• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of pnasPNASInfo for AuthorsSubscriptionsAboutThis Article
Proc Natl Acad Sci U S A. Jul 14, 2009; 106(28): 11564–11569.
Published online Jul 1, 2009. doi:  10.1073/pnas.0904477106
PMCID: PMC2710658
Biochemistry

The role of transposable elements in the regulation of IFN-λ1 gene expression

Abstract

IFNs λ1, λ2, and λ3, or type III IFNs, are recently identified cytokines distantly related to type I IFNs. Despite an early evolutionary divergence, the 2 types of IFNs display similar antiviral activities, and both are produced primarily in dendritic cells. Although virus induction of the type I IFN-β gene had served as a paradigm of gene regulation, relatively little is known about the regulation of IFN-λ gene expression. Studies of virus induction of IFN-λ1 identified an essential role of IFN regulatory factors (IRF) 3 and 7, which bind to a regulatory DNA sequence near the start site of transcription. Here, we report that the proximal promoter region of the IFN-λ1 regulatory region is not sufficient for maximal gene induction in response to bacterial LPS, and we identify an essential cluster of homotypic NF-κB binding sites. Remarkably, these sites, which bind efficiently to NF-κB and function independently of the IRF3/7 binding sites, originate as transposable elements of the Alu and LTR families. We also show that depletion of the NF-κB RelA protein significantly reduces the level of the IFN-λ1 gene expression. We conclude that IFN-λ1 gene expression requires NF-κB, and we propose a model for IFN-λ1 gene regulation, in which IRF and NF-κB activate gene expression independently via spatially separated promoter elements. These observations provide insights into the independent evolution of the IFN-λ1 and IFN-β promoters and directly implicate transposable elements in the regulation of the IFN-λ1 gene by NF-κB.

Keywords: gene regulation, interferon, transcription enhancer, NF-κB, Alu repeats

Interferons (IFNs) λ1, λ2, and λ3 (or IL-29, IL-28A, IL-28B) are members of the class II family of cytokines evolutionarily related to both IL-10 and type I IFNs (IFN-α/β). The genomic organization of IFN-λs (5 exons, 4 introns) resembles that of IL-10 and nonamniote type I IFNs, whereas type I IFNs are intronless. The similar genomic structure of the primordial IFN genes suggests that both type I IFNs, IFN-λs and IL-10, arose from a common ancestor early in evolution (1). A retroposition event leading to the replacement of the intron-containing IFN gene by an intronless IFN transcript, was followed by expansion of the mammalian IFN subclasses (2). The functional significance of multiple copies of IFNs is not understood, but may relate to the increasing number of pathogens or immune/physiological changes that these molecules responded to during evolution. In humans, the genes encoding IFN-λ1, λ2, and λ3 are located on the chromosome 19q13. IFN-λ2 and IFN-λ3 appear to be the result of a recent gene-duplication event and are virtually identical with a 96% amino acid identity and similar promoter sequences (3). The IFN-λ1 gene is found exclusively in primate genomes and is 81% identical to IFN-λ2/3. IFN-λs, which are now collectively referred to as type III IFNs, exhibit several features in common with type I IFNs, such as antiviral, antiproliferative, and antitumor activities (4). Although they act via unrelated receptors (5), both type I IFNs and IFN-λs induce the activation of JAK/STAT signaling pathways (6), resulting in transcriptional induction of “IFN-stimulated genes,” which mediate the antiviral effect of IFN (7).

The initial studies of IFN-λ gene regulation relied heavily on a comparative analysis with the well-characterized type I IFN gene system (8, 9). Induction of the human IFN-β gene in response to viral infection requires the coordinate activation of the transcription factors (TFs) NF-κB, AP-1, and IFN regulatory factors 3/7 (IRF3/7) (10). Virus infection leads to the phosphorylation of constitutively expressed IRF3 by IκB kinase (IKK)-like kinases IKK-ε and TBK-1 (11, 12), leading to its dimerization and translocation to the nucleus, where it binds IRF recognition sequences in the promoters of virus-inducible genes such as IFN-β. TBK-1 and IRF3 are also required for IFN-λ transcriptional gene regulation, as indicated by studies of mouse embryonic fibroblasts derived from mice deficient in TBK-1 or IRF3 (8). A search for the cis-regulatory elements in the proximal ≈600 nt of the IFN-λ1 gene promoter revealed a cluster of IRF binding sites and a κB site, suggesting that IFN-λ1 and IFN-β might be regulated by a common mechanism. This possibility was further supported by cotransfection experiments of various IRF expression constructs with IFN-λ1 proximal promoter-driven reporter constructs, which suggested that the IFN-λ1 gene was regulated by virus-induced IRF3 and IRF7 and resembled the IFN-β gene. By contrast, the IFN-λ2/3 genes, which are expressed at significantly lower levels, were found to be controlled mainly by IRF7 similar to that of IFN-α genes (9).

