• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of mbcLink to Publisher's site
Mol Biol Cell. Jul 15, 2009; 20(14): 3295–3304.
PMCID: PMC2710833

The Group Migration of Dictyostelium Cells Is Regulated by Extracellular Chemoattractant Degradation

Jean E. Schwarzbauer, Monitoring Editor

Abstract

Starvation of Dictyostelium induces a developmental program in which cells form an aggregate that eventually differentiates into a multicellular structure. The aggregate formation is mediated by directional migration of individual cells that quickly transition to group migration in which cells align in a head-to-tail manner to form streams. Cyclic AMP acts as a chemoattractant and its production, secretion, and degradation are highly regulated. A key protein is the extracellular phosphodiesterase PdsA. In this study we examine the role and localization of PdsA during chemotaxis and streaming. We find that pdsA cells respond chemotactically to a narrower range of chemoattractant concentrations compared with wild-type (WT) cells. Moreover, unlike WT cells, pdsA cells do not form streams at low cell densities and form unusual thick and transient streams at high cell densities. We find that the intracellular pool of PdsA is localized to the endoplasmic reticulum, which may provide a compartment for storage and secretion of PdsA. Because we find that cAMP synthesis is normal in cells lacking PdsA, we conclude that signal degradation regulates the external cAMP gradient field generation and that the group migration behavior of these cells is compromised even though their signaling machinery is intact.

INTRODUCTION

The process by which cells sense an attractant molecule and respond by migrating directionally toward it is called chemotaxis. Chemotaxis is essential for a variety of physiological processes in mammals as well as for the survival of lower eukaryotes. The mechanisms that regulate the directed migration of neutrophils and Dictyostelium discoideum have been extensively studied previously (van Haastert and Devreotes, 2004 blue right-pointing triangle; Bagorda et al., 2006 blue right-pointing triangle; Friedl and Weigelin, 2008 blue right-pointing triangle; Stephens et al., 2008 blue right-pointing triangle). One particular challenge of these fast-moving cells is to maintain the ability to respond sensitively and rapidly to an attractant signal. Because both neutrophils and Dictyostelium cells use signal relay loops to propagate chemoattractant signals, mechanisms must be at play to maintain detectable levels of chemoattractants. Remarkably, signal degradation also seems to play an important role in the developmental processes of multicellular organisms. Migration of primordial germ cells in Drosophila and Zebrafish seems to require degradation of specific lysophospholipids in the former or chemokines in the latter to allow these cells to find their proper developmental environment (Renault and Lehmann, 2006 blue right-pointing triangle; Minina et al., 2007 blue right-pointing triangle). Many cell types use receptor-mediated degradation to maintain detectable levels of chemoattractants. In this context, cells internalize the bound receptor and as part of the receptor recycling pathway the ligand is released for degradation (Minina et al., 2007 blue right-pointing triangle; Boldajipour et al., 2008 blue right-pointing triangle; Borroni et al., 2008 blue right-pointing triangle; Scola et al., 2008 blue right-pointing triangle). Alternatively, extracellular enzymes can specifically degrade the extracellular signaling molecules, allowing the sensing machinery to go back to basal levels and retain high sensitivity (Leidal et al., 2003 blue right-pointing triangle; Bader et al., 2007 blue right-pointing triangle; Van Lint and Libert, 2007 blue right-pointing triangle; Leung et al., 2008 blue right-pointing triangle).

Dictyostelium is an excellent model system to study chemotaxis. These social amoebae occur naturally in the soil, and they exist in two independent life stages: a growth stage and a developmental stage (Chisholm and Firtel, 2004 blue right-pointing triangle; Manahan et al., 2004 blue right-pointing triangle; Mahadeo and Parent, 2006 blue right-pointing triangle; Urushihara, 2008 blue right-pointing triangle). On the onset of starvation conditions, the cells enter a developmental program that leads to the aggregation of a group of up to 100,000 cells that eventually form a multicelluar structure. The formation of the aggregate is mediated by the cyclic nucleotide cAMP, which serves as a chemoattractant (Saran et al., 2002 blue right-pointing triangle; Garcia and Parent, 2008 blue right-pointing triangle; McMains et al., 2008 blue right-pointing triangle). Soon after the onset of starvation, development is initiated by the expression of the adenylyl cyclase A (ACA) and the G protein-coupled cAMP receptor 1 (cAR1) as well as other genes involved in intracellular signaling and sensing of external cAMP (Devreotes, 1994 blue right-pointing triangle; Parent and Devreotes, 1996 blue right-pointing triangle; Aubry and Firtel, 1999 blue right-pointing triangle; Weeks, 2000 blue right-pointing triangle). Activation of cAR1 leads to the stimulation of a variety of effectors that control chemotaxis, gene expression, and signal relay via the activation of ACA and the secretion of additional cAMP (Parent and Devreotes, 1996 blue right-pointing triangle; Aubry and Firtel, 1999 blue right-pointing triangle). Interestingly, as cells form aggregates, they acquire the ability to migrate in groups by aligning in a head-to-tail manner, forming characteristic streams. We have previously shown that the ability of cells to stream depends on the enrichment of ACA-containing vesicles at the back of migrating cells (Kriebel et al., 2003 blue right-pointing triangle, 2008 blue right-pointing triangle). We propose that the formation of head-to-tail arrays is regulated by the specific release of cAMP from vesicles at the back of cells.

Cyclic nucleotide phosphodiesterases (PDEs), which catalyze the hydrolysis of the 3′-5′ phosphodiester bond, are also up-regulated in early development (Lacombe et al., 1986 blue right-pointing triangle; Bader et al., 2007 blue right-pointing triangle). Four of the seven Dictyostelium PDEs degrade intracellular cyclic nucleotides, and the remaining three have extracellular activity (Bader et al., 2007 blue right-pointing triangle). PdsA (also called PDE1 or PdeA) is the main PDE that is responsible for the degradation of extracellular cAMP (Lacombe et al., 1986 blue right-pointing triangle; Bader et al., 2007 blue right-pointing triangle). Cells lacking PdsA show no or greatly reduced extracellular PDE activity and they fail to aggregate under starvation conditions. (Barra et al., 1980 blue right-pointing triangle; Sucgang et al., 1997 blue right-pointing triangle). This phenotype can be rescued by the re-expression of PdsA; however, overexpression leads to aberrant development (Darmon et al., 1978 blue right-pointing triangle; Faure et al., 1988 blue right-pointing triangle, 1989 blue right-pointing triangle). PdsA has been purified from cells and has been extensively characterized biochemically (Gerisch et al., 1972 blue right-pointing triangle; Brown and Rutherford, 1980 blue right-pointing triangle; Blondelet and Brachet, 1981 blue right-pointing triangle; Yamasaki and Hayashi, 1982 blue right-pointing triangle; Franke and Kessin, 1992 blue right-pointing triangle). Based upon the presence of PDE activity in cell fractions enriched for membrane, plasma membrane, or both, it has been proposed that PdsA exist in a membrane-bound form and a secreted form (Malchow et al., 1972 blue right-pointing triangle).

