![]() | ![]() |
Formats:
|
||||||||||||||||||||||||
β8 integrins are required for vascular morphogenesis in mouse embryos Howard Hughes Medical Institute and Department of Physiology, University of California, San Francisco, San Francisco, CA 94143, USA †Author for correspondence (e-mail: lfr/at/cgl.ucsf.edu) *Present address: Department of Pharmacology for Pharmacists Martinistrasse. 52, Institute of Pharmacology, University of Hamburg-UKE, 20251 Hamburg, Germany The publisher's final edited version of this article is available free at Development. See other articles in PMC that cite the published article.SUMMARY In order to assess the in vivo function of integrins containing the β8 subunit, we have generated integrin β8- deficient mice. Ablation of β8 results in embryonic or perinatal lethality with profound defects in vascular development. Sixty-five percent of integrin β8-deficient embryos die at midgestation, with evidence of insufficient vascularization of the placenta and yolk sac. The remaining 35% die shortly after birth with extensive intracerebral hemorrhage. Examination of brain tissue from integrin β8-deficient embryos reveals abnormal vascular morphogenesis resulting in distended and leaky capillary vessels, as well as aberrant brain capillary patterning. In addition, endothelial cell hyperplasia is found in these mutant brains. Expression studies show that integrin β8 transcripts are localized in endodermal cells surrounding endothelium in the yolk sac and in periventricular cells of the neuroepithelium in the brain. We propose that integrin β8 is required for vascular morphogenesis by providing proper cues for capillary growth in both yolk sac and embryonic brain. This study thus identifies a molecule crucial for vascular patterning in embryonic yolk sac and brain. Keywords: Integrin, Vasculature, Embryo, Brain, Angiogenesis, Mouse INTRODUCTION The vertebrate vascular network is essential for embryonic survival. The basic structural unit, a blood vessel, is assembled through two processes, vasculogenesis and angiogenesis, followed by the recruitment of vascular support cells (Risau, 1997). Proper patterning of the vascular network, however, requires further morphogenic events, including vessel branching and coupling, vessel guidance within target tissues, and arterial or venous specification. Recent studies have identified several factors that function in regulating vasculogenesis and angiogenesis. Basic fibroblast growth factor (bFGF) and its receptor (FGFR) are required for the differentiation of mesodermal progenitors into endothelial cells (Flamme and Risau, 1992). Vascular endothelial growth factor (VEGF) (Carmeliet et al., 1996; Ferrara et al., 1996) and its receptors VEGFR2/Kdr (Shalaby et al., 1995), VEGFR1/Flt1 (Fong et al., 1995), and VEGF-R3/Flt4 (Dumont et al., 1998) are essential for early endothelial cell differentiation and for both vasculogenesis and angiogenesis. Angiopoietins (Ang1 and Ang2) and their receptors Tie2/Tek and Tie1 promote the recruitment of support cells and vessel stability during angiogenesis (Dumont et al., 1994; Puri et al., 1995; Sato et al., 1995; Suri et al., 1996). In addition, platelet derived growth factor β (PDGFβ) and its receptors, as well as transforming growth factor β (TGFβ) and its signaling mediators, are necessary for the differentiation and recruitment of vascular support cells to developing blood vessels (Dickson et al., 1995; Lindahl et al., 1997; Goumans et al., 1999; Hellström et al., 1999). Despite significant advances in our understanding of the mechanisms underlying blood vessel assembly, the mechanisms that regulate patterning of the vascular network are still poorly characterized. More recently, factors regulating intersomitic vessel branching and patterning have been identified through genetic studies. Ephrins and Eph receptors have been found to mediate artery/vein boundary specification (Wang et al., 