A major difference between the type I and III IFN systems is the cell type-restricted nature of the type III IFN response. In contrast to almost ubiquitous expression of type I IFNs and their receptor, which results in a widespread protective antiviral immunity, IFN-λR1 is expressed primarily on epithelial and plasmacytoid dendritic cells (pDCs), contributing to the prevention of viral invasion through skin and mucosal surfaces (13). DCs are also the major producers of IFN-λs in response to virus induction or Toll-like receptor (TLR) signaling (14). Although the expression of IFN-α, IFN-β, and IFN-λ genes in pDCs and monocyte-derived DCs (MDDCs) appear to be regulated in a similar fashion upon viral infection, TLR4 stimulation by LPS induces the coordinated expression of IFN-β and IFN-λ, but not IFN-α, genes in MDDCs (14). Moreover, IFN-λ-treated DCs can induce proliferation of Treg cells (15). Thus, in addition to their role in antiviral responses, IFN-λs may play a role in the host response to bacterial infection and influence immune effector mechanisms.

Here, we investigate the regulation of IFN-λ1 gene expression in LPS-induced human MDDCs. We used a combination of bioinformatic and biochemical approaches to identify regulatory elements required for LPS induction within the IFN-λ1 genomic locus. We identified a cluster of homotypic NF-κB binding sites distal to the promoter that is required for maximum levels of IFN-λ1 gene expression in response to LPS. Contrary to the similarity in transcriptional regulation of IFN-λ1 and IFN-β suggested previously (8, 9), our results indicate that the organization of the IFN-λ1 enhancer differs significantly from the IFN-β enhanceosome. Our data support the recent proposal that there are fundamental differences in type I and type III IFN gene expression (13).

Results

Distal Regulatory Elements Are Required for LPS-Induced Expression of IFN-λ1 in Primary Human Myeloid Cells.

Previous studies demonstrated that LPS-induced differentiation of MDDCs result in the rapid and robust expression of the IFN-λ1 gene (16). Here, we show that in addition to MDDCs, IFN-λ1 expression is significantly induced in the human M-CSF- and GM-CSF-derived macrophages (MPHs) (105- and 104-fold, respectively) (17) (Fig. S1A), contrary to a previous study (16). The mRNA expression peaked at ≈2 h after LPS induction (Fig. S1B) and had similar kinetics in MDDCs and MPHs.

To understand the molecular mechanisms involved in IFN-λ1 gene expression, we examined the promoter structure of the gene with a comparative genomics approach and identified punctuated islands of sequence conservation extending as far as 5 Kbp upstream of the IFN-λ1 transcription start site. No significant conservation was observed distal to that region. Next, we generated 2 luciferase-reporter constructs driven by: (i) 5,068 nt encompassing all conserved islands, and (ii) 1,106 nt encompassing the conserved region most proximal to the gene. These were assembled into adenoviruses (18) to facilitate their delivery into MPHs and MDDCs, which are notoriously difficult to transfect. With the efficiency of DNA delivery approaching 100% and no significant effect on the resting cells (measured by endogenous IFN-λ1 and IP-10 response), both constructs demonstrated the LPS-inducible reporter activity, but the response was significantly stronger for the −5,068 construct in all myeloid cells tested (Fig. 1 A–C).

Fig. 1.
LPS-induced transcriptional activation of the IFN-λ1 gene requires distal promoter region that encompasses 4 putative κB sites within transposable elements. (A–C) The LPS-induced activity of the −5,068-nt driven luciferase-reporter ...

We conclude that the most proximal region of 1,106 nt, which contains the previously described virus-inducible promoter of the IFN-λ1 gene (8), is not sufficient for maximal levels of induction by LPS.

The Distal Upstream Region Contains 4 Putative κB Sites Introduced by a Transposable Element.

To dissect the contribution of various segments between the −5,068 nt and −1,106 nt upstream of the transcription start site, we generated 2 intermediate luciferase-reporter constructs, driven by 3,209 and 1,901 nt of the upstream region. The deletion set was transfected into HEK-293-TLR4/MD2-CD14 cells, in which a robust and transient expression of endogenous IFN-λ1 mRNA was detected after LPS stimulation. We detected a significantly higher activity of the reporter gene driven by either −5,068-, −3,209-, or −1,901-nt upstream sequences compared with the −1,106-nt one (Fig. 1D). Next, we examined the region between −1,901 and −1,106 nt, which appeared to be sufficient for most of the gene induction by LPS, for the presence of putative binding sites. We identified a cluster of 4 putative NF-κB binding sites in this region, named here as κB3–κB6 (Fig. 1E). Closer analysis of the genomic region encompassing the cluster of κB sites revealed that all are located within the transposable elements: site κB5 is in the Alu Sx repeat, flanked by 2 MLT2b2 LTRs of class L endogenous retroviruses (ERVLs) that contain sites κB3, κB4, and κB6.

