heterochromatin is
tri-methylated H3-K9 (H3K9me3) laid down by the Suv39h family of HMTases. In
mouse cells null for both Suv39h1 and Suv39h2 ( Suv39h
dn), the absence of H3K9me3 leads to a delocalisation of HP1α and
HP1β from pericentromeric heterochromatin
( Lehnertz et al., 2003)
(). We also found that
KAP1 localisation to pericentric heterochromatin was lost in Suv39h
dn cells (),
indicating that KAP1 concentration at these nuclear domains may be driven
through its interactions with HP1s. However, discrete KAKA foci containing
KAP1, HP1 and ZFP647 were still present in the nuclei of Suv39h dn
cells (). This suggests
that formation of KAKA foci is independent of the activity of the Suvar39h
HMTases and that the two nuclear sites of accumulation of KAP1 are
fundamentally different from one another. Sumoylation of KAP1 corresponds to the appearance of KAKA foci We also observed that both SUMO1 and SUMO2/3 could be found concentrated at
pericentric heterochromatin in some differentiated ES cells (SUMO1 shown in
). As KAP1 itself can be
sumoylated ( Ivanov et al.,
2007; Lee et al.,
2007; Li et al.,
2007; Mascle et al.,
2007), we thought it possible that the SUMO we observe at
pericentric heterochromatin is actually modified KAP1. However, at day 10 of
differentiation, the percentage of cells in which SUMO1 and SUMO2/3 is at
pericentric heterochromatin (19% and 46%, respectively) is far below that in
which KAP1 is at these sites (96%). Interestingly, in Suv39h dn
cells, pericentric localisation was no longer seen for either SUMO (SUMO1
shown in ), suggesting
the localisation of a major sumoylated target or of SUMO itself to this site
is dependent on this HMTase or H3K9me3. By contrast, the juxtaposition of KAKA
foci and SUMO-containing PML NBs persists in the absence of the Suv39h HMTases
(arrowed in ). The appearance of KAKA foci during ES cell differentiation, and their
proximity to SUMO-containing PML-NBs, prompted us to address whether
sumoylation of KAP1 is also regulated during differentiation. By western blot
with a KAP1 antibody, we analysed total cell extracts, prepared in the
presence of N-ethylmaleimide (NEM) to preserve SUMO modification,
from both undifferentiated (–RA) and day 10 differentiated (+RA)
wild-type ES cells (wt41). We found that the major unmodified form of KAP1
(, single arrow) was
downregulated during ES cell differentiation, as previously described for F9
cells ( Cammas et al., 2004).
However, interestingly, a higher molecular weight form, corresponding to
SUMOylated KAP1 (double arrow), was increased with differentiation. This was
also seen in extracts from Suv39 dn ES cells. This suggests that the
sumoylated form of KAP1, which is the form active in transcriptional
repression ( Ivanov et al.,
2007; Lee et al.,
2007; Li et al.,
2007; Mascle et al.,
2007), is resident in the euchromatic compartment, perhaps in KAKA
foci, and not at the constitutive heterochromatin, as KAP1 is delocalised from
pericentric heterochromatin in Suv39 dn ES cells
(). KRAB ZFPs have a dynamic nuclear localisation The initial studies of transgenes silenced by the KRAB-KAP1 repression
mechanism ( Ayyanathan et al.,
2003), the KAP1 localisation studies during ES and EC cell
differentiation ( Cammas et al.,
2002; Cammas et al.,
2004), and the subnuclear localisation of epitope-tagged KRAB-ZFPs
( Matsuda et al., 2001;
Payen et al., 1998;
Sutherland et al., 2001)
() had all pointed
towards a link between the KAP1/KRAB-ZFP repression pathway and domains of
pericentric heterochromatin in the nucleus. In this paper, we present the
first detailed study of the subnuclear distribution of endogenous KRAB-ZFPs.