Although intracellular signal transduction mechanisms regulating chemotaxis and streaming in Dictyostelium have been extensively studied previously (Insall and Andrew, 2007 blue right-pointing triangle; Janetopoulos and Firtel, 2008 blue right-pointing triangle; Kay et al., 2008 blue right-pointing triangle; Kolsch et al., 2008 blue right-pointing triangle; Kortholt and van Haastert, 2008 blue right-pointing triangle), the role that extracellular signal degradation plays in these processes has not been examined. We hypothesize that PdsA, by degrading extracellular cAMP, plays a key role in regulating chemotaxis both by sensitizing the chemoattractant response and by shaping the gradient during streaming. We therefore assessed the role of PdsA in actively chemotaxing Dictyostelium cells and determined the cellular distribution of PdsA during chemotaxis. Our data show that extracellular soluble form of PdsA is required for the discrimination and propagation of the cAMP signal during chemotaxis.

MATERIALS AND METHODS

Reagents

Caffeine, ATP, cAMP, dithiothreitol (DTT), and all other reagents were purchased from Sigma-Aldrich (St. Louis, MO) unless otherwise noted. [α-32P]ATP was purchased from MP Biomedicals (Irvine, CA).

Antibodies

Antibodies against ACA (Parent and Devreotes, 1995 blue right-pointing triangle) and cAR1 (Hereld et al., 1994 blue right-pointing triangle) were a generous gift from Peter Devreotes (Johns Hopkins University, Baltimore, MD). A rabbit polyclonal antibody to PdsA was created against the peptide sequence N-LNDYYTPENWNYYSG-C, corresponding to amino acids 60-74 of the protein sequence. Additional rabbit polyclonal antibodies were generated against three other peptide sequences from the PdsA protein: amino acids 284-298 (N-ANEFPFSVKVKPFEL-C), amino acids 345-358 (N-KQIKIDKLKAIYIE-C), and amino acids 428-443 (N-TQRVIYQQLKEANNNG-C). The specificity of these antibodies was tested using both concentrated extracellular media as well as lysates including both the total cells and the extracellular media. Unpurified and affinity-purified forms of the antisera were tested, and the unpurified serum provided greater sensitivity with little increase in background over the affinity-purified forms. The antibody to amino acids 60-74 was able to detect endogenous levels of PdsA greater than the other antibodies tested. A mouse monoclonal antibody against calnexin (Muller-Taubenberger et al., 2001 blue right-pointing triangle) was obtained from the Developmental Studies Hybridoma Bank maintained by the Department of Biological Sciences at The University of Iowa (Iowa City, IA).

Plasmids, Cell Lines, and Development

The full-length PdsA gene was cloned from genomic DNA isolated from AX3 wild-type (WT) cells by a proteinase K and phenol extraction method adapted from Sambrook (2001) blue right-pointing triangle. The reverse primer TAGGATCCAATTATTTAAATACAAATTGGATCACCTT and the forward primer AGGATCCTATTAAAAAATGGCATTAAATAAAAAATTGTAAG were used. The polymerase chain reaction (PCR) product was cut using a BamHI and inserted into the BglII site of pB18 (Johnson et al., 1991 blue right-pointing triangle) or pAB3 (reconstructed pCV5 vector) (Janetopoulos et al., 2001 blue right-pointing triangle). The 3′ addition of green fluorescent protein (GFP) or Myc was accomplished by inserting a new restriction site to replace the stop codon (KpnI and ApaI, respectively). This product was inserted into the enhanced GFP (Clontech, Mountain View, CA) or pCMV-Myc (Clontech) vectors and cloned into pB18 or pAB3. For the N-terminal fusions, a mutated full-length gene was amplified to create two pieces with overlapping ApaI restriction sites and a short linker sequence. The N-terminal mutant was formed using the previously mentioned primers and the internal primers CAGTAACGATGGGCCCGGTGGTGGTAGTAATTTTTATAATTTAAATG and CATTTAAATTATAAAAATTACTACCACCACCGGGCCCATCGTTACTG. The Myc epitope or enhanced yellow fluorescent protein (YFP) sequences were inserted in frame into the ApaI site of the N-terminal mutant PdsA gene. Plasmids were electroporated into cells by the method of (Pang et al., 1999 blue right-pointing triangle) by using a MicroPulser electroporation device (Bio-Rad Laboratories, Hercules, CA). Transformed cells were subject to selection with G418 (Geneticin; Invitrogen, Carlsbad, CA) at 2.5–20 μg/ml. Cells were plated on a SM agar plate with a lawn of bacteria and allowed to grow at 22°C (Sussmann, 1966 blue right-pointing triangle). Plaques that formed fruiting bodies were selected.

Cell lacking PdsA (UK5 and UK7) were obtained from Richard Kessin (Columbia University, New York, NY). In all experiments, UK5 and UK7 cells behaved similarly; for consistency, findings obtained with UK5 cells (which we refer to as pdsA) are presented in this study. WT (AX3) pdsA or transfected cells were grown in shaking cultures in HL5 media to ~5 × 106 cells/ml and processed for development as described previously (Kriebel et al., 2003 blue right-pointing triangle). Briefly, cells were washed once in development buffer (DB; 5 mM Na2HPO4, 5 mM NaH2PO4, pH 6.2, 2 mM MgSO4, and 200 μM CaCl2), resuspended in DB at 2 × 107 cells/ml, and shaken at 100 rpm for 4–8 h with pulses of 75 nM cAMP every 6 min. To allow pdsA cells to develop to the chemotaxis-competent stage, partly purified extracellular media (see below) was also added every 6 min, just after the cAMP pulse. The cells were then processed according to the assay performed.

Partly Purified Extracellular Media

Extracellular media (EC) were partly purified from pdsA/pdsA cells as described previously, with small modifications (Orlow et al., 1981 blue right-pointing triangle). In brief, cells (4 × 107 cells/ml) were developed for 16 h with 100 nM pulses of cAMP. The cells were removed by centrifugation, and the EC were centrifuged again at 13,000 × g for 30 min (4°C). The EC was subjected to ammonium sulfate precipitation (1.5 M) for 2 h (4°C), centrifuged at 13,000 × g for 30 min (4°C), and the supernatant was retained. Ammonium sulfate precipitation (2.5 M) was carried out again described above. The pellet was resuspended in PDE buffer (50 mM Tris and 10 mM MgCl2, pH 7.5) and placed in a Slide-A-Lyzer dialysis cassette (Pierce Chemical, Rockford, IL) with a 10-kDa permeability limit and dialyzed overnight at 4°C in PDE buffer with 4 mM DTT. The cassette was transferred to PDE buffer with 0.1 mM DTT and dialyzed at 4°C overnight. The solution was removed from the cassette and centrifuged at 48,000 × g for 30 min to remove any insoluble materials. The supernatant was aliquoted and stored at −30°C until use.

Chemotaxis Assays

To examine self-aggregation, cells were developed for 5 h, extensively washed with PB, and plated at 5 × 106 cell/35 mm on plates covered with 1.5% agar in DB. Aggregates and streams were visualized 30 min to 1 h after plating. For assay of the influence of partly purified EC on self aggregation cells, 100 μl of cells was extensively washed and then plated at a density of 5 × 106 cells/ml on eight-well chambered slides (Lab-Tek 155411; Nalge Nunc International, Rochester, NY) and allowed to adhere. The extracellular media were removed and replaced with 200 μl of PB or partly purified EC at given densities. Chemotaxis was visualized using time-lapse microscopy. Under-agarose and micropipette assays were performed as described previously (Parent et al., 1998 blue right-pointing triangle; Comer and Parent, 2006 blue right-pointing triangle).