Together, these results suggest that LPS induction of the IFN-λ1 gene requires the NF-κB activation pathway, which acts through the distal cluster of κB sites. These sites originate from the insertion of the Alu Sx repeat flanked by ERVL LTR repeats.

Distal κB Sites in the Transposable Elements Bind NF-κB.

EMSA analysis of NF-κB binding using nuclear proteins extracted from MDDCs revealed the binding of 2 major complexes, a p50p50 homodimer and a RelAp50 heterodimer to the 2 proximal κB sites (κB1 and κB2) and 3 distal κB sites (κB3, κB5, κB6), as shown by supershift assays with antibodies against p50 and RelA (Fig. 2A). Further evaluation of binding affinities of the κB binding sites using a series of protein dilutions of recombinant RelAp50 indicated that the distal κB3, κB5, and κB6 sites have the highest affinities, whereas κB4 site did not efficiently bind RelAp50 (Fig. S2). In MDDCs, we also noted that the 3 distal κB sites display a somewhat higher affinity for NF-κB than the 2 proximal sites. Furthermore, ChIP analysis of in vivo association of RelA with the proximal and distal promoter regions of the IFN-λ1 gene in MDDCs revealed a stronger and faster recruitment of RelA to the distal cluster of κB sites after induction with LPS (Fig. 2B).

Fig. 2.
NF-κB binds to the distal κB elements in MDDCs. (A) Nuclear extracts from resting or MDDCs stimulated with LPS for 1 h were used in an EMSA-supershift experiment with radioactive probes corresponding to κB1, κB2, κB3, ...

κB Sites in the Transposable Elements Are Required for Maximal Levels of IFN-λ1 Gene Expression in Response to LPS.

To examine the contribution of individual κB sites to LPS induction of the IFN-λ1 gene, site-specific mutations in the κB sites were generated in the background of the −1,901-nt construct. In the proximal promoter region, disruption of IRF binding to the ISRE site significantly reduced the LPS-induced reporter activity, whereas disruption of NF-κB binding to the site κB2 had little effect (Fig. 3). Partial removal of NF-κB binding to the distal region either at sites κB3 and κB4 or sites κB5 and κB6 drastically reduced the level of promoter activity (Fig. 3), with the remaining ≈2-fold induction similar to the one displayed by the −1,106 reporter construct (Fig. 1D). We note that disruption of NF-κB binding to individual distal κB sites had little effect on gene reporter expression (Fig. S3), possibly because of the compensatory mechanisms within the cluster.

Fig. 3.
NF-κB binding to the distal cluster is required for maximal IFN-λ1 promoter activity. The activity of the −1,901-nt wild-type and site-specific mutants as indicated in the scheme (1-way ANOVA test) is shown as the mean and SEM ...

These observations suggest that the organization of the distal promoter region has evolved to ensure a robust transcriptional response. In a homotypic cluster, the disruption of individual binding sites can be tolerated, as the presence of other sites compensate. However, all sites may contribute to the overall sensitivity of the transcriptional response (19).

NF-κB RelA Is Required for Maximum Levels of IFN-λ1 Gene Expression.

Based on the above results, we hypothesized that NF-κB RelA binding to the distal cluster of κB sites is a key regulatory event in the activation of the IFN-λ1 gene by LPS. Thus, we analyzed IFN-λ1 mRNA expression in HEK-293-TLR4/MD2-CD14 cells in which the levels of individual NF-κB subunits were knocked down by RNAi. The efficiency of each knockdown was normally >85% (Fig. S4A). Approximately 20-fold reduction in mRNA levels was observed when RelA or IRF3 were knocked down (Fig. 4A), and it was validated by independent siRNA reagents (Fig. S4B). Inhibition of other NF-κB subunits resulted in a moderate effect (c-Rel, p100/p52) or had no effect (RelB, p105/p50) on gene expression (Fig. 4A). The effect of the siRNA knockdown of RelA and IRF3 was also examined in MDDCs stimulated with LPS, and significantly lower levels of IFN-λ1 mRNA were observed (Fig. S4C). To further validate the key role of RelA in IFN-λ1 gene expression, we coexpressed 5 NF-κB subunits and 3 IRF proteins (IRF3, IRF5, IRF7) together with the −1,901 gene reporter construct. All protein expression constructs were generated in the same expression vector, HA-tagged, and resulted in similar levels of protein expression. Only RelA, IRF3, and IRF7 were able to activate endogenous gene expression (Fig. S4D).

Fig. 4.
NF-κB RelA and IRF3/7 activate IFN-λ1 via spatially separated (distal and proximal) promoter elements. (A) The inhibition of RelA and IRF3 has the strongest effect on IFN-λ1 mRNA expression in HEK-293-TLR4/MD2-CD14 cells stimulated ...