1998; Adams et al., 1999; Adams et al., 2001), vessel assembly, and vascular morphogenesis and branching (Adams et al., 2001; Adams et al., 1999). Delta/Notch signaling is required for intersomitic blood vessel branching and morphogenesis (Xue et al., 1999; Krebs et al., 2000). Ca2+/calcineurin/NFAT are necessary for the recruitment of smooth muscle cells to the dorsal aorta and for intersomitic vascular branching and patterning (Graef et al., 2001). While molecules required for intersomitic vessel patterning have been identified, molecules that regulate patterning of a complex vascular network within an organ such as the brain are completely uncharacterized. The developing neuroepithelium lacks intrinsic vasculature. Capillary vessels penetrate the neuroepithelium in response to angiogenic factor(s), such as VEGF, expressed by neuroepithelial cells, and extend in a parallel and organized fashion during subsequent development (Breier et al., 1992). They branch regularly and anastomose to form an organized network (Marin-Padilla, 1988). Thus, the development of the brain vascular network provides an ideal system for studies on patterning of the vascular network. Vascular patterning processes are likely to be regulated by cell-matrix and cell-cell interactions, and to be influenced by environmental cues. Integrins are important extracellular matrix (ECM) transmembrane receptors that participate in a variety of cellular events including proliferation, differentiation, adhesion, migration and cell survival (Schwartz et al., 1995). Integrin receptors are heterodimeric molecules that consist of α and β subunits. A subset of integrins including α vβ3, α vβ5,α 5β1,α 2β1,α vβ1 and α 1β1 have been implicated in vascular development (Hynes and Bader, 1997). Of particular interest is integrin α vβ3, which is expressed on endothelial cells. α vβ3 antagonists and blocking monoclonal antibodies inhibit angiogenesis in vitro, suggesting that this integrin may play a crucial role in vascular development (Eliceiri and Cheresh, 1999). However, neither integrin αv nor integrin β3 mutant mice exhibit obvious defects in angiogenesis during development (Bader et al., 1998; Hodivala-Dilke et al., 1999). Analysis of the integrin β8 sequence indicates that it is highly conserved among species, but is quite divergent from other integrin β subunits, suggesting that it may have unique functions (Moyle et al., 1991). At present, the integrin αv is the only partner identified for integrin β8. The integrin αvβ8 has been shown to bind vitronectin, and may also bind laminin and collagen IV in cell culture (Moyle et al., 1991; Nishimura et al., 1994; Venstrom and Reichardt, 1995). β8 mRNA is expressed in adult brain, kidney and placenta (Moyle et al., 1991), and its protein is reportedly localized to brain synapses, glial cells (Milner et al., 1997a; Milner et al., 1997b; Nishimura et al., 1998), as well as to the suprabasal cells of the epidermis during eyelid morphogenesis (Stepp, 1999). To dissect integrin β8 functions in vivo, we have generated β8-deficient mice. This mutation results in embryonic lethality with defective vascular development in the placenta and yolk sac or perinatal lethality with intracerebral hemorrhage. Analyses of mutant brain tissue demonstrate that capillaries are formed, but are aberrantly patterned with hyperproliferative endothelial cells. In addition, neuroepithelial cells appear disorganized in the mutant. Finally, integrin β8 mRNA is localized to neuroepithelial cells, but has not been detected in the vasculature. Consequently, we propose that integrins containing β8 provide proper environmental cues for patterning of the embryonic brain vascular network. MATERIALS AND METHODS Generation of integrin β8-deficient mice A 6.5 kb XbaI genomic fragment with a PGK-neo-cassette (1.4 kb) inserted to replace an EcoRI fragment was used to generate the targeted allele following the standard procedures (Fig. 1A