Western Blotting

The Crieterion gel system (Bio-Rad Laboratories) was used according to the manufacturer's instructions for all Western blotting. Immunostaining was carried out using standard methods. Transferred membranes were briefly washed in TBS-T (25 mM Tris, 137 mM NaCl, 2.7 mM KCl, pH 7.6, and 0.05% Tween 20) and blocked overnight in either 4% bovine serum albumin in Tris-buffered saline/Tween 20 (TBS-T) (for ACA, cAR1, and Myc) or in 4% nonfat dry milk (for PdsA). Primary antibodies were used at 1:1000 for Myc and PdsA and 1:2000 for ACA and cAR1; secondary antibodies (catalog no. NA934V, horseradish peroxidase [HRP]-linked anti-rabbit and NA931V, HRP linked anti-mouse, GE Healthcare, Chalfont St. Giles, Buckinghamshire, United Kingdom) were used at 1:10,000.

Adenylyl Cyclase Activity Assay

Assay was performed as described previously (Comer et al., 2005 blue right-pointing triangle). Adenylyl cyclase measurements exhibit considerable variation between experiments. From day to day, the amount of labeled ATP decreases due to breakdown of both the isotope and ATP. The most accurate way to compare and display results is by examining the profile and extent of activation between cell lines using the same reaction mix on the same day. Therefore we, and others in the field, have chosen to present adenylyl cyclase activation data as representative of results from at least three independent experiments, each performed in duplicate on a given day.

Fixation and Immunostaining

Developed cells were either plated uniformly on an eight-well chambered slide (Lab-Tek, Nalge Nunc International) and allowed to chemotax for 30 min or plated in 5-μl spots on a two-well chambered slide, overlaid with 1 ml of PB, and subjected to an attractant gradient. Once the cells were polarized and chemotaxing, the buffer was gently removed and replaced with an equal volume of 100% methanol (−20°C). After 5 min, the methanol was replaced with PB and then cells were incubated in blocking solution (10% fetal bovine serum, 2% normal goat serum, and 0.1% digitonin in PB). Fixed cells were washed once with PBS + 0.05% digitonin (PBSD) and then probed with primary antibody in PBSD + 10% blocking solution: rabbit polyclonal anti-Myc (sc-789; Santa Cruz Biotechnology, Santa Cruz, CA) at a dilution of 1:200, mouse monoclonal anti-Myc (sc-40; Santa Cruz Biotechnology) at a dilution of 1:50, mouse anti-calnexin at a dilution of 1:100, or rabbit anti-cAR1 at a dilution of 1:500. After extensive washing, secondary antibody at a concentration of 2 μg/ml in PBSD + 10% blocking solution was added. All secondary antibodies were from Invitrogen (488 goat anti-mouse, 488 goat anti-rabbit, 568 goat anti-mouse, and 555 goat anti-rabbit). Nuclear staining was done with 300 nM 4,6-diamidino-2-phenylindole (D3571; Invitrogen) in PBS for 5 min.

Microscopy and Image Processing

Fluorescent images were taken on a spinning disk confocal microscope (PerkinElmer Life and Analytical Sciences, Boston, MA), micropipette images were taken using either an Axiovert S100 inverted microscope (Carl Zeiss, Thornwood, NY) attached to a MicroPublisher 3.3 RTV camera (QImaging, Surrey, BC, Canada) or Axiovert 200 inverted microscope (Carl Zeiss) attached to a CoolSNAP HQ camera (Roper Scientific, Trenton, NJ) using a 10× objective (Carl Zeiss). Images were taken using an MZ125 upright stereomicroscope (Leica Microsystems, Deerfield, IL) attached to a MicroPublisher 3.3 RTV camera. Images of self-aggregation were taken on a Axiovert 200 microscope using a BioPrecision 2 multiposition stage (Ludl Electronic Products, Hawthorne, NY) automated by iVision software (iVision Software, Omaha, NE). Images were processed using ERS software (PerkinElmer, Boston, MA), ImageJ (National Institutes of Health, Bethesda, MD), or iVision software.

RESULTS

Addition of Conditioned Buffer Rescues the Developmental Defect of pdsA Cells

It has been established previously that cells lacking PdsA fail to aggregate and differentiate when plated on nonnutrient agar (Barra et al., 1980 blue right-pointing triangle; Sucgang et al., 1997 blue right-pointing triangle). Some mutated cell lines lacking key signaling proteins have been shown to enter development and become chemotactically competent when given exogenous pulses of cAMP (Pitt et al., 1992 blue right-pointing triangle; Insall et al., 1994 blue right-pointing triangle; Bolourani et al., 2006 blue right-pointing triangle). We therefore tested whether pdsA cells can be driven to enter development by this method. We pulsed cells for 5 h, plated them on nonnutrient agar, and recorded their ability to chemotax and form aggregates. As expected, 60 min after plating, WT cells streamed into aggregates; however, the pulsed pdsA failed to do so (Figure 1A). Furthermore, the pulsed pdsA cells were not able to respond to an externally imposed gradient of cAMP and migrate directionally (Figure 1B).

Figure 1.
The developmental defect of pdsA cells can be rescued by exogenously providing partially purified PEC. (A) Cells were pulsed with cAMP for 5 h and plated on nonnutrient agar. Pictures were taken 1 h after plating. Data are representative results ...

We found that the expression pattern of the developmentally regulated signaling proteins ACA and cAR1 was aberrant in pdsA cells. Whereas WT cells began to express ACA and cAR1 at 2 h, peaking at 5–6 h, pdsA cells expressed ACA later and to a much lesser extent than WT cells and the level of cAR1 remained undetectable until 8 h of development (Figure 1C). To rescue the developmental defect of the pdsA cells, we partly purified the soluble form of PdsA from the EC of pdsA cells overexpressing full-length PdsA (PdsA/pdsA), which exhibited robust PDE activity, and added it to starving cells. The purity of the EC was examined by western blotting using an antibody to PdsA and by examining protein levels by silver staining. Western blot analysis of dilutions from the partially purified extracellular medium preparations, hereafter referred to as PEC, showed that a one-fifth dilution of PEC isolated from WT cells (2.4 μg of protein loaded) detected less PdsA than a 1/250 dilution of PEC isolated from PdsA/pdsA cells (16 ng of protein loaded) (Supplemental Figure S1). The predominant band in PEC isolated from PdsA/pdsA cells was PdsA, whereas in PEC isolated from WT cells the PdsA was not distinctly visible (and it did not rescue the developmental defect of pdsA cells; see below). This suggests that the PEC made from overexpressing cells not only contained more PdsA but also contained less contaminants (Supplemental Figure S1). PEC (from PdsA/pdsA) was added to starving pdsA cells every 6 min just after the cAMP bolus. After 6 h of starvation, the supernatant of developed pdsA cells had similar amounts of PdsA compared with WT cells (Figure 1D), showing that the amount of PdsA exogenously provided is similar to what WT cells produce. This treatment bypassed the developmental defect of the pdsA cells. These cells, which will be referred as pdsA/PEC cells, expressed ACA and cAR1 with timing similar to WT cells, although pdsA/PEC cells did express lower levels of cAR1 (Figure 1C). Together, these findings show that the exogenous addition of a PdsA-enriched PEC to pdsA cells successfully rescues their ability to reach the chemotaxis-competent stage.