We conclude that NF-κB RelA and IRF3/7 are required for LPS induction of IFN-λ1 gene expression.

NF-κB and IRFs Activate IFN-λ1 via Spatially Separated Promoter Elements.

We next examined the sequence requirements for NF-κB RelA and IRF3-mediated activation of the IFN-λ1 gene by coexpressing these proteins together with either the −1,901 or −1,106 gene reporter constructs (Fig. 4B). The induction of the −1,901 construct by RelA (148 ± 18-fold) was ≈7 times higher than that of the −1,106 construct (22 ± 5-fold), whereas we observed no difference in IRF3-mediated induction of the reporter constructs (15 ± 2-fold for both the −1,901 and −1,106 constructs) (Table S1). We also investigated whether coexpression of IRF3/7 with NF-κB RelA would result in stronger activation of IFN-λ1 than by RelA alone. Indeed, the activity of the −1,901 reporter construct was higher when IRF3 or IRF7 was coexpressed with RelA (compare 148 ± 18-fold induction by RelA to 224 ± 66-fold by coexpression of RelA and IRF3 or 269 ± 37-fold by coexpression of RelA and IRF7) (Table S1). Similar results were observed with the endogenous genes.

We conclude that IRF3/7 and NF-κB activate the IFN-λ1 gene expression via spatially separated promoter elements. The IRF proteins act predominantly at the proximal promoter region and NF-κB at the distal cluster of κB binding sites. Both pathways are required to ensure the maximum level of gene expression.

Multiple Alu S Elements Comprising κB Sites Are Integrated in the IFN-λ1 Genomic Locus.

Taking into account the independence of NF-κB activating signaling and the fact that κB sites appear to originate by the insertion of the Alu Sx and ERVL LTR repeats, the whole IFN-λ1 genomic region was inspected in more detail for the presence of other transposable elements. We found at least 10 elements of Alu S subfamilies in 5′ and 3′ regions of the gene and its introns (Table S2), 6 of which were Alu Sx repeats carrying κB sites either identical to the κB5 site in Alu Sx_2 or containing point mutations in the positions unlikely to affect NF-κB binding specificities (Fig. 5 and Fig. S5). Of particular interest, the Alu Sx element located in the second intron of the IFN-λ1 gene (Alu Sx_3 in Fig. 5 and Fig. S5) produces a rare island of sequence conservation in this genomic region. In contrast, there was no additional MLT2B2 ERVL LTR element carrying similar κB binding sites in the region. Moreover, when a sequence similarity search with the fragment encompassing κB3 and κB4 sites of the MLT2b2 in the IFN-λ1 promoter was conducted genomewide by using the Ensemble Blastview platform, only 52 ERVL sequences in the human genome aligned with this region, and only 3 of them comprised the intact κB3 site.

Fig. 5.
Multiple transposable elements within 10 Kbp of the human chromosome 19 encompassing the IFN-λ1 genomic locus. The transposable elements of SINE and LTR families are shown as black and light gray boxes, respectively. The Alu Sx elements encompassing ...

Thus, the IFN-λ1 locus contains a large number of κB site-containing Alu S elements, which could potentially provide additional binding sites for NF-κB.

Discussion

IFN-λs are a group of cytokines that are distantly related to type I IFNs and display similar antiviral properties. In this study we provide insights into the molecular mechanisms leading to IFN-λ1 gene expression in LPS-stimulated MDDCs, and we identify a modular organization of the IFN-λ1 enhancer. Specifically, IFN-λ1 gene expression is mediated by spatially separated promoter elements that independently interact with IRF and NF-κB. Remarkably, the distal cluster of κB sites, which we show are required for maximal levels of LPS induction, were introduced into the IFN-λ1 locus by insertion of Alu Sx and ERVL LTR repeats.

As in the case of IFN-β, both NF-κB and IRF3/7 are required for transcriptional regulation of the IFN-λ1 gene (Fig. 4 and Fig. S4), but the mechanisms are distinct. The enhancer of the IFN-β gene is one of the best-characterized enhancers in the human genome and provides a model of a highly coordinated and cooperative assembly of NF-κB and IRF3/7 into a multicomponent complex (enhanceosome) that recruits the basal transcriptional machinery to the promoter. A less integrative, but more evolutionarily flexible, form of enhancer organization is a modular enhancer that functions as an ensemble of separate elements that independently affect gene expression (20). The observed independence of NF-κB and IRF3 signaling in the activation of both the endogenous gene and the −1,901-nt gene reporter (Fig. 4B) and the high number of κB sites distributed across the promoter favor the latter model of enhancer organization for IFN-λ1. Moreover, the modular enhancer model predicts a level of redundancy in function of independent elements, which we observe in the activity of the IFN-λ1 κB sites (Fig. S3).

