|
|
Pain. Author manuscript; available in PMC 2009 July 27. Published in final edited form as: Published online 2008 December 9. doi: 10.1016/j.pain.2008.10.023. | PMCID: PMC2716034 NIHMSID: NIHMS124553 |
Polymorphisms in the GTP cyclohydrolase gene (GCH1) are associated with ratings of capsaicin pain Claudia M. Campbell,a Robert R. Edwards,ab Cheryl Carmona,c Magdalena Uhart,d Gary Wand,d Alene Carteret,c Yu Kyeong Kim,e James Frost,f and James N. Campbellc* aDepartment of Psychiatry & Behavioral Sciences, The Johns Hopkins University School of Medicine, Meyer 1-108, 600 N Wolfe Street, Baltimore, MD 21287, USA bDepartment of Anesthesiology, Perioperative and Pain Medicine, Harvard Medical School, Brigham & Women’s Hospital, Suite 302, 850 Boylston Street, Chestnut Hill, MA 02467, USA cDepartment of Neurosurgery, The Johns Hopkins University School of Medicine, Meyer 5-109, 600 N. Wolfe Street, Baltimore, MD 21287, USA dDepartment of Medicine, The Johns Hopkins University School of Medicine, Suite 7403, 1830 E. Monument Street, Baltimore, MD 21287 USA eDepartment of Nuclear Medicine, Seoul National University College of Medicine, Seoul National University Bundang Hospital, 300 Gumi-ro, Bundang-gu, Seongnam, 463-707, South Korea fDepartment of Radiology, The Johns Hopkins University School of Medicine, 600 N. Caroline Street, Baltimore, MD 21287 USA Though it is clear that genomic variability plays an integral role in accounting for pain sensitivity, controversy exists over which genes are involved. While recent data suggest a “protective” (i.e., less pain) haplotype in the GTP cyclohydrolase (GCH1) gene, other research has failed to confirm this association. Possibly, the effects of single nucleotide polymorphisms (SNPs) vary depending on the pain task. The current investigation analyzed the association of five previously identified GCH1 SNPs with ratings of pain induced by topical high concentration (10%) capsaicin applied to the skin of 39 healthy human volunteers. Each of the GCH1 polymorphisms was associated with lower pain ratings. When combined, three of the five accounted for a surprisingly high 35% of the inter-individual variance in pain ratings. We conclude that SNPs of the GCH1 gene may profoundly affect the ratings of pain induced by capsaicin. Keywords: GTP cyclohydrolase, GCH1, Genetics, Pain, Experimental pain, Capsaicin A growing body of research suggests that genetic variability at a number of loci contributes to individual differences in pain sensitivity [ 7, 15]. GTP cyclohydrolase (GCH1), recently implicated in shaping pain responses in rodents and humans, regulates production of g( R)- l-erythro-5,6,7,8-tetrahydrobiopterin (BH4), an essential cofactor for the synthesis of dopamine, serotonin, and nitric oxide. To date, three studies have evaluated GCH1’s role in nociceptive processing. In the initial report, Tegeder et al. [ 18] discovered a haplotype associated with reduced ratings of experimental pain stimuli in normal volunteers, and a favorable outcome with regard to long-term pain reduction in patients that underwent lumbar disc surgery. However, Kim and Dionne [ 10] failed to replicate significant associations between the same GCH1 genomic variants and pain responses, both in assessment of experimental pain and in a postoperative third-molar dental pain model. The most recent assessment, performed by authors that presented the initial findings, indicates that carriers of the protective haplotype, relative to non-carriers, reported decreased sensitivity to mechanical stimulation following freeze lesion. Individuals that expressed the protective haplotype further showed an increased thermal pain threshold (less hyperalgesia) on capsaicin-treated skin, when compared to those that exhibited the more common alleles [ 17]. One potential explanation for the discrepant findings could be the use of differing postoperative pain assessments and experimental stimuli [ 8]. The recent findings by Tegeder (2008) may suggest a mechanistic link between the experimentally induced sensitized skin and the protective effects of the GCH1 haplotype. Our group possessed existing data on a small cohort of subjects undergoing assessment of pain responses following topical application of capsaicin. We sought to characterize the association of previously identified GCH1 SNPs and ratings of capsaicin pain intensity in this sample of healthy participants. The present study is distinctive in that we tested pain to capsaicin directly over an extended period of time (90 min). This paradigm yielded positive results despite a relatively small number of subjects, thus suggesting that this test may have a particularly strong ability to distinguish effects. The study sample consisted of 39 healthy young