pdsA/PEC Cells Have Streaming Defects

We next wanted to assess the role of PdsA during chemotaxis to cAMP. We first used the population-based under-agarose assay to examine the ability of cells to chemotax to various concentrations of cAMP. This assay also provides insight into the ability of cells to relay chemotactic signals to neighboring cells as their migration in streams is readily observable when they align in a head-to-tail manner. Figure 2A shows representative images of WT and pdsA/PEC cells migrating to a subset of cAMP concentrations, and Figure 2B summarizes the response to a broader concentration range of cAMP. The ability of WT cells to migrate directionally and align in a head-to-tail manner was readily observable at cAMP concentrations ranging from 100 nM to 100 μM, although the streaming behavior was weaker at 100 nM cAMP. We envision that this is due to the fact that fewer cells respond to low attractant concentrations and that relay (and streaming) requires a minimum cell density to occur. Indeed, we found that the apparent amount of WT cells remaining in the wells decreased with increasing attractant concentration (Figure 2A). In contrast, pdsA/PEC cells responded to a narrower cAMP concentration range, migrating to cAMP concentrations between 250 nM and 50 μM, and, most remarkably, forming abnormal, very thick streams compared with WT cells.

Figure 2.
pdsA/PEC cells migrate to a cAMP source but exhibit streaming defects. (A) WT and pdsA/PEC cells were plated into side wells. The center well contains [cAMP] as indicated on the left. Images were taken 1 h after plating. Images are representative ...

We next observed the migration behavior of WT and pdsA/PEC cells in response to a micropipette filled with cAMP. Here, again we observed that pdsA/PEC cells respond to a narrower cAMP concentration range. Whereas WT cells sensed and responded to cAMP concentrations ranging from 100 nM to 1 mM, pdsA/PEC cells were responsive from 250 nM to 0.1 mM cAMP (data not shown). Furthermore, the pdsA/PEC cells seemed less polar than WT cells, displaying a more round, less elongated shape. Nevertheless, we found that both WT and pdsA/PEC cells reached comparable chemotactic speeds independently of the amount of cAMP in the micropipette (data not shown) and, not surprisingly, pdsA/PEC and WT cells showed a similar ability to polymerize actin in response to chemoattractant addition, showing the characteristic rapid peak of cortical F-actin accumulation followed by a return to pseudopod-associated staining (Supplemental Figure S2). We also found that under normal plating densities (4 × 104 cells/cm2), WT cells streamed during chemotaxis at all cAMP concentration tested (Figure 2C; data not shown). However, as we observed with the under-agarose assay, the pdsA/PEC cells exhibited streaming defects during chemotaxis to a micropipette. Interestingly, we found the streaming behavior of the pdsA/PEC cells to be dependant on the cell plating density to a much greater extent than WT cells. At low cell density (2 × 104 cells/cm2), the migration of WT cells to the back of cells ahead of them was readily visible (Figure 2C and Supplemental Movie 1). In contrast, at similar plating densities, the pdsA/PEC cells migrated toward the needle as individual cells, only occasionally forming short transient groups (Figure 2D and Supplemental Movie 2). At higher densities (6 × 104 cells/cm2), the pdsA/PEC cells migrated in large and thick groups and did not form the characteristic thin lines of cells observed with WT cells (Figure 2, C and D, and Supplemental Movies 1 and 2). Moreover, the thick lines of pdsA/PEC cells that did form did not extend far beyond the micropipette tip and were transient in nature. Together, these findings establish that PdsA is required for cells to sense a broader range of chemoattractant and for proper streaming during chemotaxis.

PEC Alters the Streaming Behavior of WT and pdsA/PEC Cells

We next attempted to rescue the streaming defect of pdsA/PEC cells. We plated developed cells on a glass cover chamber and added PEC isolated from PdsA/pdsA cells or PB, gently mixed to final concentrations of between 12 ng and 5.8 μg protein/ml. The movement of cells was then recorded every minute. Whereas WT cells plated with PB showed extensive streaming after 60 min, pdsA/PEC cells were primarily in small groups or as individual cells, although they did migrate throughout the assay. The addition of PEC at 12 ng/ml did not alter the behavior of either WT or pdsA/PEC cells (data not shown). However, the addition of 580 ng/ml PEC remarkably altered the behavior of both cell lines (the addition of 58 and 120 ng/ml PEC gave rise to less robust effects). WT cells formed small clusters of only three or four cells. In contrast, the pdsA/PEC cells moved into extended branched aggregates, reminiscent of streams (Figure 3 and Supplemental Movies 3 and 4). However, this behavior was dependent on the amount of PEC added. Indeed, at higher concentrations of 1.2 and 5.8 μg/ml, both WT cells and pdsA/PEC cells migrated without streams and formed small aggregates (data not shown). Together, these data show that the ability of cells to properly relay signals and stream is tightly regulated by the presence of PdsA.

Figure 3.
PdsA regulates self-aggregation. Images showing the ability of WT and pdsA/PEC cells to self-aggregate after they are plated at high density. Cells were allowed to reach the chemotaxis-competent stage as described in Materials and Methods, plated ...

Activation and Cellular Distribution of ACA Is Normal in pdsA/PEC Cells

The ability of cells to activate ACA and to secrete cAMP is essential for signal relay and streaming. To determine the mechanism by which PdsA regulates streaming, we assessed the integrity of the ACA signaling cascade in pdsA/PEC cells. In Dictyostelium, the signaling cascade from chemoattractant receptors to ACA is highly regulated, requiring inputs from Gβγ-subunits, phosphatidylinositol 3-kinase, cytosolic regulator of adenylyl cyclase (CRAC), and target of rapamycin complex 2. The exogenous addition of chemoattractants to whole cells leads to a rapid burst in ACA activity followed by a characteristic slow return to basal levels. We found that the activation of ACA in pdsA/PEC cells is similar to WT cells (Figure 4A). These findings establish that PdsA is not required for signals to be properly transduced from chemoattractant receptors to ACA.

Figure 4.
Activation and cellular distribution of ACA is normal in pdsA/PEC cells. (A) Graph depicting the chemoattractant-mediated activation of ACA in WT and pdsA/PEC cells. Cells were stimulated with 10 μM cAMP. Data are representative ...