The differences in sequence organization of the IFN-β and IFN-λ1 promoters are likely to affect their sensitivity to activation and may reflect on their distinct physiological roles. IFN-β can be induced in virtually all cells, acting as a molecular signal for viral infection. As such, it must be strongly regulated and activated only in response to a clear signal. At the same time in the cells with limiting concentrations of key TFs, the input signal can be amplified by the fixed arrangement of binding sites in the enhancer, controlling the expression of IFN-β in a highly nonlinear fashion (21). For example, in fibroblasts NF-κB and IRF3/7 appear to be present at suboptimal concentrations, limiting the input signal to IFN-β. This results in only in a fraction of cells expressing the gene. Overexpression of RelA significantly increases the number of IFN-β-producing cells (22). In contrast, in MDDCs RelA can be found in all cell nuclei within 30 min of LPS stimulation (Fig. S6), ensuring the availability of the activating signal. In this situation, binding of RelA to target promoters is likely to provide an activation signal based on the number of available κB binding sites independently of promoter occupancy by other TFs (23). Consequently, the robustness and sharpness of the IFN-λ1 expression is ensured by the array of κB sites in its promoter. It would be interesting to investigate whether in cells with nonlimiting concentrations of NF-κB IFN-β gene expression still depends on the enhanceosome assembly.

Recent comparative genomics studies have shown that a substantial proportion of sequence-constrained elements unique to mammals arose from mobile elements, suggesting that transposons have been a major force in the evolution of mammalian gene regulation (24, 25). The IFN-λ1 genomic locus appears to have accumulated a high number of transposable elements, raising the possibility that they might be a part of an ongoing evolutionary selection and primate specification of IFN-λs (26). In fact, although the ERVL-Alu Sx-ERVL element transposition into the region can be detected as early as in marmosets, it is not found in the corresponding sequence of the chimpanzee genome and is only partially present in the genomes of orangutan and rhesus monkeys.

ERV LTRs comprise ≈8% of the human genome, but are usually not found in gene-rich regions, because they can have an affect on gene expression (27, 28). However, those elements that do become fixed are more likely than other transposable elements to assume a role in gene regulation via exaptation of functional elements in the ERV LTRs to the host. For example, Wand et al. (29) have shown that a significant fraction of p53 site-containing class 1 ERVs may have exapted as regulatory sequences to expand the p53 transcriptional network. The class L ERVs, however, are one of the older families of ERVs and are present in all placental animals but they have undergone a major burst in amplification in primates (30). Consequently, these elements are characterized by a high level of sequence divergence. Indeed, the results of our genomewide analysis of ERVL sequences, which align them to the κB-containing MLT2b2 in the IFN-λ1 promoter confirmed their high sequence divergence.

In contrast to ERVs, primate-specific Alu repeats, which comprise >10% of the human genome, are often found in gene-rich regions (31). Their genome distribution appears to be nonrandom, clustering in genes of signaling, metabolic, and transport proteins (32). Alu elements have been implicated in diverse functions including transcriptional regulation, mainly by providing new enhancer signals to neighboring genes (33). A number of TF binding sites (TFBSs) (AP-1, estrogen responsive element, liver X receptor, etc.) have been previously shown to function in the Alu elements, and when analyzed computationally they have revealed positional conservation in all subfamilies (34). However, with a notable exception of our earlier study (35) describing an insertion of a functional κB site via Alu Sg element in the promoter of the IFN-γ gene and the recent study by Apostolou and Thanos (22) implicating Alu Sx elements in the interchromosomal interaction with the IFN-β promoter, there is no information regarding the function of NF-κB binding sites in the Alu repeats. It is interesting to speculate that multitude of Alu S repeats interspersed in the genome may function as specific anchors that can sequester NF-κB and influence gene expression, either directly via exaptation to the nearby genes as cis-regulatory elements (e.g., IFN-λ1 promoter) or indirectly as trans-regulatory elements via interchromosomal interactions with the promoters of selected genes [e.g., IFN-β promoter (22)].

We identify 10 elements of the Alu S subfamily in the 10 Kb of the IFN-λ1 locus, 6 of which are Alu Sx elements carrying κB sites identical or similar to the site κB5. The reason for such a high number of transposable elements carrying putative κB sites in this genomic region is not clear, especially in view of the fact that some of them are not detected in other primate genomes. The human evolutionary lineage has experienced a repeat-driven genome expansion of 30 Mb since the divergence from chimpanzees (36). It is therefore possible that the TFBSs, which translocated into this region with the transposable elements, may contribute to the regulatory divergence between species.