adults (53% female; self-reported ethnicity = 49% European American, 30% African American, 21% Asian American). The present data were collected as part of a functional neuroimaging PET study of muopioid receptors in placebo response (Campbell et al., in preparation). Eligibility criteria included having no pain condition or medical disorders; participants were excluded from participation if they had an active alcohol or drug abuse problem, or if there was present use of narcotics, antidepressants, anticonvulsants, or muscle relaxants. All subjects provided informed consent, and the Johns Hopkins Institutional Review Board approved all study procedures. A blood sample was obtained for SNP analysis, and then participants were comfortably positioned in a PET scanner for the remainder of the procedure. The capsaicin application methods were similar to procedures that were utilized in the previous studies by our group [ 1, 2]. A topical cream consisting of 0.5 g of 10% capsaicin was applied to a 6.25-cm 2 area on the dorsal aspect of the right hand, and was evenly spread on the skin. An occlusive dressing (Tegederm™) was placed over the site to maintain the capsaicin within the area of application. Since topical capsaicin-induced pain varies strongly as a function of skin temperature [ 1], a contact thermode (Medoc US, Minneapolis, MN, USA), held at a constant temperature of 38 °C, was maintained over the area. A bolus injection of 19.5 (1.2) mCi (range = 16.3–21.1 mCi) of the radiolabeled compound [11C]-carfentanil (mean dose = .005 µg/kg, range = .002–.008) was administered after the capsaicin and ther-mode were in place. This dose of carfentanil is known to be sub-threshold for effects on pain perception [ 19]. Pain ratings gradually increase to reach a plateau within 30 min of applying the capsaicin [ 1]. Pain rating data were collected over a 90 min interval. Participants rated their pain continuously on a computerized 0–100 visual analog scale (0 = no pain and 100 = most intense pain imaginable). In addition, the participants were prompted every 30 s asking whether the value on the screen represented their current rating. This task was added to ensure that subjects were awake and alert. Genotyping was conducted across the Chr14q22.1-q22.2 region that contains the GCH1 gene. We evaluated the five SNPs that showed significant associations with pain responses in a previous study by Tegeder et al. [ 18]: rs752688, rs4411417, rs8007201, rs3783641 and rs8007267. The location of these nucleotides spans the GCH1 gene. Genomic leukocyte DNA was extracted using the Gentra Puregene kit (Quiagen, Minneapolis, MN). Genotyping was performed by the 5′-nuclease method using fluorogenic allele-specific probes. Oligonucleotide primer and probe sets were designed based on TaqMan™ probe primer combinations available from the Assay-on-Demand™ human SNP genotyping collection from Applied Biosystems Incorporated (ABI, Foster City, CA) (rs752688 Assay on demand #9866644 (ABI, Ca); rs4411417 Assay on demand #11164699 (ABI, Ca); rs3783641 Assay on demand #25800745 (ABI, Ca); and rs8007267 Assay on demand #1545138 (ABI, Ca). Single nucleotide polymorphism rs8007201 was genotyped using primers (forward primer GGTGGTCCTGATATTTCTCAATTCTGT; reverse primer CAGGAACAACTTTAGAGGGCAGTT) and probes (FAM-CTACCCCAGCAATC and VIC-AAAACTACTCCAGCAATC). PCR amplifications for Assay on Demand SNPs were performed in a 5-µl volume containing 0.25 µl 20× assay mix, 2.5 µl TaqMan Genotyping Master Mix (ABI, Foster City, CA), and 9 ng genomic DNA. SNP rs8007201 was PCR amplified in a 5-µl volume containing 1.8 µM of forward and reverse primers, 0.25 µM of each reporter and quencher probe, 2.5 µl TaqMan Genotyping Master Mix, and 9 ng genomic DNA. Reaction mixtures were incubated at 50 °C for 2 min and at 95 °C for 10 min, and amplified for 40 cycles at 92 °C for 15 s and at 60 °C for 1 min. Allele-specific signals were distinguished by measuring endpoint 6-FAM or VIC fluorescence intensities using an ABI 7900HT sequence detection system instrument, and genotypes were generated using the SDS v2.1 software package (Applied Biosystems). As a quality control, repeat genotyping of 18% of samples was carried out, and the overall error rate was <0.005. Genotype completion rate was 100%. Analysis of covariance (ANCOVA) was used to examine the relationships between the five SNPs and the mean ratings of capsaicin pain intensity controlling for sex and ethnic group membership (which can impact both pain ratings and allelic frequency [ 3, 10]). Further analysis was done to determine the role of these variables. Data for individuals, heterozygous or homozygous for the less-frequent allele (as identified as part of the “protective” haplotype by Tegeder et al., 2006), were combined for analysis and presentation purposes (see Table 1). Analyses were also conducted to examine potential confounds of carfentanil administration as well as population stratification. | Table 1Mean ratings of capsaicin pain intensity as a function of variability at 5 GCH1 SNPs. |