Because the enrichment of ACA at the back of migrating cells is also required for cells to migrate in a head-to-tail manner, we transfected pdsA cells with our ACA-YFP expression plasmid (Kriebel et al., 2003 blue right-pointing triangle) and assessed the cellular distribution of ACA during chemotaxis and streaming. To further characterize the behavior of pdsA/PEC cells, we also monitored the distribution of the cAMP receptor cAR1-GFP and CRAC-GFP, a pleckstrin homology domain-containing protein necessary for ACA activation and development, in these cells during chemotaxis. We found that, much like in WT cells, cAR1-GFP is uniformly distributed on the plasma membrane in polarized and migrating pdsA/PEC cells as well as in pdsA cells developed in the absence of PEC (Figure 4B). Likewise, CRAC-GFP is redistributed sharply to the leading edge of polarized and migrating WT and pdsA/PEC cells (Figure 4B). Finally, we also determined that ACA-YFP is highly enriched at the back of these cells, much like in WT cells (Figure 4B). As expected, we found that neither CRAC-GFP nor ACA-YFP exhibited a specific redistribution in pdsA cells developed in the absence of added PEC (Figure 4B). These findings establish that the presence of PdsA is not required for cells to adequately transduce signals to ACA. Nor is it required for signaling molecules to be properly distributed during chemotaxis and streaming.

PdsA Localizes to the Endoplasmic Reticulum (ER) during Chemotaxis

We next set out to determine the cellular distribution of PdsA during chemotaxis. We constructed YFP fusions at either the C or N terminus of PdsA (PdsA-YFP and YFP-PdsA) and used the phenotypic rescue of cells lacking PdsA as a readout for function of the fusion protein. Whereas the expression of PdsA-YFP failed to rescue the developmental defect of pdsA cells, YFP-PdsA was able to do so showing characteristic fruiting body formation (Supplemental Figure S3). We developed the YFP-PdsA/pdsA cells to the chemotaxis-competent stage, exposed them to a micropipette containing cAMP, and studied the cellular distribution of YFP-PdsA. We found a dim YFP signal associated with densely packed intracellular structures that did not colocalize with mitochondria or lysosomes (Supplemental Figure S4). Unfortunately, the YFP-PdsA fusion protein was expressed at low levels making it difficult to clearly follow its distribution in live cells. Furthermore, the expression of YFP-PdsA was quickly lost despite constant antibiotic selection, suggesting that the bulky YFP tag renders the protein unstable.

Because the fluorescently tagged PdsA was unstable, we attempted to visualize the cellular distribution of the endogenous protein by using polyclonal antibodies against PdsA. Although a few of them worked very well for Western analyses (see Materials and Methods for details), none worked for immunofluorescence. We therefore tagged PdsA with the Myc epitope (MASMQKLISEED) on either the C or N terminus of the protein. We found that both constructs (Myc-PdsA and PdsA-Myc) rescue the developmental defect of pdsA cells and that rescued cell lines maintained constant expression levels. By adjusting the concentration of antibiotic during selection, we were able to control the expression level of the Myc-tagged proteins and found that cells given 2.5 μg/ml G418 (G2.5) express PdsA-Myc protein at levels similar to either WT or pdsA/PEC cells (Figure 5A). Interestingly, although the antibody to PdsA was able to detect high levels of Myc-PdsA, the Myc antibody did not strongly detect the Myc-PdsA protein by either Western analysis or immunofluorescence. The epitope recognized by the PdsA antibody is nine amino acids downstream of the insertion site of the N-terminal Myc epitope. Whether the recognition of the Myc antibody is masked by the location of the epitope or the recognition of the PdsA antibody is enhanced by the Myc epitope is unclear. Because the PdsA-Myc protein was strongly detected by the Myc antibody and expressed at a similar level than the WT protein, we used the G2.5 PdsA-Myc/pdsA cells for further immunofluorescence analyses.

Figure 5.
PdsA-Myc localizes to the endoplasmic reticulum. (A) Representative Western blot showing the expression of PdsA, Myc-PdsA, or PdsA-Myc in the supernatant of cells starved and pulsed with cAMP for 5 h. (B and C) Confocal fluorescent images of PdsA-Myc/ ...

To examine the cellular distribution of PdsA-Myc, we rapidly fixed actively chemotaxing cells with 100% methanol and processed the samples for immunostaining. As we observed for YFP-PdsA, we found the Myc signal to strongly label densely pack intracellular structures that resemble ER (Figure 5B). Indeed, we observed a perfect colocalization signal when we costained with an antibody against calnexin, an ER-specific type I transmembrane protein (Muller-Taubenberger et al., 2001 blue right-pointing triangle) (Figure 5B). Interestingly, we found the PdsA-Myc signal to be specifically excluded from the perinuclear ER pool. Because biochemical studies have suggested that PdsA is associated with the plasma membrane, we set out to determine whether PdsA-Myc localized to the plasma membrane. We used an antibody against cAR1 to visualize the plasma membrane in PdsA-Myc/pdsA cells and looked for costaining with Myc. We found no colocalization of PdsA-Myc with the plasma membrane (Figure 5C). Although we cannot rule out that the cellular distribution we observe relies on tagged versions of PdsA, the fact that we see a similar distribution using YFP-PdsA or PdsA-Myc, and, more importantly, that both fusion proteins rescue the developmental phenotype of pdsA cells, strongly argues against a nonspecific effect of Myc or YFP. Together, our findings show for the first time that PdsA is closely associated with the ER during chemotaxis. Furthermore, our studies establish that PdsA is not associated with the plasma membrane during chemotaxis.

DISCUSSION

In this study, we show that chemoattractant degradation is essential for cells to optimally sense external chemical gradients. We show that cells lacking PdsA can reach the chemotaxis-competent stage by exogenously providing PdsA during development. These pdsA/PEC cells are able to migrate directionally to an exogenous gradient of cAMP and show normal, robust polarized F-actin assembly. As expected, we found that pdsA/PEC cells migrate directionally to a narrower range of chemoattractant concentration gradients. We reasoned that when exposed to high cAMP concentration gradients, the receptors become quickly saturated, and the cells cannot sense any difference between their front and back. In contrast, at low cAMP concentration gradients, the pdsA/PEC cells cannot distinguish the exogenously applied stimulus from the endogenous cAMP they produce and they do not respond chemotactically. However, we were surprised to find that the pdsA/PEC cells still show a significant chemoattractant response range. It therefore seems that the intrinsic dynamic range of receptor activation is able to withstand wide variations in external attractant concentrations. In contrast, we cannot rule out that the lower cAR1 levels present in pdsA/PEC cells also account for the narrower range of responsiveness observed in these cells.

We discovered that the absence of PdsA dramatically alters the ability of cells to migrate in groups. Using the under-agarose assay, in which cell motion is restricted and the diffusion of large molecules, such as PdsA, is slowed (Johnson et al., 1996 blue right-pointing triangle), the pdsA/PEC cells migrated in a disordered manner, showing broad twisted streams as opposed to the single-file head-to-tail arrays observed in WT cells. In the needle assay, the external cAMP signal diffuses from a point source forming a radial gradient convergent at the needle. In this assay, WT cells formed clear, finely branched streams that dominated the field of view at high cell density. Alternatively, the migration behavior of pdsA/PEC cells showed a significant dependence on plating density. In addition, when streams formed they were not persistent and favored cells traveling parallel to each other rather than in head-to-tail lines akin to what we observed with the under-agarose assay. Because we found that the absence of PdsA did not regulate the signal relay machinery (the extent and timing of the chemoattractant-mediated activation of ACA as well as the cellular distribution of ACA and CRAC were comparable to what is observed in WT cells), we conclude that the streaming defect we observed is associated with the effect of PdsA on the external cAMP gradient field. We speculate that without degradation, a local collection of cells produces more cAMP favoring the formation of thick aggregates. In WT cells, locally dense cell regions have a locally higher concentration of PdsA, making large clusters unfavorable.