In summary, the organization of the IFN-λ1 regulatory sequences appears to be different from that of the IFN-β gene. In LPS-stimulated MDDCs, the enhancer of IFN-λ1 senses high levels of nuclear RelA via the distal cluster of κB sites, integrated into this region as a part of mobile genetic elements transposition. An independent signal transmitted by IRF3/7 via the proximal promoter region, distantly similar to the IFN-β enhancer, may represent the remnants of the type I IFN regulatory system and contribute to a fine-tuning of gene expression.

Methods

Plasmids.

NF-κB and IRF expression constructs were generated in the pENTR vector (Invitrogen) modified to contain the CMV promoter and IRES-linked GFP (pBent). IFN-λ1 promoter fragments were obtained by PCR of a genomic DNA and cloned into the pGL3 Basic vector (Promega). For delivery into human myeloid cells, IFN-λ1promoter/luciferase cassettes were excised and subcloned into the pBent vector, modified to contain CMV-driven GPF in the orientation opposite to the luciferase gene and recombined into pAD/PL DEST vector (Invitrogen) for adenovirus production. The sequences and restriction maps of all constructs are available on request.

Cell Culture and mRNA Expression Analysis.

HEK-293-TLR4/MD2-CD14 cells were cultured in DMEM in the presence of 10 mg/mL of Blasticidin and 50 mg/mL of HygroGold (Invivogen). Human monocytes were obtained from the blood of healthy donors by elutriation as described (18). Cells were cultured in RPMI medium 1640 in the presence of the following cytokines (all from Peprotech): 50 ng/mL GM-CSF and 10 ng/mL IL-4 (MDDC) for 5–7 days; 50 ng/mL M-CSF (M-CSF MPH) and 50 ng/mL GM-CSF (GM-CSF MPH) for 3–5 days. Total RNA (0.5–1 mg) extracted with a QiaAmp RNA blood mini kit (Qiagen) was used in cDNA synthesis. The gene expression was analyzed by a 2-standard curve method using TaqMan gene expression assay Hs00601677_g1 and ribosomal protein endogenous control (ABI) in a Corbett Rotor-gene 6000 machine (Corbett Research).

Transfections and Luciferase Reporter Assays.

siRNA knockdown in cell lines was performed by using On-target plus individual or SMART pool siRNA reagents (Dharmacon) and Lipofectamine RNAiMAX Transfection Reagent (Invitrogen). siRNA knockdown in MDDCs was performed with DharmaFECT Transfection Reagent I (Dharmacon). The sequences of the custom-designed siRNAs are available on request. Transfections of luciferase and protein expressing constructs into cell lines were performed in 96-well plates in triplicate by using Lipofectamine 2000 Transfection Reagent (Invitrogen) and detected with Dual-Glo Luciferase Assay System (Promega). Luciferase activity was normalized by intensity of Renilla luciferase produced from a construct cotransfected into the same cells (cell line) or intensity of GFP produced from the same adenoviral vector backbone (primary cells).

Adenoviral Infections.

Adenoviral infections of primary human myeloid cells were performed in 96-well plates in triplicate. The plates with serum-free RPMI medium 1640 containing the desired number of viral particles were centrifuged at 400 × g for 30 min then placed at 37 °C overnight. The next day the virus media were replaced with 100 μL of standard media and the cells were allowed to recover for 2 days before the application of experimental conditions.

EMSA.

Oligonucleotide probes (Table S3) were radiolabeled with [α-32P]dCTP (PerkinElmer). Nuclear extracts from MDDCs stimulated with 100 ng/mL LPS for 1 h, recombinant p50/RelA protein purification, and binding assay were performed as described (37). For supershift analysis, the reaction mixture was preincubated with 0.5–1 μg of sc-372 (RelA) and sc-114 (p50) antibodies (Santa Cruz Biotechnology) for 10 min before addition of the labeled probe. The gels were quantified with a PhosphorImager (FujiFilm).

ChIP.

ChIP assays were carried out essentially as described (38) using sc-372 (RelA) antibodies and the following primers: IFN-λ1 distal region (TTTAAGGGCAGGTGCAGGGTGTC; TTACCCAATGTGGTGGGCACCATC), IFN-λ1 proximal region (GCCAGTTGGCTGAAAGCTGCCCA; GGCAGGGCCAAGTGAGCTGG GA), IFN-β (TGAAAGGGAGAAGTGAAAGTGGG; AAGGCTTCGAAAGGTTGCAGTTA). The detailed protocol is available on request.

Bioinformatics and Statistical Analyses.