PCR genotyping Yolk sac DNA was used for PCR analyses with primers specific for the wild-type and targeted alleles [wild-type primers DW74 (5′ATTATCTGGTTGATGTGTCAGC3′) and JW153 (5′AGAGAGGAACAAATATCCTTCCC3′); mutant primers DW56 (5′AGAGGCCACTTGTGTAGCGCCAAG3′) and DW94 (5′GGAGGCATACAGTCTAAATTGT3′)]. PCR conditions as described by the manufacturer of AmpliTaq Polymerase (Perkin-Elmer Cetus, Norwalk, CT) were used to generate fragments from wild-type (330 bp) and targeted (450 bp) alleles on 1% agarose gels. Tie2/lacZ heterozygotes (Schlaeger et al., 1997) were identified by PCR using primers: lacZFor (5′-TCGTTTGCCGTCTGAATTTGACCTG-3′) and lacZRev (5′-TGACCATGCAGAGGATGATGCTCG- 3′). Morphological and histological analysis Whole-mount embryos were photographed on a dissecting microscope. For histology, embryos were fixed in Carnoy’s solution or in 4% paraformaldehyde (PFA) in PBS. Fixed embryos were either used directly for vibratome sectioning or were dehydrated and embedded in paraffin. Sections (150 μm) were used in free-floating immunohistochemistry. Paraffin wax embedded sections (7 μm) were either stained with Hematoxylin and Eosin or were used for immunohistochemistry. Immunohistochemistry Immunohistological methods were used as described previously (Jones et al., 1994). Primary antibodies were used as follows: anti- CD31 (PECAM1) (Pharmagen, MEC 13.3) at 1:150 dilution; anti-fibronectin (Sigma) at 1:2000 dilution; anti-laminin (Sigma, #L9393) at 1:4000 dilution; RC2 (Hybridoma bank, Iowa city, IA) at 1:20 dilution; and anti-desmin (DAKO, #A0611) at 1:50 dilution. Electron microscopy Embryos were fixed overnight in 2.5% glutaraldehyde, 1% PFA in 0.1 M sodium cacodylate buffer, pH 7.4. Brains were sectioned at 1 mm using a vibratome and processed using standard techniques. In situ hybridization In situ hybridization was performed on fresh frozen sections as described (Schaeren-Wiemers and Gerfin-Moser, 1993). The digoxigenin RNA labeling and detection kit from Roche Biochemicals (Indianapolis, IN) was used. A 5.5 kb integrin β8 cDNA fragment was used as template. Endothelial cell quantification Capillary endothelial cell nuclei were counted using 5 μm paraffin sections of brains. Sections were stained with DAPI, biotinylated isolectin BS (L-2140; Sigma) and anti-BrdU antibody (BD pharmagen) [methods were modified from Hellstorm et al. (Hellstorm et al., 2001)]. Images were taken from the ganglionic eminence using a 40× objective on a Nikon Eclipse E600 microscope and overlaid in Adobe Photoshop 6.0. VEGF ELISA assay VEGF was assayed following the procedures of Hellstrom et al. (Hellstrom et al., 2001), using the mouse VEGF ELISA detection kit QuantikineM (R & D Systems, Minneapolis, MN). RESULTS Generation of integrin β8-deficient mice The gene for integrin β8 was inactivated by replacing sequences encoding 45 amino acids at the C terminus of exon IV and part of the intron sequences with a neomycin-resistance (neor)- expression cassette. Exon IV encodes a von Willebrand factor-A-like domain that has been shown to form part of the ligand binding site in other integrin heterodimers (Tuckwell and Humphries, 1997; Xiong et al., 2001). This alteration results in a frameshift in addition to a deletion, abolishing the production of functional β8 protein (Fig. 1 Integrin β8-deficient mice die either by E11.5 or perinatally Mice heterozygous for integrin β8-deficiency appeared normal and were fertile. Genotypic analyses of over 150 weaning-age pups from heterozygous intercrosses identified no homozygous mutants, indicating that integrin β8-deficiency results in embryonic or perinatal lethality. Examination of embryos collected at different developmental stages revealed that approximately two-thirds of homozygous embryos die between E9.5–E11.5, while the remaining die within days of birth (Table 1). Thus, the integrin β8 mutant allele is a recessive lethal mutation.
