pmc logo image
Logo of nihpaNIHPA bannerabout author manuscriptssubmit a manuscript
Journal List > NIHPA Author Manuscripts

Formats:
Mol Microbiol. Author manuscript; available in PMC 2009 July 14.
Published in final edited form as:
Mol Microbiol. 2008 December; 70(5): 1062–1075.
doi: 10.1111/j.1365-2958.2008.06485.x.
PMCID: PMC2709978
NIHMSID: NIHMS118854
Copyright notice and Disclaimer
Mechanistic insight into the ribosome biogenesis functions of the ancient protein KsgA
Keith Connolly,1 Jason P. Rife,2 and Gloria Culver1*
1Departments of Biology and of Biochemistry and Biophysics, University of Rochester, Rochester, New York 14627, USA
2Department of Medicinal Chemistry and Institute for Structural Biology and Drug Discovery, Virginia Commonwealth University, Richmond, Virginia 23298, USA
*To whom correspondence should be addressed: Email: gculver/at/mail.rochester.edu, Phone #: 585-276-3602, Fax #: 585-275-2070
Small right arrow pointing to: The publisher's final edited version of this article is available at Mol Microbiol.
Small right arrow pointing to: See commentary "Ribosome biogenesis; the KsgA protein throws a methyl-mediated switch in ribosome assembly." in Mol Microbiol, volume 70 on page 1051.
 
Small right arrow pointing to: See other articles in PMC that cite the published article.
Summary
While the general blueprint of ribosome biogenesis is evolutionarily conserved, most details have diverged considerably. A striking exception to this divergence is the universally conserved KsgA/Dim1p enzyme family, which modifies two adjacent adenosines in the terminal helix of small subunit ribosomal RNA (rRNA). While localization of KsgA on 30S subunits (SSUs) and genetic interaction data have suggested that KsgA acts as a ribosome biogenesis factor, mechanistic details and a rationale for its extreme conservation are still lacking. To begin to address these questions we have characterized the function of E. coli KsgA in vivo using both a ksgA deletion strain and a methyltransferase deficient form of this protein. Our data reveals cold sensitivity and altered ribosomal profiles are associated with a ΔksgA genotype in E. coli. Our work also indicates that loss of KsgA alters 16S rRNA processing. These findings allow KsgAs role in SSU biogenesis to be integrated into the network of other identified factors. Moreover, a methyltransferase-inactive form of KsgA, which we show to be deleterious to cell growth, profoundly impairs ribosome biogenesis prompting discussion of KsgA as a possible anti-microbial drug target. These unexpected data suggest that methylation is a second layer of function for KsgA and that its critical role is as a supervisor of biogenesis of SSUs in vivo. These new findings and this proposed regulatory role offer a mechanistic explanation for the extreme conservation of the KsgA/Dim1p enzyme family.
Keywords: KsgA, Dim1p, rRNA processing, ribosome biogenesis
Ribosome biogenesis is a fundamental, multi-step process in all organisms. Processing of ribosomal RNA (rRNA) from a primary transcript, modification of rRNAs and ribosomal proteins (r-proteins), and association of the r-proteins with rRNA requires a high level of coordination as well as a host of additional factors. The fruition of this process is two discrete ribosomal subunits that associate during translation initiation to form the functional ribosome. In general, such a simplified scheme of ribosome biogenesis appears to be representative of the process throughout evolution.
Examination of ribosome biogenesis at the level of nucleotide modification reveals much divergence of the ribosome maturation process between prokaryotes, eukaryotes, and archaea. In particular, among all rRNA modifications, only three are conserved throughout all three kingdoms. One is the conversion of U1958 (E.coli numbering) to psuedouridine in large ribosomal subunit (LSU) rRNA (Ofengand, 2002). While this modification itself is conserved, the machinery, and therefore the mechanism by which it is accomplished, differs depending on the kingdom and organism (Ofengand, 2002). The other modifications conserved throughout evolution, are the dimethylations of two adjacent adenosines [A1518 and A1519 (E. coli numbering)] in the universally conserved 3′ terminal helix of the small ribosomal subunit (SSU) rRNA [helix 45; (Brimacombe, 1995), (Van Knippenberg et al., 1984)]. These dimethylation modifications, which are present on almost all known ribosomes with the exception of only two organellar instances (Klootwijk et al., 1972, Noon et al., 1998, Steege et al., 1982, Van Buul et al., 1984), are catalyzed by the universally conserved Dim1p/KsgA enzyme family. Hence, these two methylations and the enzyme family responsible for them are unparalleled in terms of their representation in SSU biogenesis and present an interesting challenge to uncover the evolutionary and functional significance of this rRNA modification system.
Identification of ksgA came following the isolation of E. coli strains that were resistant to the aminoglycoside antibiotic kasugamycin due to the lack of methylation of A1518 and A1519 (Helser et al., 1972, Sparling, 1970, Poldermans et al., 1979c). Complementation studies in E. coli identified Dim1p as the yeast ortholog of ksgA. These studies required and took advantage of the ability of Dim1p to methylate E. coli SSU rRNA in vivo, therefore clearly demonstrating the extreme conservation at the catalytic level of this enzyme family (Lafontaine et al., 1994). Dim1p was demonstrated to be essential due to an additional 18S rRNA processing function (Lafontaine et al., 1995). Use of a mutant allele of dim1 (dim1-2) revealed that lack of dimethylation of helix 45 did not alter cell growth (Lafontaine et al., 1998). Thus, methylation of the two adenosines in neither E. coli (Poldermans et al., 1979a, Poldermans et al., 1979c) nor S. cerevisiae (Lafontaine et al., 1998) is essential in spite of the nearly universal conservation of this methyltransferase system. These results suggested that another function might exist that could explain the retention of these genes from an ancient ancestor.
The cellular importance and a molecular understanding of Dim1p function in S. cerevisiae have been more forthcoming than this level of detail for KsgA in prokaryotes. Many previous studies of KsgA function have been performed using selected kasugamycin-resistant strains, which have been shown to lack dimethylation of helix 45 but have generally not otherwise been well characterized and thus have limited the interpretation of these data. In vitro studies, however, have shown that treatment of precursor SSU particle components with KsgA prior to their in vitro reconstitution increased their activity in a polypeptide synthetic assay when compared to their untreated counterparts (Igarashi et al., 1981). Interestingly, methylation of mature reconstituted SSUs had no significant effect on their performance in the same assay suggesting the methylation system is important in biogenesis rather than translation per se (Igarashi et al., 1981). Furthermore, despite the extreme conservation of both the sequence and modifications at A1518 and A1519, neither changes of the sequence nor methylation appear to affect in vitro incorporation of SSUs to 70S ribosomes (Cunningham et al., 1991, Cunningham et al., 1990); while in vivo the absence of methylation at A1518 and A1519 in helix 45 has a subtle impact on read-through of nonsense and frame shift mutations (van Buul et al., 1984). Also, KsgA has been genetically linked to a number of factors involved in ribosome function by either rescuing growth defects upon overexpression (Lu & Inouye, 1998) or exacerbating growth defects when genetically deleted in already compromised strains (Campbell & Brown, 2008).