We show that these proteins do have a dynamic nuclear localisation during cell
differentiation, but that they are not seen concentrated at the visible
domains of constitutive heterochromatin in differentiated mouse cells, even in
cells where KAP1 is concentrated there (Figs
and
). What is the explanation for the differential localisation of endogenous and
ectopically expressed KRAB-ZFPs? Ectopic expression of GFP-tagged Zfp647
deletion constructs show that it is the KRAB domain itself that is required
for localisation to heterochromatin (). This is probably due to the specific interaction of the KRAB
domain with KAP1 ( Friedman et al.,
1996) and is supported by previous findings where other tagged
KRAB-ZFPs, with mutations in the KRAB domain that are unable to bind KAP1, can
no longer localise to centromeric foci
( Matsuda et al., 2001). It
seems most likely that the ZFs or linker regions of KRAB ZFPs, such as Zfp647,
provide the DNA-binding specificity to direct the protein to its correct
target loci. We suggest that in the absence of these regions (deletion
constructs or gene-trapped proteins), the KRAB-KAP1 interaction dominates and
results in a mis-localisation of the KRAB protein at heterochromatin. Ectopic
expression of epitope tagged full-length KRAB-ZFPs may saturate specific
target binding sites in the genome and so also result in the accumulation of
the tagged protein at heterochromatin. Thus, caution must be exercised in interpreting the mechanism of
transcriptional repression when using ectopically expressed KRAB-ZFPs; it
remains unclear what the function of KAP1 is, if any, at constitutive
heterochromatin. Some KRAB proteins do consist of only a KRAB domain, e.g.
MIF1 ( Nikulina et al., 2006),
and some are alternatively spliced to generate a KRAB-box only protein, e.g.
KRAB-O from the Zfp208 locus ( Oh
et al., 2005). Therefore, it is possible that localisation at
pericentric heterochromatin is relevant to the function of a subset of KRAB
box-containing proteins. However, our finding that, in Suv39h dn ES
cells, KAP1 is completely delocalised from pericentric heterochromatin,
presumably as a consequence of HP1 delocalisation
(), suggests that the
major role of KAP1 is not at pericentric heterochromatin. This is supported by
the fact that the phenotype of the mice null for both Suv39h HMTases is quite
mild, with all animals developing normally until 12.5 dpc and many mice
surviving to adulthood ( Peters et al.,
2001). A null deletion of KAP1 itself, however, results in
complete embryonic lethality just after implantation
( Cammas et al., 2000). Ivanov
et al. ( Ivanov et al., 2007)
have reported that a sumoylation-deficient mutant of KAP1 (K6R) still
localised to pericentric heterochromatin and suggest that loss of repression
conferred by this mutant was not due to a defect in subnuclear targeting. This
would also be consistent with our suggestion that pericentric heterochromatin
is not the site of KRAB ZFP-mediated gene repression. KRAB ZFPs characterise a novel nuclear body In differentiated mouse cells, we found that two endogenous KRAB-ZFPs
(Zfp647 and NT2) were concentrated in nucleoplasmic foci that are not
associated with pericentric heterochromatin, but are tightly associated with
foci of KAP1 (Figs and
). We have termed these KRAB-
and KAP1-associated (KAKA) foci. We consider it likely that the
KAP1-containing nucleoplasmic foci reported with the GFP-tagged KRAB ZFP PAROT
are also KAKA foci ( Fleischer et al.,
2006). KAKA foci also contain the known KAP1-interacting proteins HP1α and
HP1β ( Nielsen et al.,
1999; Ryan et al.,
1999). We also show that another component of the KAP1-mediated
repression machinery, SETDB1 ( Schultz et
al., 2002), is present in nucleoplasmic foci that we observe
occasionally overlapping with KAKA foci
(). The
KAP1-HP1-KRAB-ZFP complexes in KAKA foci may only be transiently interacting
with SETDB1, or they may be interacting mainly with other chromatin modifiers
at these sites. In this regard, it is noteworthy that only 25% of the KAP1
binding sites identified in the genome of Ntera2 cells are also marked by the
presence of H3K9me3 – the histone modification catalysed by SETDB1
( O'Geen et al., 2007). KAKA foci – twin of PML NBs? We have shown that KAKA foci are often juxtaposed to PML nuclear bodies
(). This is reminiscent
of the relationship between gems, Cajal bodies and cleavage bodies, all
structures involved in steps of pre-mRNA processing. These bodies can occur as
separate nuclear structures, but can be also be twinned or colocalised in some
situations ( Li et al.,
2006). Intriguingly, given the spatial juxtaposition of KAKA foci and PML-NBs,
both KAP1 and PML are proteins of the RBCC family. Modification of PML by
sumoylation is known to be important for the formation of PML-NBs
( Zhong et al., 2000) and SUMOs
are concentrated in PML-NBs ( Bernardi and
Pandolfi, 2007) (). As we have found that the appearance of high molecular
weight forms of KAP1 during differentiation, consistent with its sumoylation
(), is coincident with
the cytological appearance of KAKA foci (Figs
and
), we speculate that, similar
to PML-NBs, sumoylation of KAP1 is involved in the formation of KAKA foci.