To characterize phenotypic defects in the homozygotes, embryos were harvested from embryonic day 9.5 (E9.5) to birth (Table 1, Fig. 2
Almost all class B mutant embryos developed intracerebral hemorrhage by E12.5 (Fig. 2F This analysis indicates that deficiency of integrin β8 leads to lethality at two different developmental stages. Class A integrin β8-deficient embryos (~60%) died by E11.5 with small body size and pale yolk sacs. Class B integrin β8-deficient embryos (~40%) survived to birth, but died perinatally with evidence of massive intracerebral hemorrhage and occasional cleft palate. The morphological characteristics mentioned above are used to define two mutant classes for further analyses hereafter. Impaired vascular development in class A integrin β8-deficient mutants The small body size and abnormal yolk sac vasculature of E10.5 class A mutants suggests a defect in extra-embryonic tissues. In wild-type embryos, the chorionic plate is well developed and traversed by the allantoic vessels by E10.5. The placenta has developed an apparent labyrinthine layer where fetal blood vessels invade and actively interdigitate with maternal blood vessels to form a sponge-like network for nutrient and O2 exchange (Fig. 3A
The yolk sac vasculature of E10.5 mutants was analyzed using a mouse strain carrying a Tie2:lacZ reporter gene that is expressed in all embryonic endothelial cells (Schlaeger et al., 1997). The Tie2:lacZ reporter allele was crossed into the integrin β8-deficient strain and mutant embryos were examined using X-gal staining. The vascular pattern of the yolk sac in E9.5 integrin β8-deficient embryos appears grossly normal (data not shown). At E10.5, the vasculature in the wild-type yolk sac develops a complex pattern with primary and secondary branches from the major vessels (Fig. 3C To examine vascular development within the embryo proper, we employed whole-mount immunohistochemical staining with anti-PECAM as well as X-gal staining in embryos carrying the Tie2:lacZ reporter gene. As shown in Fig. 3E–G Integrin β8 is expressed in cells surrounding endothelium in the placenta and yolk sac The vascular defects in the placenta and yolk sac could result from the absence of integrin β8 from endothelial cells, from cells surrounding endothelium, or both. To identify cells expressing integrin β8, in situ hybridization was performed on E9.5 placenta and yolk sac (Fig. 4A–D
Normal capillary blood vessel assembly but defective vascular patterning in class B mutants We chose to focus our analysis of intra-embryonic phenotypes on class B mutants for the following reasons. Class A mutants die by E11.5 with prominent defects in placental and yolk sac vascularization. The placental defect is likely responsible for the early lethality and at least some of the intra-embryonic phenotypes of class A mutant embryos. In addition, the placenta includes multiple cell types of both maternal and embryonic origin. By contrast, the early embryonic brain consists primarily of only two cell types, endothelial cells and neuroepithelial cells, both of embryonic origin, facilitating analysis of vascular defects in class B mutants. In class B integrin β8-deficient embryos, intracerebral hemorrhage appears initially bilaterally in the ganglionic eminence by E12.5 (Fig. 2F
Distended capillary blood vessels could result from abnormal basement membranes or defects in recruitment of pericytes. The vascular basement membranes were examined using antibodies recognizing laminin, fibronectin, collagen IV and perlecan, all of which are core components of the basement membrane. Integrin β8-deficient embryos at E12.5 express all four proteins, which are localized similarly in both wild-type and mutant embryos (data not shown). Anti-laminin staining outlines thin, elongated capillary vessels present in E12.5 wild-type brain (Fig. 6A
Pericytes were detected using an antibody recognizing desmin, a pericyte-specific intermediate filament protein in the brain. Pericytes are present and are recruited to the vascular capillaries in both wild-type and mutant embryos at E12.5 (Fig. 6G,H Examination of capillary endothelial cell ultrastructure using electron microscopy identified numerous morphological abnormalities in E12.5 mutant brains (Fig. 7B