Recently, we proposed a model for interaction of KsgA with SSUs and based on these in vitro findings suggested a role for KsgA in limiting access of SSUs to IF3 and 50S subunits (Xu et al., 2008). However, it was unclear how such a role for KsgA would manifest itself in the context of complex cellular milieu of the SSU biogenesis and translational pathways. Also, it was unclear if such a role would be conserved for the KsgA family of proteins. To more completely interrogate the function of KsgA we have used an E. coli strain with a precise deletion of ksgA. Herein we present data that demonstrates the ΔksgA genotype results in cold sensitivity and altered ribosome profiles with a shift in the characteristic populations of free SSUs and SSUs in the 70S ribosome. Moreover, although absence of KsgA is not lethal, it does result in SSU rRNA processing defects reminiscent of those found upon Dim1p depletion, while LSU rRNA processing is unaltered. Functions whose loss results in the cold-sensitive phenotype may be conserved as overexpression of archeal (M. jannaschii) and to a lesser extent eukaryotic (S. cerevisiae) homologs of KsgA (referred to as Dim1p) can suppress this phenotype (unpublished results). Thus, it appears that KsgA is a bona fide SSU biogenesis factor and that this function is conserved. To determine the role of methylation by KsgA in biogenesis in vivo, a methyltransferase deficient form of KsgA was analyzed. Surprisingly, this did not decouple the biogenesis and modification activities; the catalytically-inactive KsgA has a negative effect on growth and alters ribosome formation of both wild-type and ΔksgA strains. Thus, the presence of KsgA in a form that is unable to methylate SSUs is more detrimental to ribosome formation than the complete absence of KsgA. This mutant form of KsgA is stably bound to SSUs formed in vivo and thus suggests a mechanism to describe the associated phenotypes.
Our findings suggest that KsgA functions as a late stage ribosome biogenesis factor and that methylation is a trigger for release of KsgA from the assembling subunits. Thus, release of KsgA from the newly mature SSU may be regulated by methylation and be accompanied by conformational rearrangements that allow final maturation and entrance into the translation cycle. We have constructed a model that describes roles for KsgA in SSU biogenesis, as well as, the consequences on SSU biogenesis when either no KsgA or a catalytically inactive KsgA form is present. This novel functional role for KsgA and possibly its homologs offers a functional mechanistic explanation for the extreme conservation of the KsgA/Dim1p enzyme family given that modification of the two adjacent adenosines in SSU rRNA is dispensable.
Deletion of ksgA results in a cold sensitive growth phenotype
While a role for KsgA and related family members in SSU rRNA modification has been well established, roles in ribosome biogenesis and the functional consequences of methylation are less well understood. As mentioned above, many studies of KsgA function were performed in selected kasugamycin resistant strains and thus generally not in distinct, isogenic and well-characterized genotypic backgrounds. In order to more completely interrogate the role of KsgA in vivo, an E. coli strain harboring a clean deletion of ksgA was prepared as part of the Keio Collection and was used in this work (E. coli strain JW0050-3 (Baba et al., 2006); herein referred to ΔksgA). The growth of ΔksgA was compared to growth of its parental strain (BW25113) at 37° C (permissive temperature), 25° C (low temperature) and 20° C (Figure 1A and BFigure 1). At permissive temperature growth of the two strains is comparable (Figure 1A and BFigure 1). When the two strains are compared at low temperature (25°C), the ΔksgA strain has a marked growth defect compared to the parental strain (Figure 1A and BFigure 1) and this effect is further exacerbated at even lower temperature (20°C) (Figure 1A and BFigure 1). This phenotype was also apparent in a separate genetic background bearing deletion of the ksgA gene (ΔksgA-K12; data not shown). Thus, although KsgA is not essential for growth under optimal conditions, this gene is important for cell growth at low temperatures. Since cold sensitivity is often observed when factors involved in ribosome biogenesis are defective and since E. coli strains which are resistant to the antibiotic kasugamycin, and therefore lack methylation at A1518 and A1519, have not been reported to be cold sensitive, further study of the ΔksgA strain was undertaken.
Figure 1
Figure 1
Figure 1
Deletion of ksgA results in cold sensitivity and altered ribosome profiles
Deletion of ksgA results in altered SSU population properties
We next asked if the cold sensitive phenotype associated with ksgA deletion was in fact related to a ribosome biogenesis defect. Ribosomes and ribosomal subunits formed in both the parental and ΔksgA strains were examined using sucrose gradient sedimentation profiles (Figure 1CFigure 1). Unlike some strains that lack SSU biogenesis factors (Dammel & Noller, 1993, Guthrie et al., 1969), a discrete precursor SSU particle was not observed in the absence of KsgA (Figure 1CFigure 1 I and III). However, there are striking differences in the ribosome profiles obtained from the ΔksgA strain compared to its parental strain particularly at low temperature. [We chose 25° C as our low temperature since growth of ΔksgA is significantly altered at this temperature, but growth of the parental strain and ribosome biogenesis processes are less so than at even lower temperatures (Figure 1A and BFigure 1 and data not shown)]. Focusing on the SSU population, the percentage of free SSUs and SSUs in 70S ribosomes was calculated for the ΔksgA strain as well as the parental strain (Figure 1CFigure 1). At permissive temperature the percentage of free SSUs is slightly higher in the ΔksgA strain (Figure 1CFigure 1 I; 14±5.0%) compared to the parental strain (Figure 1CFigure 1 II; 10±2.4%). At low temperature the percent of free SSUs increases in both strains, however, the effect of deletion of ksgA on SSU biogenesis is exacerbated by low temperature and results in a significant accumulation of SSUs in the free form (Figure 1CFigure 1 III; 40±2.2%) when compared to the parental strain (Figure 1CFigure 1 IV; 25±0.5%). These increases parallel the growth defects at the lower temperature (Figure 1A and BFigure 1) presumably because a smaller percentage of subunits are in a translationally active state due to less efficient ribosome biogenesis. Although the amount of monosomes is comparable in the ΔksgA and parental strains at low temperature few if any polysomes are observed in ΔksgA strains (data not shown). Thus, KsgA appears to play a role in establishing the ratio of functional subunits found in vivo and has altered ribosome profiles very similar to strains lacking era (Inoue et al., 2006) and yjeQ (Campbell & Brown, 2008) activity, two GTPases involved in SSU biogenesis. Thus, KsgA appears to be a bona fide SSU biogenesis factor.