As shown in Table 1, subjects expressing the uncommon alleles for SNPs that were previously identified by Tegeder et al. (2006) exhibited lower pain ratings. This relationship was particularly striking for rs4411417 ( p = .005). For this SNP, those having the common variant reported 78% more pain than those exhibiting the uncommon alleles. Stated differently the subjects with the uncommon alleles reported of 44% less pain. Significant effects were also evident for rs3783641 and rs752688 ( p’s < .05). Pain ratings as a function of time are shown for each of the three SNPs associated with the significant effect in . The mean rating of pain over time is also shown. A linear model including all 3 significant SNPs together (i.e., rs3783641, rs4411417, and rs752688) accounted for 35% of the variance in capsaicin-induced pain ratings after controlling for sex and ethnic group. Rs441417 accounted for 23% of the variance alone. ANCOVAs revealed a trend toward significance between pain intensity and rs8007201 (p = .08). The association for rs8007267 lacked significance (p = .19). In ligand-based PET imaging studies, drug dose varies with the specific activity arising from the synthesis. Therefore, we tested whether there was a confounding effect of carfentanil dose. Carfentanil dose was uncorrelated with capsaicin pain ratings (r = .16), and did not vary across genetic groups. For example in the case of rs4411417, the dose of carfentanil for the uncommon SNP was 0.0055 µg/kg, and the dose for the common SNP was 0.0049 µg/kg (p = .71). In order to examine potential confounding effects of population stratification, an analysis of sex and ethnic variability was also conducted. The sample was ethnically diverse and no sex, age, or ethnic differences were evident in the group as a whole. We also did subanalysis for each SNP. The results were mixed. For example, the SNP for which pain ratings differed the most (rs441417), 3 of 10 subjects with the uncommon allele were African Americans. There were 9 African Americans out of 29 participants in the common allele group. This distribution is in keeping with frequencies determined in other population studies, where frequency of the variant nucleotide is cited to be about 17–18% for both African Americans and Caucasians. For allele rs8007267, 11 of 12 subjects with the variant SNP were African Americans raising the possibility of population stratification. However, the association of this allele with pain ratings was the least impressive of the five SNPs examined (p = .19). Men and women, as well as age range were equally distributed within the common and uncommon allelic groups (for each SNP p > .05). Only a few genes contributing to individual differences in pain sensitivity have been identified to date, and independent replication of any observed associations is crucial (see [ 7, 12] for review). Here, we sought to test the five SNPs identified in the original Tegeder study, with respect to their associations with individual differences in pain intensity ratings during a high-potency capsaicin stimulus presented over a 90-min period of time. In general, relative to the use of phasic stimuli, this type of tonic experimental pain stimulus may provide a greater sensitivity in elucidating the physiological mechanisms contributing to pain perception [ 1, 2]. We report here, in a small sample of healthy volunteers, a significant association between three previously identified GCH1 SNPs (out of five that were tested) and ratings of the intensity of tonic capsaicin pain. These three SNPs when taken together accounted for an impressive 35% of the variation in pain ratings. For one of the SNPs (rs4411417), the ratings of pain for the common nucleotide variant were 78% higher than those for the uncommon variant. Another observation is that pain remained at a high plateau throughout the 90 min of pain ratings for the subjects with the common alleles, whereas the pain drifted downward for the subjects with the SNP variants (). These findings dovetail nicely with animal studies implicating BH4 in pain responses, following nerve injury and inflammation [ 17, 18]. However, Kim and Dionne’s negative findings in a large sample certainly suggest the possibility that the presence and the strength of associations may depend on which pain-induction modalities are utilized in a given study. While individual differences in pain sensitivity are often correlated across types of noxious