To investigate vascular development and patterning in more detail, we analyzed the brain capillary network. In E10.5 wild-type brains, capillary vessels have penetrated into the neuroepithelium and coupling of vessels has occurred near the ventricle (Fig. 8A
Endothelial cell hyperplasia in class B β8-deficient mutants The ultrastructural analysis of endothelial cells in Class B mutants suggests that endothelial cells are hyperactive (Fig. 7 Interestingly, overexpression of VEGF can result in endothelial cell proliferation with highly fenestrated and ‘glomeruloid-like’ vessels (Cheng et al., 1997; Sundberg et al., 2001), similar to those observed here. To determine whether elevated expression of VEGF might account for the defective vasculature observed in the brains of the integrin β8 mutants, we measured VEGF levels in the brains of E12.5 and E14.5 control and mutant mice. A significant increase of VEGF in the mutant brains was not seen at either age [E12.5 wild type, 24.6±8.3 ng/g; E12.5 mutant, 22.4±1.8 ng/g (n=3); E14.5 wild type, 28.5±6.1 ng/g; E14.5 mutant, 30.6±0.8 ng/g (n=2)]. We were unable to localize VEGF within the brain by immunohistochemistry. Abnormal neuroepithelial organization in class B β8- deficient mutants Radial glial cells are the predominant cell type populating the early neuroepithelium. Their cell bodies reside near the internal ventricular surface and their processes extend radially towards the external surface at the pia (Rakic, 1972). Their processes also wrap around developing brain capillary vessels (Noctor et al., 2001), suggesting they may regulate capillary development. Neuroepithelial cell organization was examined with the radial glial cell-specific antibody RC2 (Edwards et al., 1990). The alignment of radial glial cell processes appears normal in E10.5 mutant embryos (Fig. 4J Integrin β8 is expressed in periventricular neuroepithelial cells The defects observed in integrin β8-deficient embryos might result from the absence of integrin β8 function within endothelial cells, neuroepithelial cells or both. The phenotype could reflect a defect in cell adhesion, basement membrane organization or cell signaling. In situ hybridization analysis indicated that the integrin β8 transcript is localized to the embryonic brain in the periventricular zone at E10.5 (Fig. 7A,B DISCUSSION With a genetic approach, we have found that absence of integrin β8 results in embryonic or perinatal lethality with profound vascular defects. The majority of mutants (class A) die during midgestation with defective vascularization in the placenta and yolk sac as well as abnormal angiogenesis in the neuroepithelium. Approximately 35% of mutants (class B) die perinatally with intracerebral hemorrhage and abnormal vasculature in the brain. Unusually high proliferation of endothelial cells is observed and apparently precedes hemorrhage in class B mutant brains. In addition, vascular patterning and organization of the neuroepithelium are disrupted in class B mutant brains. Finally, expression studies localize integrin β8 transcripts to endodermal cells in the yolk sac and periventricular neuroepithelial cells in the early embryonic brain. We propose that integrins containing the β8 subunit are required in some tissues for vascular morphogenesis by providing non-autonomous cellular cues for capillary patterning. This study thus identifies a molecule crucial for proper patterning of the embryonic yolk sac and brain vasculature. Integrin β8 and brain vascular patterning Class B integrin β8-deficient embryos develop extensive intracerebral hemorrhage, suggesting that there is defective development of the vasculature. Consistent with this, we observed in the mutant brains aberrant capillary vessel growth and patterning (Fig. 8A–D
In the absence of integrin β8, organization of the neuroepithelium is abnormal as shown by cavitations in periventricular tissues as well as disorganization of the neuroepithelial cells (Fig. 4 How might β8 integrins function to generate or regulate vascular guidance cues? One possibility is that β8 integrins could bind to a receptor expressed on capillary endothelial cells and directly function as cell-tethered guidance molecules. Numerous examples of transmembrane receptors functioning as guidance molecules have been documented in studies of axonal growth and guidance (Yu and Bargmann, 2001). Alternatively, β8 integrins could indirectly regulate vascular morphogenesis by affecting the production and distribution of angiogenic factors that are required for capillary growth. Notably, VEGF is expressed in periventricular neuroepithelial cells and bioactive forms of surface bound VEGF are released by proteolysis (Breier et al., 1992; Ferrara, 1999). Even though overexpression of VEGF can result in endothelial cell and vascular phenotypes similar to those of the integrin β8 mutant (Cheng et al., 1997; Sundberg et al., 2001), we did not detect a significant increase in total VEGF levels in the brains of mutant compared with wild-type embryos. Thus, β8 integrins must regulate endothelial cell proliferation and vasculogenesis through a different pathway. Additionally, β8 integrins could regulate capillary growth by organizing extracellular matrix substrates necessary for capillary migration and growth. There is evidence in class B mutants that the capillary basement membrane is discontinuous, indicating that extracellular matrix organization may be defective. In other experimental systems, β1 integrins have been shown to be required for laminin assembly (Colognato et al., 1999; Wu, 1997). Integrin αvβ8 Like integrin β8 mutants, there are two classes of integrin αv mutant mice with a majority dying embryonically at E10.5– E11.5 with placental defects and a minority dying perinatally with intracerebral hemorrhage (Bader et al., 1998). Integrin αv is reportedly expressed in radial glial cells beginning at E10.5 (Hirsch et al., 1994). These similarities indicate that integrin α vβ8 is required for normal vascular development in the placenta and embryonic brain, and for the proper organization of the neuroepithelium. In addition to the β8 subunit, the αv subunit can associate with multiple other integrin β subunits (β1, β3, β5, β6). However, mice that lack β3 (Hodivala-Dilke et al., 1999), β5 (Huang et al., 2000), or β6 (Huang et al., 1996) are viable and exhibit no obvious defects in vascular development. This suggests that other α v-containing integrins can not compensate for the absence of α vβ8 during early development. In addition to the similarities described above, there are several differences between the integrin β8 and the integrin αv mutant phenotypes. The yolk sac vascular defect in integrin β8- deficient mutants has not been reported in integrin α v-null mice. Although not the only interpretation, it thus seems possible that an additional unidentified α subunit pairs with integrin β8 in the yolk sac. Notably, 24 integrin α and 9 integrin β genes have been identified in the human genome sequencing project, of these six α and one β subunits were not identified previously and thus the proteins encoded by these sequences have not been characterized (Venter and Adams, 2001). The aberrant angiogenesis and absent floor plate detected in the E10.5 neuroepithelium of integrin β8 class A mutants, and the abnormal capillary growth and vascular patterning in integrin β8 class B mutants have not been reported in integrin αv knockout mice (Bader et al., 1998). If these differences are confirmed by further analyses of integrin α v-null embryos, they suggest that other integrin α subunits are likely to participate with integrin β8 in these developmental processes. Alternatively, overexpression of one of the other αv partners in the absence of β8 could account for some of the phenotypic features. Integrin α v-null neonates develop a cleft palate and intestinal hemorrhage with 100% penetrance; however, intestinal hemorrhage was never observed and palatal defects were only observed rarely in integrin β8 mutants. This suggests that the absence of other α v-containing heterodimers is responsible for these phenotypes. Vascular morphogenesis in embryonic brain What are the molecular bases of brain vascular patterning cues regulated by integrin β8? Studies of integrins α vβ1, α vβ5 and α vβ6 have shown that each can bind to TGFβ1 (Munger et al., 1998; Munger et al., 1999). Recent biochemical studies indicate that integrin α vβ8 can bind and activate TGFβ1 signaling in cultured cells (Mu et al., 2002). A mutation in endoglin, a TGFβ1 receptor involved in its signaling, results in brain hemorrhage in humans (McAllister et al., 1994). We are currently investigating the possibility that TGFβ1 signaling is involved in regulating vascular development in the embryonic brain. Interestingly, mice bearing mutations in PDGFB and PDGF receptor-β (PDGFRβ) have intracerebral hemorrhage beginning at E16.5 (later than that in integrin β8-deficient mice) and show endothelial cell hyperproliferation at E11.5 (Hellstrom et al., 2001). These phenotypes are believed to result from defective differentiation and recruitment of pericytes, which are dependent upon PDGF-/PDGFRβ signaling (Hellström et al., 1999; Lindahl et al., 1997). It is possible that integrin β8 functions upstream to affect PDGFB/PDGFRβ signaling. In addition, intracerebral hemorrhages have been observed in mice carrying mutations in transcription factors, such as Id1,3 (Lyden et al., 1999), Fli1 (Spyropoulos et al., 2000) and CBP (Tanaka et al., 2000), and components of the Notch signaling pathway, such as presenilin 1 (Shen et al., 1997) and Numb (Zhong et al., 2000). However, the cellular defects associated with intracerebral hemorrhages in these mutants have not been well characterized. Comparisons of the brain capillary defects of these mutants to those of integrin β8-deficient mutants may help to elucidate the mechanisms regulating brain vascular development. Brain vascular patterning is a complex process whose regulating mechanisms are poorly characterized. We show here that ablation of integrin β8 results in abnormal vascular capillary growth and patterning in the embryonic brain. Thus, integrin β8 is essential for normal development of the vascular network in the embryonic brain. In addition, the periventricular hemorrhage observed in the integrin β8-deficient mutant brain is reminiscent of that associated with germinal matrix hemorrhage (GMH), which affects premature human babies (Sherwood et al., 1978). Further analyses of the expression and functions of integrin β8 should help to unravel the regulatory mechanisms necessary to establish an organized capillary network in the embryonic brain and may also shed light on the cause of GMH. Acknowledgments We thank Tom Sato for Tie2:lacZ reporter mice; Steve Nishimura for sharing unpublished observations and critical reading of the manuscript; Ivy Hsieh for assistance on EM analysis; Donald McDonald for extensive insightful discussions; and Zhen Huang, Ursula Fuenfschilling and Ravi Majeti for helpful comments on the manuscript. This work was supported by NIH grant NS19090 and by the Howard Hughes Medical Institute (L. F. R.). J. Zhu is the recipient of an N.I.H. N.R.S.A. Fellowship. L. F. R. is an investigator of the Howard Hughes Medical Institute. References
|
PubMed related articles
Your browsing activity is empty. Activity recording is turned off. |
|||||||||||||||||||||||
Nature. 1997 Apr 17; 386(6626):671-4.
[Nature. 1997]Development. 1992 Oct; 116(2):435-9.
[Development. 1992]Nature. 1996 Apr 4; 380(6573):435-9.
[Nature. 1996]Nature. 1996 Apr 4; 380(6573):439-42.
[Nature. 1996]Nature. 1995 Jul 6; 376(6535):62-6.
[Nature. 1995]Nature. 1995 Jul 6; 376(6535):66-70.
[Nature. 1995]Cell. 1998 May 29; 93(5):741-53.
[Cell. 1998]Genes Dev. 1999 Feb 1; 13(3):295-306.
[Genes Dev. 1999]Cell. 2001 Jan 12; 104(1):57-69.
[Cell. 2001]Hum Mol Genet. 1999 May; 8(5):723-30.
[Hum Mol Genet. 1999]Genes Dev. 2000 Jun 1; 14(11):1343-52.
[Genes Dev. 2000]Development. 1992 Feb; 114(2):521-32.
[Development. 1992]Annu Rev Cell Dev Biol. 1995; 11():549-99.
[Annu Rev Cell Dev Biol. 1995]Thromb Haemost. 1997 Jul; 78(1):83-7.
[Thromb Haemost. 1997]J Clin Invest. 1999 May; 103(9):1227-30.
[J Clin Invest. 1999]Cell. 1998 Nov 13; 95(4):507-19.
[Cell. 1998]J Clin Invest. 1999 Jan; 103(2):229-38.
[J Clin Invest. 1999]J Biol Chem. 1991 Oct 15; 266(29):19650-8.
[J Biol Chem. 1991]J Biol Chem. 1994 Nov 18; 269(46):28708-15.
[J Biol Chem. 1994]Mol Biol Cell. 1995 Apr; 6(4):419-31.
[Mol Biol Cell. 1995]Glia. 1997 Dec; 21(4):350-60.
[Glia. 1997]Dev Biol. 1997 May 15; 185(2):215-28.
[Dev Biol. 1997]Proc Natl Acad Sci U S A. 1997 Apr 1; 94(7):3058-63.
[Proc Natl Acad Sci U S A. 1997]Cell. 1994 Mar 25; 76(6):989-99.
[Cell. 1994]Histochemistry. 1993 Dec; 100(6):431-40.
[Histochemistry. 1993]J Cell Biol. 2001 Apr 30; 153(3):543-53.
[J Cell Biol. 2001]J Cell Biol. 2001 Apr 30; 153(3):543-53.
[J Cell Biol. 2001]FEBS Lett. 1997 Jan 6; 400(3):297-303.
[FEBS Lett. 1997]Science. 2001 Oct 12; 294(5541):339-45.
[Science. 2001]Proc Natl Acad Sci U S A. 1997 Apr 1; 94(7):3058-63.
[Proc Natl Acad Sci U S A. 1997]Development. 1994 Sep; 120(9):2539-53.
[Development. 1994]J Anat. 1989 Jun; 164():85-92.
[J Anat. 1989]Proc Natl Acad Sci U S A. 1997 Oct 28; 94(22):12081-7.
[Proc Natl Acad Sci U S A. 1997]Am J Pathol. 2001 Mar; 158(3):1145-60.
[Am J Pathol. 2001]J Comp Neurol. 1972 May; 145(1):61-83.
[J Comp Neurol. 1972]Nature. 2001 Feb 8; 409(6821):714-20.
[Nature. 2001]Neuroscience. 1990; 36(1):121-44.
[Neuroscience. 1990]Neuron. 1998 Nov; 21(5):1031-44.
[Neuron. 1998]Nat Neurosci. 2001 Nov; 4 Suppl():1169-76.
[Nat Neurosci. 2001]Development. 1992 Feb; 114(2):521-32.
[Development. 1992]J Mol Med. 1999 Jul; 77(7):527-43.
[J Mol Med. 1999]Proc Natl Acad Sci U S A. 1997 Oct 28; 94(22):12081-7.
[Proc Natl Acad Sci U S A. 1997]Am J Pathol. 2001 Mar; 158(3):1145-60.
[Am J Pathol. 2001]Cell. 1998 Nov 13; 95(4):507-19.
[Cell. 1998]Dev Dyn. 1994 Oct; 201(2):108-20.
[Dev Dyn. 1994]J Clin Invest. 1999 Jan; 103(2):229-38.
[J Clin Invest. 1999]Mol Cell Biol. 2000 Feb; 20(3):755-9.
[Mol Cell Biol. 2000]J Cell Biol. 1996 May; 133(4):921-8.
[J Cell Biol. 1996]Science. 2001 Feb 16; 291(5507):1304-51.
[Science. 2001]Cell. 1998 Nov 13; 95(4):507-19.
[Cell. 1998]Mol Biol Cell. 1998 Sep; 9(9):2627-38.
[Mol Biol Cell. 1998]Cell. 1999 Feb 5; 96(3):319-28.
[Cell. 1999]Nat Genet. 1994 Dec; 8(4):345-51.
[Nat Genet. 1994]J Cell Biol. 2001 Apr 30; 153(3):543-53.
[J Cell Biol. 2001]Development. 1999 Jun; 126(14):3047-55.
[Development. 1999]Neuropathol Appl Neurobiol. 1978 Jul-Aug; 4(4):245-61.
[Neuropathol Appl Neurobiol. 1978]