Consistent with a link between KAKA foci and sumoylation, KRAB-ZFPs themselves
have also been shown to be sumoylated in a proteomics analysis of proteins
modified by SUMO1 and SUMO2/3 ( Vertegaal
et al., 2006). It remains for bone fide target genes of KRAB-ZFPs, such as Zfp647, to be
identified in order to address whether target genes are recruited to KAKA foci
for their silencing or whether KAKA foci are storage, processing or assembly
sites for the proteins involved in KRAB-ZFP-mediated silencing. Cell culture and differentiation Undifferentiated E14 wt, gene-trapped,
Dnmt3ab–/–
( Okano et al., 1999),
Suv39h1/h2–/–
( Peters et al., 2001) and OS25
( Billon et al., 2002) ES cells
were maintained on 0.1% gelatin-coated dishes in Glasgow's modified Eagle's
medium (GMEM) containing 10% foetal calf serum (FCS), non-essential amino
acids, 1 mM sodium pyruvate, 0.3 mg/ml L-glutamine, 0.1 mM 2-mercaptoethanol
and 1000 U/ml human recombinant LIF. Mouse NIH3T3 fibroblasts were maintained
in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% FCS. 100 μg/ml hygromycin B was used to select for undifferentiated
(Oct4-expressing) OS25 cells. To induce their differentiation,
5×10 5 OS25 cells were plated in 25 cm 2 flasks
(Costar) without LIF or hygromycin B for 1 day. The cells were maintained in
medium with 5×10 –6 M RA for the next 4 days. For the
remaining length of differentiation (up to day 10), 2.5 μM gancyclovir was
also added to RA-containing medium to select against undifferentiated
(Oct4-expressing) cells ( Billon et al.,
2002). Media was changed every second day and cells were replated
or seeded onto 4×10 cm 2 gelatinised slides as necessary. All
other cell lines maintained and differentiated as above with RA, but with no
selection. DNA sequence analysis of ES492/Zfp647 Cell transfection Full-length Zfp647 cDNA, and versions lacking the ZFs, or the KRAB
box, were cloned from PCR products in frame into pEGFP-C1 or -N1 vectors
(Clontech). Zfp647 lacking the ZFs (GFP-Zfp647ΔZF) consisted of GFP
fused to amino acids 1 to 186 of Zfp647. Zfp647 without the KRAB box consisted
of GFP fused to amino acids 187 to 535
(). NIH3T3 cells were
transfected with Lipofectamine 2000 (Invitrogen) according to the
manufacturer's instructions. Cells were incubated for 24 hours, fixed and
visualised for GFP expression. Bacterial fusion proteins and antibody production Products encoding amino acids 90-174 of Zfp647, covering most of the linker
region, were PCR amplified from IMAGE clone 5326813 using the primers
5′ACTGAATTCGGAAGTGACCACTCAGAATGC3′ and
5′TGAGCGGCCGCATAGGGTCTCTCAACAGTGGG3′. The PCR product was
subcloned into pGex-4T-1 (Amersham Biosciences), sequenced and transformed
into E. coli BL21-CodonPlus (DE3)RP cells (Stratagene). Bacterial
GST-ZFP647 linker fusion protein was induced with IPTG and purified on
glutathione-agarose (Sigma) before injection into rabbits and sheep
(Diagnostic Scotland). The same PCR product was cloned into pET32a (Novagen);
the His-tagged fusion protein was purified on a Ni-agarose column (HIS-Select
Nickel Affinity Gel, Sigma) and an affinity column was made by binding it to
CNBr-activated sepharose 4B (Amersham Biosciences). Antibodies recognising
Zfp647 (α-Zfp647) were affinity purified against the Zfp647 linker
affinity column and specificity was confirmed by western blotting against
His-tagged Zfp647 protein expressed in E. coli (data not shown). Subcellular fractionation and western blotting Protein extracts from 12.5 dpc embryos were prepared by homogenisation of