We also found that the addition of exogenous PdsA dramatically disrupts the intrinsic ability of WT cells to stream and, most remarkably, it induced pdsA/PEC cells to migrate in groups and form streams. However, the migration behavior of the pdsA/PEC cells treated with PdsA was distinct from WT cells treated with PB. The streams in the treated pdsA/PEC cells were thicker and did not branch out to the extent that the WT cells did. It therefore seems that the addition of a bolus of PdsA is not optimal to induce normal streaming and branching. Using cell fractionation, it has been proposed that PdsA is present in both soluble and plasma membrane-bound forms (Malchow et al., 1972 blue right-pointing triangle; Blondelet and Brachet, 1981 blue right-pointing triangle; Bader et al., 2007 blue right-pointing triangle). We now show that PdsA is not associated with the plasma membrane and that it is found exclusively on the ER. We presume that ER contamination in the plasma membrane fractions is responsible for the earlier findings. Because a uniform bolus of PdsA is not sufficient to fully restore the streaming ability of pdsA/PEC cells, we envision that a controlled and perhaps local secretion of the PdsA is involved. The secretion would be difficult to visualize. In fixed cells, secreted PdsA will be lost and with live cells, the YFP-PdsA is not expressed high enough to visualize. Furthermore, biochemical assays are not sensitive enough to detect PdsA secretion in a timely manner (Malchow et al., 1972 blue right-pointing triangle). Nevertheless, we envision that coupled with the asymmetric distribution of ACA at the back of cells, this local pool of PdsA would ultimately favor migration in single-file lines.

Considering that the diffusion rate of cAMP is 2 orders of magnitude faster compared with the reported hydrolysis rate of cAMP by secreted PdsA (Gerisch, 1976 blue right-pointing triangle; Nanjundiah and Malchow, 1976 blue right-pointing triangle; Bader et al., 2007 blue right-pointing triangle), our finding that only a soluble form of PdsA is available to degrade the cAMP signal and that its activity affects the shape of streams is surprising. Indeed, a computational investigation of the cAMP gradient field produced by signal relay determined that secreted PdsA does little to sharpen the gradient field and assist streaming (Tang and Othmer, 1995 blue right-pointing triangle). Conversely, the activity of PdsA has been shown to be modulated by the presence of an inhibitor (PDI; phosphodiesterase inhibitor) that is expressed at different levels during development (Gerisch et al., 1972 blue right-pointing triangle; Franke and Kessin, 1981 blue right-pointing triangle), and when cells are pulsed with small amounts of cAMP (as in our study), the expression of the inhibitor is reduced and the activity of PdsA increases by ~2 orders of magnitude (Yeh et al., 1978 blue right-pointing triangle). Under these conditions, our hypothesis that the secreted form of PdsA regulates cAMP gradients and group migration is more likely.

The transition of Dictyostelium from single to group cell behavior has been the subject of many modeling studies. In the majority of the papers published, cAMP is proposed to be uniformly emitted by cells in response to a cAMP signal, and the phosphodiesterase activity is either distributed uniformly extracellularly in space and time (Levine and Reynolds, 1991 blue right-pointing triangle; Levine et al., 1996 blue right-pointing triangle; Sawai et al., 2005 blue right-pointing triangle), associated with the plasma membrane, or both (Pate and Odell, 1981 blue right-pointing triangle; Tang and Othmer, 1995 blue right-pointing triangle). Although both models are capable of reproducing many features of Dictyostelium aggregation, including the propagation of cAMP waves in characteristic spirals and the formation of stream-like aggregates, they are not perfect. In previous work, we have proposed that the secretion of cAMP is spatially restricted (Kriebel et al., 2003 blue right-pointing triangle, 2008 blue right-pointing triangle). We now show that only the secreted form of PdsA can degrade the external cAMP signal and that the addition of a uniform bolus of PdsA does not lead to the formation of highly branched, head-to-tail lines characteristic of WT streaming. It will therefore be interesting to see how including these new parameters improves the mathematical models that describe aggregation and streaming.

Although our study clearly defines an important role for extracellular chemoattractant degradation in the context of Dictyostelium chemotaxis and streaming, we envision that similar mechanisms are at play to regulate mammalian cell chemotaxis. In leukocyte migration and inflammation, a role for various proteases as well as internalization of bound receptor by decoy receptors has been suggested to remove attractant molecules and regulate chemoattractant gradients (Borroni et al., 2008 blue right-pointing triangle; Friedl and Weigelin, 2008 blue right-pointing triangle; Leung et al., 2008 blue right-pointing triangle; Scola et al., 2008 blue right-pointing triangle). Interestingly, the pathogenic bacteria Pseudomonas aeruginosa seems to use degradation of proinflammatory factors to prevent host defenses from fighting the infection (Leidal et al., 2003 blue right-pointing triangle). In addition, Drosophila germ cell migration is negatively regulated by two lipid phosphatases (wunen and wunen-2) that are expressed by somatic cells. These phosphatases dephosphorylate lysophospholipids and provide repellent cues that steer the migrating cells toward the proper environment (Renault and Lehmann, 2006 blue right-pointing triangle). In zebrafish development, germ cell migration is guided by the chemokine stromal cell-derived factor-1 (SDF-1). The CXCR4 receptor on migrating cells has been shown to guide their chemotaxis; however, mutations that control receptor internalization, and thereby signaling levels, have been shown to affect the precision of chemotaxis (Minina et al., 2007 blue right-pointing triangle). In addition, CXCR7, which also binds SDF-1, is expressed in somatic tissue and seems to influence SDF-1 gradient formation by internalizing the attractant along the migration route (Boldajipour et al., 2008 blue right-pointing triangle). It therefore seems that regulated attractant degradation allows a variety of cells to follow precise chemotactic path in complex environments.

Supplementary Material

[Supplemental Materials]

ACKNOWLEDGMENTS

We thank Richard Kessin for providing the pdsA cells. In addition, we thank the members of the Parent laboratory and the groups of Alan Kimmel, Tian Jin, and Wolfgang Losert for many helpful discussions and suggestions. This work was supported by the Intramural Research Program at the Center for Cancer Research, National Cancer Institute, National Institutes of Health and National Institute of Standards and Technology Center for Theoretical and Computational Materials Science grant 60NANB6D61200. E.C.R. is a recipient of a Career Award at the Scientific Interface from the Burroughs Wellcome fund.

Footnotes

This article was published online ahead of print in MBC in Press (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E09-03-0223) on May 28, 2009.