Overexpression of KsgA effects growth of ΔksgA and SSU distribution
As with any deletion in a polycistronic background, one concern is that polar effects may play some role in the defects associated with ksgA deletion. To investigate this possibility we explored whether overexpression of KsgA could rescue phenotypes exhibited by the ΔksgA strain. At the low temperature, expression of plasmid encoded KsgA from an inducible promoter partially alleviates the cold-sensitive phenotype in ΔksgA (Figure 2AFigure 2). Interestingly, overexpression of KsgA at permissive and low temperatures in the parental strain is of no advantage under growth conditions in liquid media (data not shown) and moreover dilution plating experiments reveal a deleterious effect of overexpression of KsgA in both ΔksgA and parental strains at 37° C (Figure 2AFigure 2; see materials and methods). The changes in growth in response to KsgA dosage is consistent with the location of ksgA in a highly regulated operon (van Gemen et al., 1989, Pease et al., 2002, Roa et al., 1989), and implications of increased KsgA concentration and its potential impact in translation initiation are discussed below. To confirm that these data were due to KsgA and could not be attributed to the tagged version of the protein, overexpression experiments using both KsgA and E66A KsgA (see below) lacking epitope tags were performed. Similar results were obtained with these untagged proteins as with their tagged counterparts (data not shown). In addition, previous studies have shown that this His tagged version of KsgA is as catalytically active as the untagged version in methylation reactions performed in vitro (O'Farrell et al., 2004). Moreover herein we demonstrate catalytic activity of tagged KsgA in vivo. (Figure 4CFigure 4). For simplicity and to facilitate other experiments, the tagged forms of KsgA and mutants were used in the subsequent experiments.
Figure 2
Figure 2
Figure 2
Overexpression of KsgA and E66A KsgA alter growth characteristics of ΔksgA and alter the state of SSUs
Figure 4
Figure 4
Figure 4
KsgA and E66A KsgA associate with accumulated 30S ribosomal subunit peaks
Overexpression of KsgA has an obvious effect on growth of ΔksgA at low temperature (Figure 2AFigure 2). To investigate if changes in ribosome profiles were part of the physiological cause of these different growth rates sucrose gradient sedimentation profiles were again analyzed to examine SSU populations in regard to their propensity to be in the 70S ribosome or free form. Surprisingly, at low temperature where growth of ΔksgA is rescued, a larger percentage of the SSU population is in the free form [Figure 2BFigure 2 III; 37±4.8% (ΔksgA + empty vector) and 56±2.4% (ΔksgA + KsgA)]. In fact, in both ΔksgA and parental strains, KsgA overexpression leads to an increase in free SSUs relative to the total SSU population at both permissive and low temperatures (Figure 2CFigure 2). One explanation for the seemingly contradictory data where KsgA overexpression rescues growth at low temperature in ΔksgA while causing an accumulation of free SSUs is induction of KsgA could rescue the ribosome biogenesis defect in ΔksgA, as exemplified by changes in cell growth, while having an inhibitory effect on SSU entrance into translationally competent ribosomes, as monitored by an increase in free SSUs (see below). Although these effects are somewhat subtle, growth phenotypes uncovered at low temperature using dilution plating support this interpretation (Figure 2AFigure 2).
Processing of 16S rRNA is altered in the absence of KsgA
It is possible that the increase in free SSUs results from defects in late stages of SSU biogenesis, such as defects in rRNA cleavage and processing. Mature SSU rRNA (16S rRNA) is the end product of sequential processing of a primary transcript containing both the SSU and LSU sequences as well as intervening sequences (Figure 3AFigure 3). An intermediate in this processing cascade is a precursor 16S form, termed 17S, which is the product of RNase III cleavage separating SSU rRNA from the remainder of the primary transcript (Srivastava & Schlessinger, 1990). Processing of 17S by RNases E and G and an unknown nuclease produce the mature 5′ and 3′ ends, respectively (Srivastava & Schlessinger, 1990). Comparison of mature 16S rRNA and the processing intermediates is therefore a measure of SSU rRNA processing efficiency.
Figure 3
Figure 3
Figure 3
KsgA impacts SSU rRNA processing in vivo
Agarose gel electrophoresis used to separate the rRNA species contained in total rRNA extracted from both the ΔksgA and parental strains grown at 37° C and 25° C revealed an increase level of 17S rRNA in the ΔksgA strain grown at low temperature (Fig. 3BFigure 3). Additionally, primer extension and northern experiments were performed to verify the accumulation of 17S rRNA and not other intermediates of the SSU rRNA processing cascade (data not shown). Thus, the free 30S particles observed in the ribosome profiles likely represent immature SSUs. To assess the processing defect, the percent of 17S rRNA among the total SSU rRNA was calculated (Figure 3BFigure 3). At permissive temperature, the percentage of 17S rRNA is comparable in both strains [Figure 3BFigure 3; lane 1, 1% (ΔksgA), and lane 2, 0% (parental)]. At low temperature however, the percentage of 17S is dramatically increased in the ΔksgA strain (Figure 3BFigure 3; lane 3, 33%) when compared to the parental strain at low temperature (Figure 3BFigure 3; lane 4, 15%). This impaired processing coincides with and may explain the altered ribosome profiles of the ΔksgA strain at low temperature (Figure 1CFigure 1). In addition there is no significant difference in LSU rRNA processing between the two strains at either permissive or low temperature (data not shown). Again this defect in 16S rRNA maturation is very similar to what is observed when other ribosome biogenesis factors are deleted or mutated (Bylund et al., 1998, Inoue et al., 2003). These findings indicate that KsgA is a SSU biogenesis factor in vivo and that its function may extend beyond 16S rRNA methylation.
Expression of a catalytically inactive form of KsgA is deleterious to cell growth at all temperatures and alters SSU distribution
Next, we wished to address whether the methyltransferase activity of KsgA was required for its ribosome biogenesis role and more specifically 16S rRNA maturation. Based on crystallographic evidence and methyltransferase studies (Inoue et al., 2007, O'Farrell et al., 2004) an alanine substitution for glutamic acid at position 66 (E66A KsgA) results in inhibition of S-adenosyl-methionine (SAM) cofactor binding and thus eliminates KsgAs methyltransferase activity. To verify the KsgA proteins used in these studies were either capable of proper catalysis (WT KsgA) or were catalytically inactive (E66A KsgA), primer extension experiments were performed to assess the methylation of A1518 and A1519 of 16S rRNA in vivo (Figure 3CFigure 3). Only when WT KsgA is overexpressed in ΔksgA is a prominent stop due to these rRNA modifications observed (Figure 3CFigure 3, lane2). Indeed, the primer extension stop is so extensive that no readthrough to the next modification at 1516 is observed. Overexpresstion of E66A KsgA does not result in a distinct primer extension stop at the appriopriate position (Figure 3CFigure 3, lanes 3 and 4), which is consistant with in vitro assays that were unable to detect methyltransfer by this protein (H. O'Farrell and JPR, unpublished results). This catalytically inactive form of KsgA was used to assess whether methyltransfer was required or involved in the other functions of KsgA. Remarkably, dilution plating experiments show overexpression of E66A KsgA is deleterious to growth of ΔksgA and, to a lesser extent, parental strains at both temperatures tested (Figure 2AFigure 2). This is especially intriguing considering the absence of the dimethylation modification on A1518 and A1519 can be tolerated, especially at permissive temperature [Figure 2A and 2BFigure 2 I and II; (Poldermans et al., 1979c)]. The growth defect associated with E66A KsgA suggests that a form of the protein that is incapable of methylation is less tolerated in vivo than no KsgA protein. Additionally, this result is very different from what is observed as expression of a catalytically inactive allele of dim1 does not alter cell viability in S. cerevisiae (Lafontaine et al., 1998). Thus, methylation by KsgA is critical when KsgA is present but the methylations are not important in and of themselves.