dissected limbs (where Zfp647 is expressed) in 2×SDS loading buffer and
boiling samples before loading. Whole-cell protein extracts were made by
overlaying cells with PBS, adding an equal volume of 2×SDS protein
loading buffer and boiling before loading. NEM was added to the loading at a
final concentration of 20 mM in the protein samples in which it was used. For
nuclear extracts, cells were washed in PBS and resuspended on ice in nuclei
extraction Buffer A [NBA, 5.5% sucrose (w/v in dH 2O), 10 mM
Tris-HCl (pH 8), 85 mM KCl, 0.5 mM spermidine, 250 μM PMSF (phenyl methyl
sulfonyl fluoride), 0.2 mM EDTA]. An equal volume of NBA + 0.1% NP-40 [v/v]
was then added prior to pelleting at 500 g for 3 minutes at
4°C. Nuclei were washed with NBA and their concentration determined from
the A 260. An equal volume of 2×SDS protein loading buffer was
added to the sample and boiled before loading on SDS-PAGE gels. Total cell,
cytoplasmic and nuclear NIH3T3 fractions were prepared as previously described
( Sutherland et al., 2004). For western blotting, protein extracts were fractionated by 10-12% SDS-PAGE
and transferred to a nylon membrane by wet blotting (GENIE blotter, Idea
Scientific). The membranes were incubated with primary antibodies and detected
by horseradish peroxidase (HRP)-conjugated donkey anti-rabbit or anti-mouse
whole molecule IgG (Sigma, 1:10,000) and chemiluminescence (SuperSignal
1:2000). Primary antibody dilutions were as follows: 1:1000 sheep α-647
(3.2 mg/ml), 1:1500 rabbit α-647 (4.75 mg/ml) and 1:2500 rabbit
α-KAP1 (Bethyl Laboratories, A300-274A). For loading controls, protein
extracts were stained with GelCode Blue stain reagent (ThermoScientific) after
fractionation. For histone loading controls, protein extracts were
fractionated by 17% SDS-PAGE before GelCode Blue staining. Immunofluorescence Cells were grown as monolayers on slides and fixed for 20 minutes in 3%
paraformaldehyde (pFa)/PBS containing 1.5 mM MgCl 2 and 1 mM
CaCl 2. Fix was quenched in 50 mM NH 4Cl/PBS for 10
minutes and cells were permeabilised in 0.25% Triton X-100/PBS for 12 minutes.
Cells were incubated overnight with primary antibodies: 1:150 dilution of
rabbit α-647 (this paper); undiluted mAb supernatant recognising KAP1
(gift of F. J. Rauscher III and D. Schultz) or a 1:1200 dilution of a mAb
against KAP1 (gift of P. Chambon); 1:500 dilutions of mouse mAb
α-HP1α, β and γ (Chemicon); 1:200 dilution mouse mAb
α-SSEA-1 (DSHB); 1:2000 dilution of rabbit α-β-gal (Europa)
or a mAb against β-gal (Promega); 1:1000 dilution of mouse mAb
α-PML (Chemicon); 1:300 dilution of CREST sera
( Gilchrist et al., 2004);
1:150 dilution of sheep α-SUMO1 and 1:50 dilution of α-SUMO2/3
(gifts of Ron Hay); 1:200 dilution of MacroH2A1 (Upstate); and 1:500 dilution
of α-phospho-H2AX [Ser139] (Upstate). After washing off non-specifically
bound antibody, the slides were then incubated for 1 hour with 1:200 dilutions
of FITC- or TexasRed-labelled secondary antibodies (Jackson and Vector
Laboratories) or 1:1000 dilutions of Alexa Fluor 488 or Alexa Fluor 594
secondary antibodies (Invitrogen). For treatment with UV, cells were irradiated with 200 J/m2 of
UV-C at 254 nm (UV Stratalinker 1800, Stratagene), returned to media and
incubated for 30 minutes before fixation and immunofluorescence as described
above. For immunofluorescence combined with detection of bromodeoxyuridine
(BrdU) incorporation, 0.01 M BrdU (Roche) was added to cells in culture 30
minutes before fixation in 3% pFa for 20 minutes. Cells were incubated with