Genomic sequences were obtained by using the publicly available UCSC hg18 human genome assembly (http://genome.ucsc.edu). The multiple alignments of 28 vertebrate species were generated by using Multiz and PhastCons by the UCSC/Penn State Bioinformatics comparative genomics alignment pipeline and viewed as the islands of conservation in the UCSC Genome Browser. The nucleotide sequence were inspected with JASPAR TF binding sites searching software (http://jaspar.cgb.ki.se) (39) for the presence of putative NF-κB (JASPAR matrixes MA0061, MA0101, MA0105, MA0107) and ISRE sites (JASPAR matrixes MA0050, MA0051) (Tables S4 and S5). Clustal format alignment of AluS elements in the IFN-λ1 gene locus was conducted with TCoffee version_7.37 software (www.tcoffee.org). A sequence similarity search was conducted genomewide by using the Ensembl Blastview platform (www.ensembl.org/Multi/blastview). All statistical analyses were performed with GraphPad Prism 5.0 software.

Supplementary Material

Supporting Information:

Acknowledgments.

We thank Dr. David Saliba (Kennedy Institute of Rheumatology) for help in optimizing ChIP conditions, Dr. Richard Copley (Wellcome Trust Centre for Human Genetics, Oxford, U.K.) for helpful comments, and Dr Gioacchino Natoli (European Institute of Oncology, Milan) for help with setting up the ChIP analysis. This work was supported by a Medical Research Council New Investigator Award (to I.A.U.) and a Royal Society International Collaboration Grant (to I.A.U. and Dr. Gioacchino Natoli).

Footnotes

The authors declare no conflict of interest.

This article contains supporting information online at www.pnas.org/cgi/content/full/0904477106/DCSupplemental.