Given the severe growth effect of E66A KsgA, the impact of this mutant allele on ribosome profiles was next examined. Overexpression of E66A KsgA has a profound effect on the state of the SSU population in both ΔksgA and parental strains at permissive and low temperatures (Figure 2BFigure 2; also see Figure 4A and BFigure 4 for representative profiles). The marked increase in free SSUs is consistent with growth data suggesting a lower percentage of SSUs are able to complete biogenesis and accumulate in the free form instead of participating in translation. The effects of E66A KsgA overexpression are less severe in the parental strain, presumably because of competition with endogenous wild-type KsgA; however in the ΔksgA strain, where no such competition exists >95% of SSUs exist in the free form at both temperatures (Figure 2BFigure 2 I and III). These data suggest E66A KsgA may efficiently sequester SSUs in the free form and limit their participation in the translation cycle. The increased portion of free SSUs observed upon induction of the methyltransferase deficient form of KsgA implicates the modification of 16S rRNA by this enzyme as an important component of KsgA function and may regulate release of KsgA and therefore the transition of the immature SSUs to final stages of biogenesis and the translation cycle.
Overexpression of KsgA alters 16S rRNA processing
Given the results for overexpression of wild-type and E66A forms of KsgA on growth and ribosome profiles, the effect of overexpression of these proteins on 16S rRNA processing was also evaluated to determine if the accumulated free subunits are mature or if they contain precursor 16S rRNA. The extent of maturation of 16S rRNA as monitored by 17S precursor rRNA percentage is slightly changed upon overexpression of wild-type KsgA in the ΔksgA strain at low temperature (Figure 3DFigure 3, compare lanes 7 & 8). This suggests that there is a slight increase in the amount of fully matured subunits and thus correlates well with the partial rescue of the slow growth phenotype upon induction of wild-type KsgA (Figure 2AFigure 2). Surprisingly, under other conditions overexpression of KsgA results in an increase in precursor 16S rRNA compared to controls. Induction of wild-type KsgA at permissive temperature in both the ΔksgA and parental strains and at low temperature in the parental strain results in an increase in 17S rRNA (Figure 3DFigure 3, lanes 2, 5 & 11). It appears that when KsgA is expressed at concentrations above its endogenous level the SSU rRNA processing cascade is stalled and immature SSUs accumulate (see below). These findings will aid in integrating, temporally, the functions of KsgA relative to other SSUs biogenesis events.
The stall in 16S rRNA maturation is further exacerbated when catalytically inactive KsgA is overexpressed (Figure 3DFigure 3). There is an increase in the relative amounts of 17S rRNA in both strains and at both temperatures upon induction of E66A KsgA (Figure 3DFigure 3; lanes 3, 6, 9 & 12). At low temperature there is a slight difference between the ΔksgA (Fig. 3DFigure 3, lane 9) and parental strains (Fig. 3DFigure 3, lane 12), which again could be explained by competition between the recombinant mutant allele and the endogenous wild-type allele in the parental background. These findings suggest that the rRNA modification performed by KsgA is an important component of appropriate and complete SSU maturation.
KsgA and E66A KsgA associate with SSUs
As a means of understanding the effect of KsgA and E66A KsgA on SSU rRNA maturation and ribosome profiles, the ability of these proteins to associate with ribosomal subunits was examined. To monitor association, fractions spanning entire sucrose gradient sedimentation profiles for ΔksgA grown at permissive temperature overexpressing either KsgA or E66A KsgA were examined via Western analysis. At the permissive temperature in the ΔksgA strain where overexpression of KsgA induces an accumulation of free SSUs, KsgA is detectable in the SSU peak (Figure 4AFigure 4). An antibody recognizing SSU protein S3 was used to verify the position of the SSU peak within the sedimentation profile (Figure 4A and BFigure 4). A 45S-like peak was observed in some profiles but was not reproducible and therefore was not carefully scrutinized in this work. Interestingly, when E66A KsgA is overexpressed in ΔksgA at permissive temperature the peak of free SSUs contains a substantial portion of the E66A KsgA (Figure 4BFigure 4). Although there appears to be lower expression of WT KsgA than E66A KsgA in the sedimentation profiles, Western analysis of serially diluted cell lysate (same lysate examined in Figure 4A and BFigure 4) shows expression levels are comparable relative to expression of endogenously expressed S3 (Figure 4CFigure 4). The apparent disparity in amounts of WT and E66A KsgA in the ribosome profiles is likely due to normalization of RNA for loading. A larger percentage of 30S (or 30S-like) subunits found in the E66A KsgA overexpression profiles compared to WT KsgA overexpression profiles. Additionally, a significant portion of the rRNA containing species in the WT KsgA overexpression profile are in the form of polysomes (data not shown), which are not observed in this experiment and do not bind KsgA. These data indicate that in vivo a methyltransferase deficient form of KsgA (E66A KsgA) associates strongly with SSUs suggesting the dimethylation function of KsgA may be important for release of the enzyme from the SSU. Indeed, these findings would support the model that binding of KsgA to the SSU is a block to later steps in the SSU biogenesis pathway, such as cleavage of 17S rRNA to mature 16S rRNA and association with the LSU. A sufficiently mature SSU structure may prompt methylation and KsgA release which appears to be required for SSU and LSU association as very few 70S ribosomes are formed when E66A KsgA is overexpressed (Figure 4BFigure 4). In addition, KsgA does not seem to bind SSUs in a translationally active state (Figure 4A and BFigure 4). A possible mechanism by which KsgA may perform this monitoring function is by requiring a specific SSU conformation allowing KsgA to access target sites on the SSU.
To further investigate the role of KsgA in accumulation of free immature SSUs, the percentage of free SSUs was analyzed as a function of varying concentrations of inducer (arabinose for KsgA expression from pBAD; see experimental procedures). As inducer concentration increases there is a corresponding increase in the percent of SSUs in the free form when compared to growth under the same conditions while empty vector is induced (Figure 4DFigure 4). Western analysis confirms that KsgA expression increased across this range of inducer (data not shown). Thus, KsgA concentration appears to correlate with the accumulation of free SSUs and more importantly with immature SSU. These data support a model where an elevated concentration of KsgA or the presence of catalytically inactive KsgA increase the amount of KsgA bound to assembling SSU and thus would play a role in the accumulation of free SSUs by limiting the later stages of SSU maturation and thereby preventing SSUs from entering the translation cycle. Chemical probing work to localize KsgA on the SSUs is supportive of this model since the KsgA interaction site overlaps with that of Initiation Factor 3 (IF3) and 50S subunits (Xu et al., 2008). Also of note, in the ΔksgA strain overexpression of E66A KsgA results in, along with the other changes, an obvious pre-30S peak at both temperatures (Figure 4BFigure 4 and data not shown). This type of peak is suggestive of an intermediate in the SSU biogenesis pathway (Dammel & Noller, 1995, Guthrie et al., 1969, Nashimoto et al., 1971) and may indicate that once the biogenesis cascade is perturbed and rRNA maturation is stalled, additional defects in the SSU biogenesis process can be revealed. This novel perturbation of the SSU biogenesis pathway may prove an invaluable tool for dissecting events in the biogenesis cascade that would otherwise be opaque.