primary antibody and subsequently fixed in 10% formalin (v/v)/PBS for 10
minutes and permeabilised with 0.1% Triton X-100/PBS for 12 minutes. DNA was
denatured with a 30-minute 2 M HCl treatment to allow for α-BrdU
antibody access. Cells were washed in PBS, blocked for 10 minutes in 5% BSA
(w/v) before incubating with 1:100 dilution of a rabbit antibody recognising
BrdU (Harlan SeraLab) for 1 hour, followed by incubation with secondary
antibodies. Slides were counterstained with 0.5 μg/ml DAPI in Vectashield, and
examined on a Zeiss Axioplan epifluorescence microscope equipped with a triple
band-pass filter (Chroma #83000) and imaged with cooled CCD camera using IPLAB
software v. 3.6 (Scanlytics, USA). For optical sectioning, the microscope
objective was fitted with a Pifoc motor to allow optical sectioning in the
z-axis and the images were subject to deconvolution to remove out of
focus blur using Hazebuster deconvolution software. A Zeiss LSM510
laser-scanning confocal microscope was also used for examining some
slides. - Ayyanathan, K., Lechner, M. S., Bell, P., Maul, G. G., Schultz,
D. C., Yamada, Y., Tanaka, K., Torigoe, K. and Rauscher, F. J., 3rd
(2003. ). Regulated recruitment of HP1 to a euchromatic gene
induces mitotically heritable, epigenetic gene silencing: a mammalian cell
culture model of gene variegation. Genes Dev.
17,
1855-1869. [PubMed]
- Bachman, K. E., Rountree, M. R. and Baylin, S. B.
(2001. ). Dnmt3a and Dnmt3b are transcriptional repressors that
exhibit unique localization properties to heterochromatin. J. Biol.
Chem. 276,
32282-32287. [PubMed]
- Bernardi, R. and Pandolfi, P. P. (2007. ).
Structure, dynamics and functions of promyelocytic leukaemia nuclear bodies.
Nat. Rev. Mol. Cell. Biol.
8,
1006-1016. [PubMed]
- Billon, N., Jolicoeur, C., Ying, Q. L., Smith, A. and Raff,
M. (2002. ). Normal timing of oligodendrocyte development from
genetically engineered, lineage-selectable mouse ES cells. J. Cell
Sci. 115,
3657-3665. [PubMed]
- Boddy, M. N., Howe, K., Etkin, L. D., Solomon, E. and Freemont,
P. S. (1996. ). PIC 1, a novel ubiquitin-like protein which
interacts with the PML component of a multiprotein complex that is disrupted
in acute promyelocytic leukaemia. Oncogene
13,
971-982. [PubMed]
- Cammas, F., Mark, M., Dolle, P., Dierich, A., Chambon, P. and
Losson, R. (2000. ). Mice lacking the transcriptional
corepressor TIF1beta are defective in early postimplantation development.
Development 127,
2955-2963. [PubMed]
- Cammas, F., Oulad-Abdelghani, M., Vonesch, J. L., Huss-Garcia,
Y., Chambon, P. and Losson, R. (2002. ). Cell differentiation
induces TIF1beta association with centromeric heterochromatin via an HP1
interaction. J. Cell Sci.
115,
3439-3448. [PubMed]
- Cammas, F., Herzog, M., Lerouge, T., Chambon, P. and Losson,
R. (2004. ). Association of the transcriptional corepressor
TIF1beta with heterochromatin protein 1 (HP1): an essential role for
progression through differentiation. Genes Dev.
18,
2147-2160. [PubMed]
- Cammas, F., Janoshazi, A., Lerouge, T. and Losson, R.
(2007. ). Dynamic and selective interactions of the transcriptional
corepressor TIF1 beta with the heterochromatin protein HP1 isotypes during
cell differentiation. Differentiation
75,
627-637. [PubMed]
- Fleischer, S., Wiemann, S., Will, H. and Hofmann, T. G.
(2006. ). PML-associated repressor of transcription (PAROT), a
novel KRAB-zinc finger repressor, is regulated through association with PML
nuclear bodies. Exp. Cell Res.
312,
901-912. [PubMed]
- Friedman, J. R., Fredericks, W. J., Jensen, D. E., Speicher, D.
W., Huang, X. P., Neilson, E. G. and Rauscher, F. J., 3rd
(1996. ). KAP-1, a novel corepressor for the highly conserved KRAB
repression domain. Genes Dev.
10,
2067-2078. [PubMed]
- Gilbert, N., Boyle, S., Sutherland, H., de Las, H. J., Allan,
J., Jenuwein, T. and Bickmore, W. A. (2003. ). Formation of
facultative heterochromatin in the absence of HP1. EMBO
J. 22,
5540-5550. [PubMed]
- Gilbert, N., Thomson, I., Boyle, S., Allan, J., Ramsahoye, B.
and Bickmore, W. A. (2007. ). DNA methylation affects nuclear
organization, histone modifications, and linker histone binding but not
chromatin compaction. J. Cell Biol.
177,
401-411. [PubMed]
- Gilchrist, S., Gilbert, N., Perry, P. and Bickmore, W. A.
(2004. ). Nuclear organization of centromeric domains is not
perturbed by inhibition of histone deacetylases. Chromosome
Res. 12,
505-516. [PubMed]
- Huntley, S., Baggott, D. M., Hamilton, A. T., Tran-Gyamfi, M.,
Yang, S., Kim, J., Gordon, L., Branscomb, E. and Stubbs, L.
(2006. ). A comprehensive catalog of human KRAB-associated zinc
finger genes: insights into the evolutionary history of a large family of
transcriptional repressors. Genome Res.
16,
669-677. [PubMed]
- Ivanov, A. V., Peng, H., Yurchenko, V., Yap, K. L., Negorev, D.
G., Schultz, D. C., Psulkowski, E., Fredericks, W. J., White, D. E., Maul, G.
G. et al. (2007. ). PHD domain-mediated E3 ligase activity
directs intramolecular sumoylation of an adjacent bromodomain required for
gene silencing. Mol. Cell
28,
823-837. [PubMed]
- Krebs, C. J., Larkins, L. K., Khan, S. M. and Robins, D. M.
(2005. ). Expansion and diversification of KRAB zinc-finger genes
within a cluster including Regulator of sex-limitation 1 and 2.
Genomics 85,
752-761. [PubMed]
- Lee, Y. K., Thomas, S. N., Yang, A. J. and Ann, D. K.
(2007. ). Doxorubicin down-regulates Kruppel-associated box
domain-associated protein 1 sumoylation that relieves its transcription
repression on p21WAF1/CIP1 in breast cancer MCF-7 cells. J. Biol.
Chem. 282,
1595-1606. [PubMed]
- Lehnertz, B., Ueda, Y., Derijck, A. A., Braunschweig, U.,
Perez-Burgos, L., Kubicek, S., Chen, T., Li, E., Jenuwein, T. and Peters, A.
H. (2003. ). Suv39h-mediated histone H3 lysine 9 methylation
directs DNA methylation to major satellite repeats at pericentric
heterochromatin. Curr. Biol.
13,
1192-1200. [PubMed]
- Li, L., Roy, K., Katyal, S., Sun, X., Bleoo, S. and Godbout,
R. (2006. ). Dynamic nature of cleavage bodies and their
spatial relationship to DDX1 bodies, Cajal bodies, and gems. Mol.
Biol. Cell 17,
1126-1140. [PubMed]
- Li, X., Lee, Y. K., Jeng, J. C., Yen, Y., Schultz, D. C., Shih,
H. M. and Ann, D. K. (2007. ). Role for KAP1 serine 824
phosphorylation and sumoylation/desumoylation switch in regulating
KAP1-mediated transcriptional repression. J. Biol.
Chem. 282,
36177-36189. [PubMed]
- Mascle, X. H., Germain-Desprez, D., Huynh, P., Estephan, P. and
Aubry, M. (2007. ). Sumoylation of the transcriptional
intermediary factor 1beta (TIF1beta), the Co-repressor of the KRAB Multifinger
proteins, is required for its transcriptional activity and is modulated by the
KRAB domain. J. Biol. Chem.
282,
10190-10202. [PubMed]
- Matsuda, E., Agata, Y., Sugai, M., Katakai, T., Gonda, H. and
Shimizu, A. (2001. ). Targeting of Kruppel-associated
box-containing zinc finger proteins to centromeric heterochromatin.
Implication for the gene silencing mechanisms. J. Biol.
Chem. 276,
14222-14229.. [PubMed]
- Matsui, Y., Zsebo, K. and Hogan, B. L. (1992. ).
Derivation of pluripotential embryonic stem cells from murine primordial germ
cells in culture. Cell
70,
841-847. [PubMed]
- Meroni, G. and ez-Roux, G. (2005. ). TRIM/RBCC, a
novel class of `single protein RING finger' E3 ubiquitin ligases.
BioEssays 27,
1147-1157. [PubMed]
- Nielsen, A. L., Ortiz, J. A., You, J., Oulad-Abdelghani, M.,
Khechumian, R., Gansmuller, A., Chambon, P. and Losson, R.
(1999. ). Interaction with members of the heterochromatin protein 1
(HP1) family and histone deacetylation are differentially involved in
transcriptional silencing by members of the TIF1 family. EMBO
J. 18,
6385-6395. [PubMed]
- Nikulina, K., Bodeker, M., Warren, J., Matthews, P. and
Margolis, T. P. (2006. ). A novel Kruppel related factor
consisting of only a KRAB domain is expressed in the murine trigeminal
ganglion. Biochem. Biophys. Res. Commun.
348,
839-849. [PubMed]
- O'Geen, H., Squazzo, S. L., Iyengar, S., Blahnik, K., Rinn, J.
L., Chang, H. Y., Green, R. and Farnham, P. J. (2007. ).
Genome-wide analysis of KAP1 binding suggests autoregulation of KRAB-ZNFs.
PLoS Genet. 3
e89. [PubMed]
- Oh, H. J., Li, Y. and Lau, Y. F. (2005. ). Sry
associates with the heterochromatin protein 1 complex by interacting with a
KRAB domain protein. Biol. Reprod.
72,
407-415. [PubMed]
- Okano, M., Bell, D. W., Haber, D. A. and Li, E.
(1999. ). DNA methyltransferases Dnmt3a and Dnmt3b are essential
for de novo methylation and mammalian development.
Cell 99,
247-257. [PubMed]
- Payen, E., Verkerk, T., Michalovich, D., Dreyer, S. D.,
Winterpacht, A., Lee, B., De Zeeuw, C. I., Grosveld, F. and Galjart, N.
(1998. ). The centromeric/nucleolar chromatin protein ZFP-37 may
function to specify neuronal nuclear domains. J. Biol.
Chem. 273,
9099-9109. [PubMed]
- Peters, A. H., O'Carroll, D., Scherthan, H., Mechtler, K.,
Sauer, S., Schofer, C., Weipoltshammer, K., Pagani, M., Lachner, M.,
Kohlmaier, A. et al. (2001. ). Loss of the Suv39h histone
methyltransferases impairs mammalian heterochromatin and genome stability.
Cell 107,
323-337. [PubMed]
- Quimby, B. B., Yong-Gonzalez, V., Anan, T., Strunnikov, A. V.
and Dasso, M. (2006. ). The promyelocytic leukemia protein
stimulates SUMO conjugation in yeast. Oncogene
25,
2999-3005. [PubMed]
- Ravasi, T., Huber, T., Zavolan, M., Forrest, A., Gaasterland,
T., Grimmond, S. and Hume, D. A. (2003. ). Systematic
characterization of the zinc-finger-containing proteins in the mouse
transcriptome. Genome Res.
13,
1430-1442. [PubMed]
- Reymond, A., Meroni, G., Fantozzi, A., Merla, G., Cairo, S.,
Luzi, L., Riganelli, D., Zanaria, E., Messali, S., Cainarca, S. et al.
(2001. ). The tripartite motif family identifies cell compartments.
EMBO J. 20,
2140-2151. [PubMed]
- Ryan, R. F., Schultz, D. C., Ayyanathan, K., Singh, P. B.,
Friedman, J. R., Fredericks, W. J. and Rauscher, F. J., 3rd
(1999. ). KAP-1 corepressor protein interacts and colocalizes with
heterochromatic and euchromatic HP1 proteins: a potential role for
Kruppel-associated box-zinc finger proteins in heterochromatin-mediated gene
silencing. Mol. Cell. Biol.