References

1. Lutfalla G, et al. Comparative genomic analysis reveals independent expansion of a lineage-specific gene family in vertebrates: The class II cytokine receptors and their ligands in mammals and fish. BMC Genomics. 2003;4:29–44. [PMC free article] [PubMed]
2. Zou J, Tafalla C, Truckle J, Secombes CJ. Identification of a second group of type I IFNs in fish sheds light on IFN evolution in vertebrates. J Immunol. 2007;179:3859–3871. [PubMed]
3. Sheppard P, et al. IL-28, IL-29, and their class II cytokine receptor IL-28R. Nat Immunol. 2003;4:63–68. [PubMed]
4. Commins S, Steinke JW, Borish L. The extended IL-10 superfamily: IL-10, IL-19, IL-20, IL-22, IL-24, IL-26, IL-28, and IL-29. J Allergy Clin Immunol. 2008;121:1108–1111. [PubMed]
5. Renauld JC. Class II cytokine receptors and their ligands: Key antiviral and inflammatory modulators. Nat Rev Immunol. 2003;3:667–676. [PubMed]
6. Kotenko SV, et al. IFN-λs mediate antiviral protection through a distinct class II cytokine receptor complex. Nat Immunol. 2003;4:69–77. [PubMed]
7. Platanias LC, Fish EN. Signaling pathways activated by interferons. Exp Hematol. 1999;27:1583–1592. [PubMed]
8. Onoguchi K, et al. Viral infections activate types I and III interferon genes through a common mechanism. J Biol Chem. 2007;282:7576–7581. [PubMed]
9. Osterlund PI, Pietila TE, Veckman V, Kotenko SV, Julkunen I. IFN regulatory factor family members differentially regulate the expression of type III IFN (IFN-λ) genes. J Immunol. 2007;179:3434–3442. [PubMed]
10. Thanos D, Maniatis T. Virus induction of human IFN-β gene expression requires the assembly of an enhanceosome. Cell. 1995;83:1091–1100. [PubMed]
11. Fitzgerald KA, et al. IKKε and TBK1 are essential components of the IRF3 signaling pathway. Nat Immunol. 2003;4:491–496. [PubMed]
12. Sharma S, et al. Triggering the interferon antiviral response through an IKK-related pathway. Science. 2003;300:1148–1151. [PubMed]
13. Sommereyns C, Paul S, Staeheli P, Michiels T. IFN-λ is expressed in a tissue-dependent fashion and primarily acts on epithelial cells in vivo. PLoS Pathog. 2008;4:e1000017. [PMC free article] [PubMed]
14. Coccia EM, et al. Viral infection and Toll-like receptor agonists induce a differential expression of type I and λ interferons in human plasmacytoid and monocyte-derived dendritic cells. Eur J Immunol. 2004;34:796–805. [PubMed]
15. Mennechet FJ, Uze G. Interferon-λ-treated dendritic cells specifically induce proliferation of FOXP3-expressing suppressor T cells. Blood. 2006;107:4417–4423. [PubMed]
16. Wolk K, et al. Maturing dendritic cells are an important source of IL-29 and IL-20 that may cooperatively increase the innate immunity of keratinocytes. J Leukocyte Biol. 2008;83:1181–1193. [PubMed]
17. Verreck FA, de Boer T, Langenberg DM, van der Zanden L, Ottenhoff TH. Phenotypic and functional profiling of human proinflammatory type 1 and antiinflammatory type 2 macrophages in response to microbial antigens and IFN-γ- and CD40L-mediated costimulation. J Leukocyte Biol. 2006;79:285–293. [PubMed]
18. Foxwell B, et al. Efficient adenoviral infection with IκBα reveals that macrophage tumor necrosis factor α production in rheumatoid arthritis is NF-κB dependent. Proc Natl Acad Sci USA. 1998;95:8211–8215. [PMC free article] [PubMed]
19. Segal E, Raveh-Sadka T, Schroeder M, Unnerstall U, Gaul U. Predicting expression patterns from regulatory sequence in Drosophila segmentation. Nature. 2008;451:535–540. [PubMed]
20. Arnosti DN, Kulkarni MM. Transcriptional enhancers: Intelligent enhanceosomes or flexible billboards? J Cell Biochem. 2005;94:890–898. [PubMed]
21. Papatsenko D, Levine M. A rationale for the enhanceosome and other evolutionarily constrained enhancers. Curr Biol. 2007;17:R955–957. [PubMed]
22. Apostolou E, Thanos D. Virus infection induces NF-κB-dependent interchromosomal associations mediating monoallelic IFN-β gene expression. Cell. 2008;134:85–96. [PubMed]
23. Bosisio D, et al. A hyper-dynamic equilibrium between promoter-bound and nucleoplasmic dimers controls NF-κB-dependent gene activity. EMBO J. 2006;25:798–810. [PMC free article] [PubMed]
24. Lowe CB, Bejerano G, Haussler D. Thousands of human mobile element fragments undergo strong purifying selection near developmental genes. Proc Natl Acad Sci USA. 2007;104:8005–8010. [PMC free article] [PubMed]
25. Mikkelsen TS, et al. Genome of the marsupial Monodelphis domestica reveals innovation in noncoding sequences. Nature. 2007;447:167–177. [PubMed]
26. Pestka S, Krause CD, Walter MR. Interferons, interferon-like cytokines, and their receptors. Immunol Rev. 2004;202:8–32. [PubMed]
27. Medstrand P, et al. Impact of transposable elements on the evolution of mammalian gene regulation. Cytogenet Genome Res. 2005;110:342–352. [PubMed]
28. van de Lagemaat LN, Medstrand P, Mager DL. Multiple effects govern endogenous retrovirus survival patterns in human gene introns. Genome Biol. 2006;7:R86. [PMC free article] [PubMed]
29. Wang T, et al. Species-specific endogenous retroviruses shape the transcriptional network of the human tumor suppressor protein p53. Proc Natl Acad Sci USA. 2007;104:18613–18618. [PMC free article] [PubMed]
30. Benit L, Lallemand JB, Casella JF, Philippe H, Heidmann T. ERV-L elements: A family of endogenous retrovirus-like elements active throughout the evolution of mammals. J Virol. 1999;73:3301–3308. [PMC free article] [PubMed]
31. Chen C, Gentles AJ, Jurka J, Karlin S. Genes, pseudogenes, and Alu sequence organization across human chromosomes 21 and 22. Proc Natl Acad Sci USA. 2002;99:2930–2935. [PMC free article] [PubMed]
32. Grover D, Majumder PP, Rao CB, Brahmachari SK, Mukerji M. Nonrandom distribution of alu elements in genes of various functional categories: Insight from analysis of human chromosomes 21 and 22. Mol Biol Evol. 2003;20:1420–1424. [PubMed]
33. Brosius J. Genomes were forged by massive bombardments with retroelements and retrosequences. Genetica. 1999;107:209–238. [PubMed]
34. Shankar R, Grover D, Brahmachari SK, Mukerji M. Evolution and distribution of RNA polymerase II regulatory sites from RNA polymerase III-dependent mobile Alu elements. BMC Evol Biol. 2004;4:37–46. [PMC free article] [PubMed]
35. Ackerman H, Udalova I, Hull J, Kwiatkowski D. Evolution of a polymorphic regulatory element in interferon-γ through transposition and mutation. Mol Biol Evol. 2002;19:884–890. [PubMed]
36. Liu G, et al. Analysis of primate genomic variation reveals a repeat-driven expansion of the human genome. Genome Res. 2003;13:358–368. [PMC free article] [PubMed]
37. Udalova IA, Knight JC, Vidal V, Nedospasov SA, Kwiatkowski D. Complex NF-κB interactions at the distal tumor necrosis factor promoter region in human monocytes. J Biol Chem. 1998;273:21178–21186. [PubMed]
38. Saccani S, Pantano S, Natoli G. Two waves of nuclear factor κB recruitment to target promoters. J Exp Med. 2001;193:1351–1359. [PMC free article] [PubMed]
39. Vlieghe D, et al. A new generation of JASPAR, the open-access repository for transcription factor binding site profiles. Nucleic Acids Res. 2006;34:D95–D97. [PMC free article] [PubMed]

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...