Analysis of ribosome biogenesis in a ΔksgA strain reveals interesting new roles for KsgA and mechanistic details of the function of this conserved methyltransferase family. Absence of KsgA results in a cold sensitive phenotype that can be attributed to a defect in ribosome biogenesis exhibited by altered ribosome profiles and SSU rRNA processing defects. An attempt to decouple the methyltransferase function of KsgA from a possible function in facilitating SSU biogenesis revealed a surprising, unprecedented effect; overexpression of the catalytically inactive form of E66A KsgA caused a growth defect at all temperatures and in both the wild-type and ΔksgA backgrounds. Moreover, the catalytically inactive E66A KsgA associates with SSUs and promotes an accumulation of free SSU (or SSU-like) particles which appear unable to form 70S ribosomes and precursor 16S rRNA. Additionally, the unique results obtained with wild-type and catalytically inactive KsgA suggest a model whereby methylation by KsgA is critical for release of the protein from the assembling subunit and for the advancement of these subunits to the next and final stages of maturation. Thus the results from the studies herein clearly describe an in vivo role for KsgA in SSU biogenesis and offer genetic and biochemical data to describe how this protein plays a role in monitoring SSUs in the biogenesis pathway. The role of methylation in KsgA function and biogenesis may explain the extreme conservation of the enzyme family and rRNA modifications.
Our findings are most easily explained in the context of the whole SSU biogenesis cascade and translation initiation machinery. Figure 5Figure 5 illustrates models for SSU biogenesis/translation initiation in vivo in light of our findings and other data reported in the literature. It is not surprising that cells lacking the ksgA gene are viable since work with kasugamycin resistant strains, has shown that methylation of A1518 and A1519 is not required for growth (Poldermans et al., 1979c). In the absence of KsgA (Figure 5AFigure 5), SSU biogenesis is slowed; in particular rRNA processing (Fig. 3Figure 3) is retarded when compared to SSU biogenesis in the presence of KsgA (Figure 5BFigure 5). Additionally, the accumulation of free SSUs observed in the absence of KsgA (Figure 1CFigure 1 III) is consistent with previous work where, in an E. coli mutant background defective in the gene coding for SSU r-protein S20, lack of methylation at A1518 and A1519 is correlated with SSUs with an apparent reduced capacity to form functional 70S ribosomes (Ryden-Aulin et al., 1993). Recent reports have also described a correlation between SSU rRNA methylation and selection of initiator tRNA suggesting that modification by KsgA may be important in formation of 70S ribosomes during translation initiation processes (Das et al., 2008). Additionally, it has been shown that SSUs from kasugamycin resistant strains interact less well with 50S subunits and other components important for translation initiation, mainly IF3, than do their methylated counterparts (Poldermans et al., 1979b, Poldermans et al., 1979c). Thus the entrance into the translational cycle for these SSUs would be slowed. These interactions could be perturbed by the defect in 16S rRNA maturation observed in ΔksgA strains and thus somewhat impair the biogenesis cascade. At normal growth temperatures, biogenesis seems able to bypass the role of KsgA and occur at a rate competent to support growth; however at low temperatures biogenesis is impaired more significantly and thus the slow growth phenotype is revealed.
Figure 5
Figure 5
Figure 5
Model of proposed roles of KsgA in SSU Ribosome Biogenesis
In wild-type cells ksgA is situated on a tightly regulated and complex operon which has been examined extensively (Pease et al., 2002, Roa et al., 1989, van Gemen et al., 1989). In vitro work has suggested that KsgA binds early in biogenesis but methylates when an appropriate level of assembly has been reached (Lafontaine et al., 1998, Thammana & Held, 1974). Thus, a regulatory role of KsgA could restrict immature subunits from entering final stages of biogenesis and thus the translational cycle (Figure 5BFigure 5). Our data suggests that KsgA remains bound until it can methylate; it is likely that methylation, release of KsgA and conformational changes that render the SSU in a more active conformation or a conformation more suitable for rRNA processing (Poldermans et al., 1979c, Poldermans et al., 1979b) are linked at this stage of biogenesis. Methylation by KsgA would only occur at a particular level of assembly and likely influence the structural conformation of the SSUs. An excess cellular concentration of KsgA could shift the equilibrium of free KsgA and KsgA-SSU (Figures 3Figure 3 & 4Figure 4) thus preventing introduction of these subunits into the translation cycle. Our model does not account for the likely possibility that excess cellular concentration of KsgA could allow KsgA to promiscuously bind mature SSUs participating in the translation cycle rather than only SSUs in the biogenesis cascade. Consistent with our findings and our interaction model for KsgA/SSU binding (Xu et al., 2008), earlier studies of KsgA show that SSU particles with bound KsgA have a reduced affinity for the LSU (Poldermans et al., 1979b). More recently a similar deleterious growth result has been reported in studies using overexpression of KsgA in a mutant era genetic background, although a role of KsgA in acid-shock response was proposed to explain this function (Inoue et al., 2007). Our data indicate that the growth effect is observed in multiple backgrounds and is not dependent on mutations in era. Our findings position KsgA within the biogenesis cascade and offer an explanation of the conserved methyltransferase activity of this ancient protein family.
The catalytically inactive E66A KsgA similarly binds the SSU during biogenesis (Fig. 3Figure 3 and and4)4Figure 4) but, as a result of its inability to catalyze the methylation reaction, remains bound to the 30S subunit excluding it from the translation cycle (Figure 5CFigure 5) and thus has a negative effect on cell growth. This interpretation is supported by work performed by Polermans et al. (1979b) demonstrating the propensity of KsgA to be bound to substrate SSU particles is drastically increased in the absence of SAM. These studies do not, however, rule out the possibility that SAM binding, not methylation, is the key trigger for the biogenesis function of KsgA. An excess cellular concentration of KsgA or E66A KsgA prevents translation initiation as demonstrated by an increase in the free SSUs and consequently a drastic reduction in 70S ribosome populations (Figure 4A and BFigure 4). This stall prior to the translational cycle likely leads to a subsequent SSU rRNA processing and biogenesis defect, since it has previously been suggested that final maturation of 16S rRNA is coupled to translation itself (Mangiarotti et al., 1974, Hayes & Vasseur, 1976). Thus, our work is consistent with previous findings, but for the first time offers a clear context, and a novel regulatory role for KsgA in vivo, in which to interpret these otherwise disparate results.