REFERENCES

  • Aubry L., Firtel R. Integration of signaling networks that regulate Dictyostelium differentiation. Annu. Rev. Cell Dev. Biol. 1999;15:469–517. [PubMed]
  • Bader S., Kortholt A., Van Haastert P. J. Seven Dictyostelium discoideum phosphodiesterases degrade three pools of cAMP and cGMP. Biochem. J. 2007;402:153–161. [PMC free article] [PubMed]
  • Bagorda A., Mihaylov V. A., Parent C. A. Chemotaxis: moving forward and holding on to the past. Thromb. Haemost. 2006;95:12–21. [PubMed]
  • Barra J., Barrand P., Blondelet M. H., Brachet P. pdsA, a gene involved in the production of active phosphodiesterase during starvation of Dictyostelium discoideum amoebae. Mol. Gen. Genet. 1980;177:607–613. [PubMed]
  • Blondelet M. H., Brachet P. The hydrophobic character of the membrane-bound phosphodiesterase from Dictyostelium discoideum. Biochim. Biophys. Acta. 1981;640:572–582. [PubMed]
  • Boldajipour B., Mahabaleshwar H., Kardash E., Reichman-Fried M., Blaser H., Minina S., Wilson D., Xu Q., Raz E. Control of chemokine-guided cell migration by ligand sequestration. Cell. 2008;132:463–473. [PubMed]
  • Bolourani P., Spiegelman G. B., Weeks G. Delineation of the roles played by RasG and RasC in cAMP-dependent signal transduction during the early development of Dictyostelium discoideum. Mol. Biol. Cell. 2006;17:4543–4550. [PMC free article] [PubMed]
  • Borroni E. M., Bonecchi R., Buracchi C., Savino B., Mantovani A., Locati M. Chemokine decoy receptors: new players in reproductive immunology. Immunol. Invest. 2008;37:483–497. [PubMed]
  • Brown S. S., Rutherford C. L. Localization of cyclic nucleotide phosphodiesterase in the multicellular stages of Dictyostelium discoideum. Differentiation. 1980;16:173–183. [PubMed]
  • Chisholm R. L., Firtel R. A. Insights into morphogenesis from a simple developmental system. Nat. Rev. Mol. Cell Biol. 2004;5:531–541. [PubMed]
  • Comer F. I., Lippincott C. K., Masbad J. J., Parent C. A. The PI3K-mediated activation of CRAC independently regulates adenylyl cyclase activation and chemotaxis. Curr. Biol. 2005;15:134–139. [PubMed]
  • Comer F. I., Parent C. A. Phosphoinositide 3-kinase activity controls the chemoattractant-mediated activation and adaptation of adenylyl cyclase. Mol. Biol. Cell. 2006;17:357–366. [PMC free article] [PubMed]
  • Darmon M., Barra J., Brachet P. The role of phosphodiesterase in aggregation of Dictyostelium discoideum. J. Cell Sci. 1978;31:233–243. [PubMed]
  • Devreotes P. N. G protein-linked signaling pathways control the developmental program of Dictyostelium. Neuron. 1994;12:235–241. [PubMed]
  • Faure M., Podgorski G. J., Franke J., Kessin R. H. Disruption of Dictyostelium discoideum morphogenesis by overproduction of cAMP phosphodiesterase. Proc. Natl. Acad. Sci. USA. 1988;85:8076–8080. [PMC free article] [PubMed]
  • Faure M., Podgorski G. J., Franke J., Kessin R. H. Rescue of a Dictyostelium discoideum mutant defective in cyclic nucleotide phosphodiesterase. Dev. Biol. 1989;131:366–372. [PubMed]
  • Franke J., Kessin R. H. The cyclic nucleotide phosphodiesterase inhibitory protein of Dictyostelium discoideum. Purification and characterization. J. Biol. Chem. 1981;256:7628–7637. [PubMed]
  • Franke J., Kessin R. H. The cyclic nucleotide phosphodiesterases of Dictyostelium discoideum: molecular genetics and biochemistry. Cell Signal. 1992;4:471–478. [PubMed]
  • Friedl P., Weigelin B. Interstitial leukocyte migration and immune function. Nat. Immunol. 2008;9:960–969. [PubMed]
  • Garcia G. L., Parent C. A. Signal relay during chemotaxis. J. Microsc. 2008;231:529–534. [PMC free article] [PubMed]
  • Gerisch G. Extracellular cyclic-amp phosphodiesterase regulation in agar plate cultures of Dictyostelium discoideum. Cell Differ. 1976;5:21–25. [PubMed]
  • Gerisch G., Malchow D., Riedel V., Muller E., Every M. Cyclic AMP phosphodiesterase and its inhibitor in slime mould development. Nat. New Biol. 1972;235:90–92. [PubMed]
  • Hereld D., Vaughan R., Kim J. Y., Borleis J., Devreotes P. Localization of ligand-induced phosphorylation sites to serine clusters in the C-terminal domain of the Dictyostelium cAMP receptor, cAR1. J. Biol. Chem. 1994;269:7036–7044. [PubMed]
  • Insall R., Andrew N. Chemotaxis in Dictyostelium: how to walk straight using parallel pathways. Curr. Opin. Microbiol. 2007;10:578–581. [PubMed]
  • Insall R., Kuspa A., Lilly P. J., Shaulsky G., Levin L. R., Loomis W. F., Devreotes P. CRAC, a cytosolic protein containing a pleckstrin homology domain, is required for receptor and G protein-mediated activation of adenylyl cyclase in Dictyostelium. J. Cell Biol. 1994;126:1537–1545. [PMC free article] [PubMed]
  • Janetopoulos C., Firtel R. A. Directional sensing during chemotaxis. FEBS Lett. 2008;582:2075–2085. [PMC free article] [PubMed]
  • Janetopoulos C., Jin T., Devreotes P. Receptor-mediated activation of heterotrimeric G-proteins in living cells. Science. 2001;291:2408–2411. [PubMed]
  • Johnson E. M., Berk D. A., Jain R. K., Deen W. M. Hindered diffusion in agarose gels: test of effective medium model. Biophys. J. 1996;70:1017–1023. [PMC free article] [PubMed]
  • Johnson R. L., Vaughan R. A., Caterina M. J., Van Haastert P. J., Devreotes P. N. Overexpression of the cAMP receptor 1 in growing Dictyostelium cells. Biochemistry. 1991;30:6982–6986. [PubMed]
  • Kay R. R., Langridge P., Traynor D., Hoeller O. Changing directions in the study of chemotaxis. Nat. Rev. Mol. Cell Biol. 2008;9:455–463. [PubMed]
  • Kolsch V., Charest P. G., Firtel R. A. The regulation of cell motility and chemotaxis by phospholipid signaling. J. Cell Sci. 2008;121:551–559. [PMC free article] [PubMed]
  • Kortholt A., van Haastert P. J. Highlighting the role of Ras and Rap during Dictyostelium chemotaxis. Cell Signal. 2008;20:1415–1422. [PubMed]
  • Kriebel P. W., Barr V. A., Parent C. A. Adenylyl cyclase localization regulates streaming during chemotaxis. Cell. 2003;112:549–560. [PubMed]
  • Kriebel P. W., Barr V. A., Rericha E. C., Zhang G., Parent C. A. Collective cell migration requires vesicular trafficking for chemoattractant delivery at the trailing edge. J. Cell Biol. 2008;183:949–961. [PMC free article] [PubMed]
  • Lacombe M. L., Podgorski G. J., Franke J., Kessin R. H. Molecular cloning and developmental expression of the cyclic nucleotide phosphodiesterase gene of Dictyostelium discoideum. J. Biol. Chem. 1986;261:16811–16817. [PubMed]
  • Leidal K. G., Munson K. L., Johnson M. C., Denning G. M. Metalloproteases from Pseudomonas aeruginosa degrade human RANTES, MCP-1, and ENA-78. J. Interferon Cytokine Res. 2003;23:307–318. [PubMed]
  • Leung L. L., Myles T., Nishimura T., Song J. J., Robinson W. H. Regulation of tissue inflammation by thrombin-activatable carboxypeptidase B (or TAFI) Mol. Immunol. 2008;45:4080–4083. [PMC free article] [PubMed]
  • Levine H., Aranson I., Tsimring L., Truong T. V. Positive genetic feedback governs cAMP spiral wave formation in Dictyostelium. Proc. Natl. Acad. Sci. USA. 1996;93:6382–6386. [PMC free article] [PubMed]
  • Levine H., Reynolds W. Streaming instability of aggregating slime mold amoebae. Phys. Rev. Lett. 1991;66:2400–2403. [PubMed]
  • Mahadeo D. C., Parent C. A. Signal relay during the life cycle of Dictyostelium. Curr. Top. Dev. Biol. 2006;73:115–140. [PubMed]
  • Malchow D., Nagele B., Schwartz H., Gerisch G. Membrane-bound cyclic AMP phosphodiesterase in chemotactically responding cells of Dictyostelium discoideum. Eur. J. Biochem. 1972;28:136–142. [PubMed]
  • Manahan C. L., Iglesias P. A., Long Y., Devreotes P. N. Chemoattractant signaling in Dictyostelium discoideum. Annu. Rev. Cell Dev. Biol. 2004;20:223–253. [PubMed]
  • McMains V. C., Liao X. H., Kimmel A. R. Oscillatory signaling and network responses during the development of Dictyostelium discoideum. Ageing Res. Rev. 2008;7:234–248. [PubMed]
  • Minina S., Reichman-Fried M., Raz E. Control of receptor internalization, signaling level, and precise arrival at the target in guided cell migration. Curr. Biol. 2007;17:1164–1172. [PubMed]
  • Muller-Taubenberger A., Lupas A. N., Li H. W., Ecke M., Simmeth E., Gerisch G. Calreticulin and calnexin in the endoplasmic reticulum are important for phagocytosis. EMBO J. 2001;20:6772–6782. [PMC free article] [PubMed]
  • Nanjundiah V., Malchow D. A theoretical study of the effects of cyclic AMP phosphodiesterases during aggregation in Dictyostelium. J. Cell Sci. 1976;22:49–58. [PubMed]
  • Orlow S. J., Shapiro I., Franke J., Kessin R. H. The extracellular cyclic nucleotide phosphodiesterase of Dictyostelium discoideum. Purification and characterization. J. Biol. Chem. 1981;256:7620–7627. [PubMed]
  • Pang K. M., Lynes M. A., Knecht D. A. Variables controlling the expression level of exogenous genes in Dictyostelium. Plasmid. 1999;41:187–197. [PubMed]
  • Parent C. A., Blacklock B. J., Froehlich W. M., Murphy D. B., Devreotes P. N. G protein signaling events are activated at the leading edge of chemotactic cells. Cell. 1998;95:81–91. [PubMed]
  • Parent C. A., Devreotes P. N. Isolation of inactive and G protein-resistant adenylyl cyclase mutants using random mutagenesis. J. Biol. Chem. 1995;270:22693–22696. [PubMed]
  • Parent C. A., Devreotes P. N. Molecular genetics of signal transduction in Dictyostelium. Annu. Rev. Biochem. 1996;65:411–440. [PubMed]
  • Pate E. F., Odell G. M. A computer simulation of chemical signaling during the aggregation phase of Dictyostelium discoideum. J. Theor. Biol. 1981;88:201–239.
  • Pitt G. S., Milona N., Borleis J., Lin K. C., Reed R. R., Devreotes P. N. Structurally distinct and stage-specific adenylyl cyclase genes play different roles in Dictyostelium development. Cell. 1992;69:305–315. [PubMed]
  • Renault A. D., Lehmann R. Follow the fatty brick road: lipid signaling in cell migration. Curr. Opin. Genet Dev. 2006;16:348–354. [PubMed]
  • Sambrook J. Molecular Cloning: A laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 2001.
  • Saran S., Meima M. E., Alvarez-Curto E., Weening K. E., Rozen D. E., Schaap P. cAMP signaling in Dictyostelium—complexity of cAMP synthesis, degradation and detection. J. Muscle Res. Cell Motil. 2002;23:793–802. [PubMed]
  • Sawai S., Thomason P. A., Cox E. C. An autoregulatory circuit for long-range self-organization in Dictyostelium cell populations. Nature. 2005;433:323–326. [PubMed]
  • Scola A. M., Johswich K. O., Morgan B. P., Klos A., Monk P. N. The human complement fragment receptor, C5L2, is a recycling decoy receptor. Mol. Immunol. 2008;46:1149–1162. [PMC free article] [PubMed]
  • Stephens L., Milne L., Hawkins P. Moving towards a better understanding of chemotaxis. Curr. Biol. 2008;18:R485–R494. [PubMed]
  • Sucgang R., Weijer C. J., Siegert F., Franke J., Kessin R. H. Null mutations of the Dictyostelium cyclic nucleotide phosphodiesterase gene block chemotactic cell movement in developing aggregates. Dev. Biol. 1997;192:181–192. [PubMed]
  • Sussmann M. Biochemical and genetic methods in the study of cellular slime mold development. In: Prescott D., editor. Methods in Cell Physiology. vol. 2. New York: Academic Press; 1966. pp. 397–410.
  • Tang Y., Othmer H. G. Excitation, oscillations and wave propagation in a G-protein-based model of signal transduction in Dictyostelium discoideum. Philos. Trans. R. Soc. Lond. B Biol. Sci. 1995;349:179–195. [PubMed]
  • Urushihara H. Developmental biology of the social amoeba: history, current knowledge and prospects. Dev Growth Differ. 2008;50(suppl 1):S277–S281. [PubMed]
  • van Haastert P.J.M., Devreotes P. N. Chemotaxis: signalling the way forward. Nat. Rev. Mol. Cell. Biol. 2004;5:626–634. [PubMed]
  • Van Lint P., Libert C. Chemokine and cytokine processing by matrix metalloproteinases and its effect on leukocyte migration and inflammation. J. Leukoc. Biol. 2007;82:1375–1381. [PubMed]
  • Weeks G. Signalling molecules involved in cellular differentiation during Dictyostelium morphogenesis. Curr. Opin. Microbiol. 2000;3:625–630. [PubMed]
  • Yamasaki F., Hayashi H. Comparison of properties of the cellular and extracellular phosphodiesterases induced by cyclic adenosine 3′,5′-monophosphate in Dictyostelium discoideum. J. Biochem. 1982;91:981–988. [PubMed]
  • Yeh R. P., Chan F. K., Coukell M. B. Independent regulation of the extracellular cyclic AMP phosphodiesterase-inhibitor system and membrane differentiation by exogenous cyclic AMP in Dictyostelium discoideum. Dev. Biol. 1978;66:361–374. [PubMed]

Articles from Molecular Biology of the Cell are provided here courtesy of American Society for Cell Biology
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...