19,
4366-4378. [PubMed]
- Schultz, D. C., Friedman, J. R. and Rauscher, F. J., 3rd
(2001. ). Targeting histone deacetylase complexes via KRAB-zinc
finger proteins: the PHD and bromodomains of KAP-1 form a cooperative unit
that recruits a novel isoform of the Mi-2alpha subunit of NuRD.
Genes Dev. 15,
428-443. [PubMed]
- Schultz, D. C., Ayyanathan, K., Negorev, D., Maul, G. G. and
Rauscher, F. J., 3rd (2002. ). SETDB1: a novel KAP-1-associated
histone H3, lysine 9-specific methyltransferase that contributes to
HP1-mediated silencing of euchromatic genes by KRAB zinc-finger proteins.
Genes Dev. 16,
919-932. [PubMed]
- Shannon, M., Hamilton, A. T., Gordon, L., Branscomb, E. and
Stubbs, L. (2003. ). Differential expansion of zinc-finger
transcription factor loci in homologous human and mouse gene clusters.
Genome Res. 13,
1097-1110. [PubMed]
- Sripathy, S. P., Stevens, J. and Schultz, D. C.
(2006. ). The KAP1 corepressor functions to coordinate the assembly
of de novo HP1-demarcated microenvironments of heterochromatin required for
KRAB zinc finger protein-mediated transcriptional repression. Mol.
Cell. Biol. 26,
8623-8638. [PubMed]
- Sternsdorf, T., Jensen, K. and Will, H. (1997. ).
Evidence for covalent modification of the nuclear dot-associated proteins PML
and Sp100 by PIC1/SUMO-1. J. Cell Biol.
139,
1621-1634. [PubMed]
- Sutherland, H. G., Mumford, G. K., Newton, K., Ford, L. V.,
Farrall, R., Dellaire, G., Caceres, J. F. and Bickmore, W. A.
(2001. ). Large-scale identification of mammalian proteins
localized to nuclear sub-compartments. Hum. Mol.
Genet. 10,
1995-2011. [PubMed]
- Sutherland, H. G., Lam, Y. W., Briers, S., Lamond, A. I. and
Bickmore, W. A. (2004. ). 3D3/lyric: a novel transmembrane
protein of the endoplasmic reticulum and nuclear envelope, which is also
present in the nucleolus. Exp. Cell Res.
294,
94-105. [PubMed]
- Tanaka, K., Tsumaki, N., Kozak, C. A., Matsumoto, Y., Nakatani,
F., Iwamoto, Y. and Yamada, Y. (2002. ). A Kruppel-associated
box-zinc finger protein, NT2, represses cell-type-specific promoter activity
of the alpha 2(XI) collagen gene. Mol. Cell. Biol.
22,
4256-4267. [PubMed]
- Urrutia, R. (2003. ). KRAB-containing zinc-finger
repressor proteins. Genome Biol.
4, 231. [PubMed]
- Vertegaal, A. C., Andersen, J. S., Ogg, S. C., Hay, R. T., Mann,
M. and Lamond, A. I. (2006. ). Distinct and overlapping sets of
SUMO-1 and SUMO-2 target proteins revealed by quantitative proteomics.
Mol. Cell Proteomics. 5,
2298-2310. [PubMed]
- White, D. E., Negorev, D., Peng, H., Ivanov, A. V., Maul, G. G.
and Rauscher, F. J., 3rd (2006. ). KAP1, a novel substrate for
PIKK family members, colocalizes with numerous damage response factors at DNA
lesions. Cancer Res. 66,
11594-11599. [PubMed]
- Zhang, R., Poustovoitov, M. V., Ye, X., Santos, H. A., Chen, W.,
Daganzo, S. M., Erzberger, J. P., Serebriiskii, I. G., Canutescu, A. A.,
Dunbrack, R. L. et al. (2005. ). Formation of
MacroH2A-containing senescence-associated heterochromatin foci and senescence
driven by ASF1a and HIRA. Dev. Cell
8, 19-30. [PubMed]
- Zhong, S., Muller, S., Ronchetti, S., Freemont, P. S., Dejean,
A. and Pandolfi, P. P. (2000. ). Role of SUMO-1-modified PML in
nuclear body formation. Blood
95,
2748-2752. [PubMed]
|
This article has been 