When KsgA is removed from the cell via a genetic knockout, accumulation of 17S rRNA processed at the 5′ and 3′ end by RNase III, but not RNase G or RNase E at the 5′ end, or an unknown RNase at the 3′ end, results (Figure 3AFigure 3 and data not shown). A comparison of 17S and 16S rRNA populations contained in total RNA extractions from the ΔksgA and parental strains illustrate this SSU rRNA processing defect (Figure 3BFigure 3) as was shown, although proved lethal, when Dim1p was removed from S. cerevisiae. Many mutations in E. coli result in rRNA processing defects, which are usually manifested as a 21S intermediate (Kaczanowska & Ryden-Aulin, 2007). KsgA is distinct in this regard and fits into a smaller group of proteins such as Era and YjeQ (Inoue et al., 2006, Campbell & Brown, 2008) where mutations or deletions result in similar phenotypes to those reported here for deletion of ksgA. Although this processing defect is not lethal in E. coli, the data are suggestive of functional conservation of the KsgA/Dim1p family. It should be noted that although phenotypes associated with catalytically inactive Dim1p are not consistent with our data using a catalytically inactive KsgA, these differences might be due simply to differences in binding affinity of KsgA and Dim1p to precursor SSUs. The experimental differences could also result from differences in ribosome biogenesis components and processes (i.e. transport between cellular compartments) rather than fundamental disparities in mechanism or function of the protein family.
The altered affinity of SSU-KsgA or SSUs unmethylated at A1518 and A1519 may be the mechanism by which KsgA supervises SSU maturation as a quality control agent. Our data further supports this mechanism because KsgA, as well as E66A KsgA, is present in sucrose gradient fractions that contain the SSU with reduced capacity to form 70S ribosomes (Figure 4A and BFigure 4). Additionally, few if any polysomes are apparent when KsgA (wild-type or E66A) is overexpressed (data not shown). Previous studies also show SSU–KsgA complexes incubated with methyl donor, S-adenosyl-L-methionine (SAM), resulted in a decrease in the stability of the SSU-KsgA complex and an increase in the affinity between SSU and LSU (Poldermans et al., 1979b). Likewise, overexpression of E66A KsgA induces an accumulation of SSU-KsgA (Figure 4BFigure 4). This, as would be predicted from earlier studies, may elicit an accumulation of the SSU-KsgA complex as a result of its low affinity for the LSU (Figure 4A and BFigure 4) and consequently there is a striking decrease in translationally competent ribosomes and severe growth defect. Elucidating a mechanism of KsgA activity could also be beneficial to antibiotic drug design considering the profound deleterious effects of E66A KsgA, where enzymatic function is abolished, and its presumed highly efficient manner of blocking translation initiation. This result contrasts dramatically with the results for catalytically inactive Dim1p, where no phenotype is observed (Lafontaine et al., 1998). Thus, KsgA may indeed be a novel antimicrobial drug target.
Strains
JW0050-3 (ΔksgA) and BW25113 (parental) strains were obtained from the E. coli Genetic Resource Center, Yale University (Baba et al., 2006). Another strain ΔksgA-K12 was a kind gift from Greg Phillips (Iowa State University), along with its parental counterpart (W3110).
Cloning and overexpression of KsgA
ksgA was PCR amplified from a plasmid (O'Farrell et al., 2004) using primers 5′ ATGAATAATCGAGTCACCAGGGC 3′ and 5′ ACTCTCCTGCAAAGGCGCGTTCTCC 3′. The PCR product was cloned into pBAD-TOPO Expression Kit (Invitrogen) according to manufacturer's protocol. Correct sequence was confirmed using pBAD sequencing primer by GENEWIZ (South Plainfield, NJ). Strains were transformed via electroporation using a Micropulser™ Elecroporator (Biorad) according to manufacturer's protocol. Overexpression of all constructs was induced with final concentration 0.04% arabinose unless otherwise noted (see Figure 4CFigure 4). The construct carried a 6XHis tag for indirect identification of recombinant protein via western analysis with Penta·His Antibody (Qiagen).
Construction of E66A KsgA
E66A KsgA was produced by alanine substitution at position 66 using QuickChange® Mutatgenesis Kit (Stratagene). Primers 5′ CTG ACG GTC ATC GCA CTT GAC CGC GAT C 3′ (sense) and 5′ GAT CGC GGT CAA GTG CGA TGA CCG TCA G 3′ (antisense) were used according to manufacturer's protocol. Mutations were confirmed using pBAD sequencing primer by GENEWIZ.
Growth Conditions
Cells were grown in LB media and ampicillin (100μg/ml) at 37° C overnight (unless otherwise noted). Saturated culture was subcultured to an OD600 of 0.02 in LB media containing arabinose (0.04%) and ampicillin (100μg/ml) (unless otherwise noted). Cells were incubated with shaking (200 rpm) at 37° C (permissive), 25° C (low) and 20° C. Further growth conditions are described as needed below.
Dilution Plating Experiments
Overnight cultures diluted in tenfold increments were spotted on either plain LB plates or LB plates containing ampicillin (100μg/ml) treated with 500 μl 1% Arabinose and allowed to dry. Plates were grown until the growth phenotype of the cells plated were apparent (~6 hours at 37° C up to ~ 36 hours at 20° C).
Sucrose Gradient Analysis of Ribosomes
Sucrose sedimentation profiles were essentially performed as described (Maki et al., 2002). Equal amounts of cleared lysate, as standardized by measurements of A254 were loaded onto a 10-40% sucrose gradient in sucrose gradient buffer [20mM Tris-HCl (pH7.8), 10 mM MgCl2, 100 mM NH4Cl] and spun in an SW41 rotor (25,000 rpm) for 17 hrs at 4° C. The speed and time were optimized to enable resolution of 70S ribosome and ribosomal subunit peaks, therefore not allowing polysomes to be readily observed. Additionally, experiments to allow resolution of polysomes were performed identically except centrifugation was for 3 hrs at 39,000 rpm (data not shown). Gradients were analyzed using a Biocomp Piston Gradient Fractionator with a BIORAD Econo UV Monitor with a Full Scale of 1.0 (unless otherwise noted). Data was recorded using DataQ DI-158-UP data acquisition software. SSU and ribosome containing peak intensities were recorded to calculate the percentage of free SSUs. Ribosome containing peak intensity was corrected to represent only SSUs [30% of entire peak (data not shown)].
RNA Extraction
Cell lysate was cleared with a 5-minute centrifugation at 10,000 rpm in a tabletop centrifuge and incubated with 3 volumes RNA precipitation buffer (100 mM NaOAc, 30 μg/mL glycogen in Ethanol) with vigorous shaking for 5 minutes. This mixture was vortexed and incubated in dry ice/ethanol bath for 10 minutes then centrifuged for 10 minutes at 4°C. Ethanol was removed and pellet resuspended in 200 μl RNA extraction buffer (0.5% SDS, 2.5 mM EDTA, 100 mM NaOAc). Phenol extraction was performed three times with equal volume phenol followed by two chloroform extractions using equal volume chloroform. RNA was recovered by ethanol precipitation using 600μl cold ethanol. The mixture was incubated in dry ice/ethanol bath for 10 minutes and spun at 13,000 rpm for 10 minutes. Supernant was removed and the pellet was washed with 500μl 70% ethanol and allowed to dry before being resuspended in 50μl H2O. In addition, 16S rRNA was specifically isolated by collecting 30S peaks in sucrose sedimentation profiles of cleared lysate using this protocol.