stimuli [ 8, 9, 13], at least one recent twin study suggests that genetic heritability may vary considerably with stimulus modality [ 14]. However, it is difficult to reconcile the initial finding of Tegeder [ 18] where mechanical pain sensitivity was most associated with the protective haplotype and their more recent findings, where no such relationship emerged. The pain-produced by topical capsaicin, after transduction by the TRPV1 receptor [ 5], is predominantly C-fiber mediated (although myelinated fibers may also be involved [ 5, 16]), and is generally considered to involve peripheral and central sensitization mechanisms. TRP channels are also activated by nitric oxide [ 17, 20]. As recently discussed by Oertel and Lotsch [ 15] in review of pain-protective genetic mutations, a genetic variant on the GCH1 gene region has been associated with decreased nitric oxide production. This in turn may influence the relationship between specific GCH1 allelic expression and pain perception, an association which may be particularly relevant in capsaicin models. As Tegeder and colleagues (2006) note, one potential mechanism by which GCH1 exerts its pain modulating effects may be through excess enzyme activity. They hypothesize that antinociceptive effects may be partially mediated by preventing excess production of nitric oxide. Despite such speculation, the molecular mechanisms by which GCH1 exerts its pain protective effects are yet to be identified. Our data do not permit an analysis of what specific components of the nociceptive system are likely to be most impacted by GCH1 variations. However, we note that assessment of pain threshold in sensitized skin and ratings of capsaicin pain intensity (present study) appear to yield the most robust associations between GCH1 and pain responses, while ratings of suprathreshold cold and heat stimuli were unrelated to GCH1 variation, even in a large sample [ 10]. Assessment of mechanical pain sensitivity appears to yield mixed results [ 17, 18]. The duration of the chosen pain induction modality may also contribute to differences in these previous findings. Tegeder and colleagues (2006) found that blocking BH4 synthesis reduced neuropathic and inflammatory pain, while administering BH4 produced/enhanced pain. While the mechanistic pathway through which this genetic variant exerts influence over pain perception is unknown, Tegeder’s findings, and subsequently ours, suggest that GCH1 variability significantly modulates pain sensitivity. Noteworthy limitations of the current analysis include our small sample size. However, our study was not an unguided search for SNPs, but rather an independent test of a specific hypothesis related to the previously identified SNPs. In addition, we did not have enough subjects to perform a haplotype analysis in the manner of the previous studies, though recent work by Lotsch et al. [ 11] suggests that analyzing even a single GCH1 SNP yields impressively high sensitivity and specificity in screening for a “ pain-protective haplotype.” Indeed, the 3 significant SNPs in this study are in high linkage disequilibrium (LD) with one another (an average LD of .89, ranging from .84 to nearly 1.0), suggesting that they convey information that is to some degree redundant, and that a haplotype analysis might be a more powerful way to interrogate these data. Another limitation may include combining different ethnic groups into these analyses. Unfortunately, our sample size does not lend itself to subanalyses in order to examine these effects by group. Additionally, no ethnic difference in pain ratings emerged. Thus, it is unlikely that population stratification influenced our results [ 4]. Additionally, Kim and Dionne’s [ 10] data indicated that ethnic differences in GCH1 allelic distributions could confound associations between pain and GCH1 genotype. Given that the previous studies had shown an ethnic difference in the distribution of alleles, we used sex and ethnicity as covariates to reduce their potential for confounding the analysis. Generally, the robustness of our results are especially impressive in light of the fact that this is a rather small and heterogeneous sample, and that the analyses included several covariates. Of note, we observed significant differences in only three of the five SNPs identified by Tegeder and colleagues (2006). However, both the non-significant SNPs (rs8007201 and rs8007267) showed a response pattern in the same direction as those that were significant (uncommon alleles associated with less pain). Our small sample size may have led to a Type II statistical error. Another possible confound might relate to the effects of carfentanil given in the course of the PET study. The dose of carfentanil was very low (e.g., 0.005 µg/kg), and is unlikely to have had pharmacological effects. Nevertheless, we compared the dose of carfentanil for the subjects with the common and uncommon variants for each SNP, and observed no differences. For rs4411417, for example, the carfentanil dose was 0.005 for each group. Most importantly, the decrease in ratings of pain for the SNP variant subjects was present before carfentanil was given. Collectively, notwithstanding the limitations of this work, the current analysis of GCH1 and capsaicin-induced pain supports a role for BH4 and GCH1 in pain signaling. Understanding and quantifying the genetic contribution to individual differences in pain sensitivity could have substantial implications for predicting the degree of an individual’s risk for developing a variety of clinical pain conditions [ 6, 7], and the present findings appear to suggest that continued investigation of GCH1’s role in shaping pain responses is likely to be a fruitful line of inquiry. Targeting of GCH1 activity could be of use for development of novel analgesics. This work was supported by NIH Grant AT001433 and with resources from NS063624 and MH75884. We also thank Basil Rudusky, M.D. and the late Mitchell Max, M.D., for their consultation in preparing this manuscript. 1. Anderson WS, Sheth RN, Bencherif B, Frost JJ, Campbell JN. Naloxone increases pain induced by topical capsaicin in healthy human volunteers. Pain. 2002;99:207–216. [PubMed] 2. Bencherif B, Fuchs PN, Sheth R, Dannals RF, Campbell JN, Frost JJ. Pain activation of human supraspinal opioid pathways as demonstrated by [11C]-carfentanil and positron emission tomography (PET). Pain. 2002;99:589–598. [PubMed] 3. Campbell CM, Edwards RR, Fillingim RB. Ethnic differences in responses to multiple experimental pain stimuli. Pain. 2005;113:20–26. [PubMed] 4. Cardon LR, Palmer LJ. Population stratification and spurious allelic association. Lancet. 2003;361:598–604. [PubMed] 5. Caterina MJ, Julius D. The vanilloid receptor: a molecular gateway to the pain pathway. Annu Rev Neurosci. 2001;24:487–517. [PubMed] 6. Edwards RR. Individual differences in endogenous pain modulation as a risk factor for chronic pain. Neurology. 2005;65:437–443. [PubMed] 7. Edwards RR. Genetic predictors of acute and chronic pain. Curr Rheumatol Rep. 2006;8:411–417. [PubMed] 8. Edwards RR, Sarlani E, Wesselmann U, Fillingim RB. Quantitative assessment of experimental pain perception: multiple domains of clinical relevance. Pain. 2005;114:315–319. [PubMed] 9. Hastie BA, Riley JL, Fillingim RB. Ethnic differences and responses to pain in healthy young adults. Pain Med. 2005;6:61–71. [PubMed] 10. Kim H, Dionne RA. Lack of influence of GTP cyclohydrolase gene (GCH1) variations on pain sensitivity in humans. Mol Pain. 2007;3:6. [PubMed] 11. Lotsch J, Belfer I, Kirchhof A, Mishra BK, Max MB, Doehring A, Costigan M, Woolf CJ, Geisslinger G, Tegeder I. Reliable screening for a pain-protective haplotype in the GTP cyclohydrolase 1 gene (GCH1) through the use of 3 or fewer single nucleotide polymorphisms. Clin Chem. 2007;53:1010–1015. [PubMed] 12. Lotsch J, Geisslinger G. Current evidence for a modulation of nociception by human genetic polymorphisms. Pain. 2007;132:18–22. [PubMed] 13. Neddermeyer TJ, Fluhr K, Lotsch J. Principle components analysis of pain thresholds to thermal, electrical, and mechanical stimuli suggests a predominant common source of variance. Pain. 2008;138:286–291. [PubMed] 14. Nielsen CS, Stubhaug A, Price DD, Vassend O, Czajkowski N, Harris JR. Individual differences in pain sensitivity: genetic and environmental contributions. Pain. 2008;136:21–29. [PubMed] 15. Oertel B, Lotsch J. Genetic mutations that prevent pain: implications for future pain medication. Pharmacogenomics. 2008;9:179–194. [PubMed] 16. Ringkamp M, Peng YB, Wu G, Hartke TV, Campbell JN, Meyer RA. Capsaicin responses in heat-sensitive and heat-insensitive A-fiber nociceptors. J Neurosci. 2001;21:4460–4468. [PubMed] 17. Tegeder I, Adolph J, Schmidt H, Woolf CJ, Geisslinger G, Lotsch J. Reduced hyperalgesia in homozygous carriers of a GTP cyclohydrolase 1 haplotype. Eur J Pain. 2008;12:1069–1077. [PubMed] 18. Tegeder I, Costigan M, Griffin RS, Abele A, Belfer I, Schmidt H, et al. GTP cyclohydrolase and tetrahydrobiopterin regulate pain sensitivity and persistence. Nat Med. 2006;12:1269–1277. [PubMed] 19. Wager TD, Scott DJ, Zubieta JK. Placebo effects on human mu-opioid activity during pain. Proc Natl Acad Sci USA. 2007;104:11056–11061. [PubMed] 20. Yoshida T, Inoue R, Morii T, Takahashi N, Yamamoto S, Hara Y, et al. Nitric oxide activates TRP channels by cysteine S-nitrosylation. Nat Chem Biol. 2006;2:596–607. [PubMed]
|
The publisher's final edited version of this article is available at 