RNA Agarose Gel Electrophoresis
Agarose gel electrophoresis analysis was performed using total RNA extracted from cell cultures. 10 μg total RNA was loaded on a 2% agarose gel containing formaldehyde as described previously (Sambrook J., 1989). Band intensity was measured using Quantity One® software (Bio-Rad). Quantification of rRNA species in each lane was calculated by normalizing to 23S rRNA and subtracting background signal. These band intensities were than calculated to show the percentage 17S rRNA among total 16S and 17S rRNA species.
Western Blot Analysis of Sucrose Gradient Fractions and Recombinant Protein Expression
Sucrose gradient fractions from the entire profile were collected and contents of those fractions were precipitated with two volumes RNA precipitation buffer (100 mM NaOAc, 30 μg/mL glycogen in Ethanol). This mixture was vortexed and incubated in dry ice/ethanol bath for 10 minutes, centrifuged for 10 minutes at 4°C before ethanol was removed and pellet allowed to dry. Pellets were resuspended in 200 μl TBS buffer. 100 μl of sample was loaded on Slot Blot apparatus to transfer to Trans-blot® nitrocellulose membrane (Bio-RAD) according to manufacturer's protocol. Membrane was probed with Penta·His Antibody (Qiagen) according to manufacturer's protocol. Following incubation with a secondary (Goat anti-mouse) antibody with a HRP conjugate (Stressgene), blot was incubated with Western Lighting™ Chemiluminescence Reagent (Perkin Elmer) and exposed on BioMax film (Kodak). The blot was then incubated in stripping buffer (2% SDS, 62mM Tris (pH 6.8), 100 mM β-mercaptoethanol) at 50° C for 1 hour. The above protocol was repeated with a primary anti-body recognizing small ribosomal protein S3.
Primer Extension
Primer extension was performed on 16S rRNA samples as indicated in Figure 3Figure 3 as previously described (Moazed et al., 1986) using a primer annealing to the 3′ end of 16S rRNA initiating cDNA synthesis at position 1542.
Acknowledgments
We would like to thank Dr. Greg Phillips for the kind gift of bacterial strains and Dr. Heather O'Farrell for constructs used in these studies and comments on this work. We would also like to thank Dr. Scott Butler and Kevin Callahan for helpful technical advice regarding Northern blot experiments, and Rob Unckless and Ben Wilson for advice on quantification of sucrose gradient peaks. Finally we would like to thank members of the Culver lab for helpful discussions during these studies and preparation of this manuscript. This work was funded by NIH grants GM062432 (to GMC) and GM66900 (to JPR) as well as the T32 GM068411 NIH Training Grant in Cellular, Biochemical and Molecular Sciences.
References
  • Baba T, Ara T, Hasegawa M, Takai Y, Okumura Y, Baba M, Datsenko KA, Tomita M, Wanner BL, Mori H. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol. 2006;2:0008. 2006. [PubMed]
  • Brimacombe R. The structure of ribosomal RNA: a three-dimensional jigsaw puzzle. Eur J Biochem. 1995;230:365–383. [PubMed]
  • Bylund GO, Wipemo LC, Lundberg LA, Wikstrom PM. RimM and RbfA are essential for efficient processing of 16S rRNA in Escherichia coli. J Bacteriol. 1998;180:73–82. [PubMed]
  • Campbell TL, Brown ED. Genetic interaction screens with ordered overexpression and deletion clone sets implicate the Escherichia coli GTPase YjeQ in late ribosome biogenesis. J Bacteriol. 2008;190:2537–2545. [PubMed]
  • Cunningham PR, Richard RB, Weitzmann CJ, Nurse K, Ofengand J. The absence of modified nucleotides affects both in vitro assembly and in vitro function of the 30S ribosomal subunit of Escherichia coli. Biochimie. 1991;73:789–796. [PubMed]
  • Cunningham PR, Weitzmann CJ, Nurse K, Masurel R, Van Knippenberg PH, Ofengand J. Site-specific mutation of the conserved m6(2)A m6(2)A residues of E. coli 16S ribosomal RNA. Effects on ribosome function and activity of the ksgA methyltransferase. Biochim Biophys Acta. 1990;1050:18–26. [PubMed]
  • Dammel CS, Noller HF. A cold-sensitive mutation in 16S rRNA provides evidence for helical switching in ribosome assembly. Genes Dev. 1993;7:660–670. [PubMed]
  • Dammel CS, Noller HF. Suppression of a cold-sensitive mutation in 16S rRNA by overexpression of a novel ribosome-binding factor, RbfA. Genes Dev. 1995;9:626–637. [PubMed]
  • Das G, Thotala DK, Kapoor S, Karunanithi S, Thakur SS, Singh NS, Varshney U. Role of 16S ribosomal RNA methylations in translation initiation in Escherichia coli. EMBO J. 2008;27:840–851. [PubMed]
  • Guthrie C, Nashimoto H, Nomura M. Structure and function of E. coli ribosomes. 8. Cold-sensitive mutants defective in ribosome assembly. Proc Natl Acad Sci U S A. 1969;63:384–391. [PubMed]
  • Hayes F, Vasseur M. Processing of the 17-S Escherichia coli precursor RNA in the 27-S pre-ribosomal particle. Eur J Biochem. 1976;61:433–442. [PubMed]
  • Helser TL, Davies JE, Dahlberg JE. Mechanism of kasugamycin resistance in Escherichia coli. Nat New Biol. 1972;235:6–9. [PubMed]
  • Igarashi K, Kishida K, Kashiwagi K, Tatokoro I, Kakegawa T, Hirose S. Relationship between methylation of adenine near the 3′ end of 16-S ribosomal RNA and the activity of 30-S ribosomal subunits. Eur J Biochem. 1981;113:587–593. [PubMed]
  • Inoue K, Alsina J, Chen J, Inouye M. Suppression of defective ribosome assembly in a rbfA deletion mutant by overexpression of Era, an essential GTPase in Escherichia coli. Mol Microbiol. 2003;48:1005–1016. [PubMed]
  • Inoue K, Basu S, Inouye M. Dissection of 16S rRNA methyltransferase (KsgA) function in Escherichia coli. J Bacteriol. 2007
  • Inoue K, Chen J, Tan Q, Inouye M. Era and RbfA have overlapping function in ribosome biogenesis in Escherichia coli. J Mol Microbiol Biotechnol. 2006;11:41–52. [PubMed]
  • Kaczanowska M, Ryden-Aulin M. Ribosome biogenesis and the translation process in Escherichia coli. Microbiol Mol Biol Rev. 2007;71:477–494. [PubMed]
  • Klootwijk J, van den Bos RC, Planta RJ. Secondary methylation of yeast ribosomal RNA. FEBS Lett. 1972;27:102–106. [PubMed]
  • Lafontaine D, Delcour J, Glasser AL, Desgres J, Vandenhaute J. The DIM1 gene responsible for the conserved m6(2)Am6(2)A dimethylation in the 3′-terminal loop of 18 S rRNA is essential in yeast. J Mol Biol. 1994;241:492–497. [PubMed]
  • Lafontaine D, Vandenhaute J, Tollervey D. The 18S rRNA dimethylase Dim1p is required for pre-ribosomal RNA processing in yeast. Genes Dev. 1995;9:2470–2481. [PubMed]
  • Lafontaine DL, Preiss T, Tollervey D. Yeast 18S rRNA dimethylase Dim1p: a quality control mechanism in ribosome synthesis? Mol Cell Biol. 1998;18:2360–2370. [PubMed]
  • Li Z, Pandit S, Deutscher MP. RNase G (CafA protein) and RNase E are both required for the 5′ maturation of 16S ribosomal RNA. EMBO J. 1999;18:2878–2885. [PubMed]
  • Lu Q, Inouye M. The gene for 16S rRNA methyltransferase (ksgA) functions as a multicopy suppressor for a cold-sensitive mutant of era, an essential RAS-like GTP-binding protein in Escherichia coli. J Bacteriol. 1998;180:5243–5246. [PubMed]
  • Maki JA, Schnobrich DJ, Culver GM. The DnaK chaperone system facilitates 30S ribosomal subunit assembly. Mol Cell. 2002;10:129–138. [PubMed]
  • Mangiarotti G, Turco E, Ponzetto A, Altruda F. Precursor 16S RNA in active 30S ribosomes. Nature. 1974;247:147–148. [PubMed]
  • Moazed D, Van Stolk BJ, Douthwaite S, Noller HF. Interconversion of active and inactive 30 S ribosomal subunits is accompanied by a conformational change in the decoding region of 16 S rRNA. J Mol Biol. 1986;191:483–493. [PubMed]
  • Nashimoto H, Held W, Kaltschmidt E, Nomura M. Structure and function of bacterial ribosomes. XII. Accumulation of 21 s particles by some cold-sensitive mutants of Escherichia coli. J Mol Biol. 1971;62:121–138. [PubMed]
  • Noon KR, Bruenger E, McCloskey JA. Posttranscriptional modifications in 16S and 23S rRNAs of the archaeal hyperthermophile Sulfolobus solfataricus. J Bacteriol. 1998;180:2883–2888. [PubMed]
  • O'Farrell HC, Scarsdale JN, Rife JP. Crystal structure of KsgA, a universally conserved rRNA adenine dimethyltransferase in Escherichia coli. J Mol Biol. 2004;339:337–353. [PubMed]
  • Ofengand J. Ribosomal RNA pseudouridines and pseudouridine synthases. FEBS Lett. 2002;514:17–25. [PubMed]
  • Pease AJ, Roa BR, Luo W, Winkler ME. Positive growth rate-dependent regulation of the pdxA, ksgA, and pdxB genes of Escherichia coli K-12. J Bacteriol. 2002;184:1359–1369. [PubMed]
  • Poldermans B, Goosen N, Van Knippenberg PH. Studies on the function of two adjacent N6,N6-dimethyladenosines near the 3′ end of 16 S ribosomal RNA of Escherichia coli. I. The effect of kasugamycin on initiation of protein synthesis. J Biol Chem. 1979a;254:9085–9089. [PubMed]
  • Poldermans B, Roza L, Van Knippenberg PH. Studies on the function of two adjacent N6,N6-dimethyladenosines near the 3′ end of 16 S ribosomal RNA of Escherichia coli. III. Purification and properties of the methylating enzyme and methylase-30 S interactions. J Biol Chem. 1979b;254:9094–9100. [PubMed]
  • Poldermans B, Van Buul CP, Van Knippenberg PH. Studies on the function of two adjacent N6,N6-dimethyladenosines near the 3′ end of 16 S ribosomal RNA of Escherichia coli. II. The effect of the absence of the methyl groups on initiation of protein biosynthesis. J Biol Chem. 1979c;254:9090–9093. [PubMed]
  • Roa BB, Connolly DM, Winkler ME. Overlap between pdxA and ksgA in the complex pdxA-ksgA-apaG-apaH operon of Escherichia coli K-12. J Bacteriol. 1989;171:4767–4777. [PubMed]
  • Ryden-Aulin M, Shaoping Z, Kylsten P, Isaksson LA. Ribosome activity and modification of 16S RNA are influenced by deletion of ribosomal protein S20. Mol Microbiol. 1993;7:983–992. [PubMed]
  • Sambrook J, EF F, Maniatis T. Molecular Cloning: A Laboratory Manual. second. Cold Spring Harbor Laboratory Press; 1989.
  • Sparling PF. Kasugamycin resistance: 30S ribosomal mutation with an unusual location on the Escherichia coli chromosome. Science. 1970;167:56–58. [PubMed]
  • Srivastava AK, Schlessinger D. Mechanism and regulation of bacterial ribosomal RNA processing. Annu Rev Microbiol. 1990;44:105–129. [PubMed]
  • Steege DA, Graves MC, Spremulli LL. Euglena gracilis chloroplast small subunit rRNA. Sequence and base pairing potential of the 3′ terminus, cleavage by colicin E3. J Biol Chem. 1982;257:10430–10439. [PubMed]
  • Thammana P, Held WA. Methylation of 16S RNA during ribosome assembly in vitro. Nature. 1974;251:682–686. [PubMed]
  • Van Buul CP, Hamersma M, Visser W, Van Knippenberg PH. Partial methylation of two adjacent adenosines in ribosomes from Euglena gracilis chloroplasts suggests evolutionary loss of an intermediate stage in the methyl-transfer reaction. Nucleic Acids Res. 1984;12:9205–9208. [PubMed]
  • van Buul CP, Visser W, van Knippenberg PH. Increased translational fidelity caused by the antibiotic kasugamycin and ribosomal ambiguity in mutants harbouring the ksgA gene. FEBS Lett. 1984;177:119–124. [PubMed]
  • van Gemen B, Twisk J, van Knippenberg PH. Autogenous regulation of the Escherichia coli ksgA gene at the level of translation. J Bacteriol. 1989;171:4002–4008. [PubMed]
  • Van Knippenberg PH, Van Kimmenade JM, Heus HA. Phylogeny of the conserved 3′ terminal structure of the RNA of small ribosomal subunits. Nucleic Acids Res. 1984;12:2595–2604. [PubMed]
  • Xu Z, O'Farrell HC, Rife JP, Culver GM. A conserved rRNA methyltransferase regulates ribosome biogenesis. Nat Struct Mol Biol. 2008;15:534–536. [PubMed]

PubMed articles by these authors
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph