• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of jvirolPermissionsJournals.ASM.orgJournalJV ArticleJournal InfoAuthorsReviewers
J Virol. Aug 2009; 83(15): 7457–7466.
Published online May 20, 2009. doi:  10.1128/JVI.00285-09
PMCID: PMC2708609

Upstream Regulatory Region Alterations Found in Human Papillomavirus Type 16 (HPV-16) Isolates from Cervical Carcinomas Increase Transcription, ori Function, and HPV Immortalization Capacity in Culture[down-pointing small open triangle]

Abstract

Human papillomavirus (HPV) DNAs isolated from cervical and head and neck carcinomas frequently contain nucleotide sequence alterations in the viral upstream regulatory region (URR). Our study has addressed the role such sequence changes may play in the efficiency of establishing HPV persistence and altered keratinocyte growth. Genomic mapping of integrated HPV type 16 (HPV-16) genomes from 32 cervical cancers revealed that the viral E6 and E7 oncogenes, as well as the L1 region/URR, were intact in all of them. The URR sequences from integrated and unintegrated viral DNA were found to harbor distinct sets of nucleotide substitutions. A subset of the altered URRs increased the potential of HPV-16 to establish persistent, cell growth-altering viral-genome replication in the cell. This aggressive phenotype in culture was not solely due to increased viral early gene transcription, but also to augmented initial amplification of the viral genome. As revealed in a novel ori-dependent HPV-16 plasmid amplification assay, the altered motifs that led to increased viral transcription from the intact genome also greatly augmented HPV-16 ori function. The nucleotide sequence changes correlate with those previously described in the distinct geographical North American type 1 and Asian-American variants that are associated with more aggressive disease in epidemiologic studies and encompass, but are not limited to, alterations in previously characterized sites for the negative regulatory protein YY1. Our results thus provide evidence that nucleotide alterations in HPV regulatory sequences could serve as potential prognostic markers of HPV-associated carcinogenesis.

A subset of mucosal human papillomavirus (HPV) types is associated with most, if not all, carcinomas of the uterine cervix, many anogenital cancers, and ~25% of head and neck cancers (reviewed in reference 49). HPV type 16 (HPV-16) is the most common oncogenic or “high-risk” (HR) HPV type; HPV-16 is found in ~50% of cervical cancers and >90% of HPV-associated head and neck cancer lesions. The persistence of HPV-16, as well as of other HR HPV types, is governed by a tightly regulated expression of limiting levels of critical early viral gene products that support initial HPV plasmid amplification and subsequent immortalization of keratinocytes (16, 25).

HPV genomes isolated from cancers often contain nucleotide sequence alterations in the HPV upstream regulatory region (URR) that controls viral-gene transcription and contains the viral origin of replication (ori). Numerous variants of the prototypical HPV-16 URR sequence (17) have been described (1, 10, 36, 66, 67); similar sequence variation has been observed in other HR and low-risk HPV types (2, 8, 9, 26, 42, 45). Some of the nucleotide changes exhibit characteristic geographic distributions and have been grouped into evolutionary variants: the European (E), North American 1 (NA1), and Asian-American (AA) variants. It has been reported that non-European HR HPV variants are associated with more aggressive clinical outcomes in epidemiologic studies (6, 41, 48, 58, 61, 64, 65). Previous studies have demonstrated that some of the URR changes altered viral enhancer activity in assays using heterologous reporter constructs (15, 32, 47). Non-European HPV-16 variants have also been found to elicit increased viral early gene transcription and transient replication in culture (27). In spite of the depth of work done in examining HPV-16 DNA isolated from clinical lesions, a complete understanding of how the detected sequence variations influence critical steps in the establishment of HPV infection has remained elusive.

In this study, we examined a set of 32 HPV-16 isolates from cervical cancer biopsy specimens, comparing the sequences and activities of the cancer-derived URRs to those of the wild-type (wt) HPV-16 prototype. We identified multiple single-nucleotide substitutions, some, but not all, of which impinge upon previously characterized transcription factor binding sites in several URRs. We introduced these modified URR sequences into a replicating wt HPV-16 genome to characterize their influence on the biology of the virus. In comparison to the prototypical wt HPV-16, the URR alterations led to increased E6/E7 transcription from the major early gene promoter, P97, and to augmented initial amplification of the reconstituted HPV-16 genomes. In further contrast to previous studies, we also characterized, for the first time, the influence of the URR sequence alterations on replisome activity at the viral ori and found that URR alterations can directly influence the viral ori function. Finally, we examined the capacities of the altered HPV-16 genomes to establish persistent infection in and to extend the life span of primary human keratinocytes, the natural host cells for HPV infection, in a quantitative colony-forming assay. URR sequence alterations that enhanced viral-genome amplification through increased transcription and ori-dependent replication were also found to increase HPV immortalization capacity.

MATERIALS AND METHODS

Plasmid constructs.

The prototypical HPV-16 wt P97 (nucleotides [nt] 6530 to +153) and URR cat reporters were synthesized by standard methods (12, 29) using the following PCR primers: nt 7445 (5′-CGCAGATCTAGCTTCAACCGAATTCG) and nt 153 (5′-GCGCAAGCTTGTGCATAACTGTGGTAACTT). PCR products were cleaved with BamHI and HindIII and inserted into a pUC 18 cat vector. The recombinant plasmid constructs were then isolated from two independently amplified bacterial colonies, and the sequences were compared to verify nucleotide substitutions within each URR sequence. Synthetic mutations in P97 cis elements were similarly cloned into the P97 cat parent via SphI/HindIII digestion. Mutations were recloned into the 7.9-kb HPV-16 W12E genome following digestion with Eco0109I and SphI. The HPV-16 W12E plasmid (GenBank accession no. AF125673) was a gift from Paul Lambert (20). The HPV-16 E1 precursor plasmid (a gift from the zur Hausen laboratory), which contains a frameshift mutation by a deletion at position 1087 in the 3′ portion of the E1 open reading frame (17), was excised with NcoI and BbsI and then cloned into the HPV-16 W12E plasmid. The HPV-16 W12 E1, E8, and DBD constructs were similarly cloned as described previously (38). All PCR-generated plasmids were verified by automated sequencing (University of Iowa DNA Core).

Clinical material, genomic mapping, cell transfections, and transcription assays.

Total DNA was phenol-chloroform extracted from cervical carcinoma biopsy specimens, and the physical status of the HPV DNA was determined by Southern blotting in the laboratories of Attila Lörincz and Sharon Wilczynski. DNA isolates were mapped by PCR, using the following primer sets, listed as forward (F) and reverse (R): L1/URR-F (GC[A/C]CAGGG[A/T]CATAA[C/T]AATGG) and L1/URR-R (GCGCAAGCTTGTGCATAACTGTGGTAACTT); E2-F (GCGCTCTGGGGGATCTAGAACCATGGAGACTCTTTGCCAACG) and E2-R (CCGCGGATCCGTTGTGGgATGCAGTATCAAGATTTG); E1-F (CCGCGGATCCAATAGTCTATATGGTCACGTAGGTC) and E1-R (gcgctctagaACCATGGCTGATCCTGCAGGTACCAATGGG); E6/E7-F (CGGTCTAGAATG TTTCAGGACCCACAGGAG) and E6/E7-R (GCCGGATCCTTATGGTTTCTGAGAACAGAT); and L2-F (GATAGTGAATGGCAACGTGAC) and L2-R (CGTCC[A/C]A[A/G][A/G]GGA [A/T]ACTGATC).

HeLa and HaCaT (a gift from N. Fusenig) cell lines were cultured, and chloramphenicol acetyltransferase (CAT) assays were performed as described previously (59). Prior to transfection, HPV-negative human squamous cell carcinoma (SCC13) cells (50) and primary human foreskin keratinocytes (HFK) were grown on irradiated J2 fibroblast feeder cells in E medium (37, 38) and stably transfected, clonal HPV+ HFK cultures were generated as described previously (28, 38). The clonal HPV-16 W12E cell line was a gift from Paul Lambert (30). For RNase protection assays, SCC13 cells were cotransfected with 5 μg of recircularized HPV-16 W12E constructs and a simian virus 40 plasmid control using Effectene (Qiagen, Valencia, CA). Total RNA was harvested 40 h posttransfection from transiently transfected SCC13 cultures or from clonal HPV+ HFK cell lines, using RNAqueous kits (Ambion Inc., Austin, TX), and a total of 10 μg per reaction was analyzed as described previously (59). Organotypic raft cultures were constructed by seeding 2.0 × 105 subconfluent HPV+ HFK cells onto collagen inserts (Biocoat; Becton Dickenson, Bedford, MA) suspended over irradiated J2 fibroblasts in E medium and then cultured for up to 4 weeks prior to being sectioned and hematoxylin and eosin stained.

Transient plasmid DNA amplification and keratinocyte immortalization assays.

Prior to transfection, HPV-16 DNAs were cleaved from pUC vector sequences with BamHI and religated at 5 μg/ml for 16 h. The ligated DNAs, reproducibly containing 30 to 50% of HPV sequences as single plasmid circles, were column purified (MaxiKit; Qiagen, Valencia, CA). For transient-replication assays, 3 μg religated HPV-16 DNA was transfected into SCC13 cells with Effectene (Qiagen, Valencia, CA) in the absence of J2 feeder cells. Total DNA was then isolated from the transfected cells (QIAamp DNA Blood Kit; Qiagen, Valencia, CA) 5 days posttransfection, and the DNA concentrations were determined as the optical density at 260 nm. A total of 4 μg of each DNA sample was digested with DpnI and linearized with BamHI and XbaI before Southern blotting. The digestion of DNA samples was confirmed by visualization of ethidium bromide-stained agarose gels following electrophoresis. For colony formation assays, 2 × 106 low-passage (8 to 10 population doublings [PDs] postexplant) primary human keratinocytes per 100-mm dish were transfected with 2 μg of recircularized HPV DNA and 1 μg of pRSV-neo. Control cultures transfected with pCMV-βgal showed reproducible transfection efficiencies of 15 to 25%. The cells were transferred at various dilutions onto an irradiated J2 fibroblast feeder 1 day later, selected in 100 to 200 μg G418/ml E medium for 5 days, and allowed to grow for another 15 to 20 days without selection. After colony numbers per transfection were determined, individual colonies were subcultured using cloning cylinders from dishes with <40 colonies. Total cellular DNA, as well as total RNA, was harvested from clonal cultures to assess the HPV DNA status and early gene transcription. Total DNA was digested with BglII (an HPV-16 “no-cutter”) or BamHI (an HPV-16 “single cutter”) before Southern blotting. Growth phenotypes, expressed as population doubling (PD) times in days, of clonal HPV-16+ HFK cultures were calculated from logarithmic growth rates determined from total cell counts spanning a defined period in culture (4 to 6 days).

Southern blotting and phylogenetic analysis.

A total of 5 μg of DpnI-resistant DNA from transiently transfected SCC13 cells, or 2 μg of HPV-immortalized HFK total DNA, was resolved on 1.0% agarose gels, depurinated in 0.25 M HCl, and blotted directly onto positively charged nylon membranes (Zeta-Probe; Bio-Rad, Hercules, CA) by alkaline transfer with 0.4 N NaOH. The blots were then hybridized at 65°C with probes (1.5 × 106 cpm/ml hybridization buffer) containing an equimolar cocktail of PCR-amplified segments of the HPV-16 genome (nt 6226 to 3873 and 4471 to 6000) and 32P labeled by random priming (HotPrime kit; GenHunter Corp., Nashville, TN) using [α-32P]dATP/dCTP. Replication-defective HPV-16 plasmids included as negative blot controls also served as DpnI digestion controls. DpnI-digested whole-cell DNAs from transfected SCC13 cultures were resolved on 1.0% agarose gels, depurinated in 0.25 M HCl, and blotted directly onto positively charged nylon membranes (Hybond-XL; Amersham Biosciences Corp., Piscataway, NJ) by alkaline transfer with 0.4 N NaOH. Aliquots of linearized HPV-16 DNA (1 to 30 pg) were included as quantitative Southern blotting controls and to normalize band intensities between multiple autoradiograms. Sequence alignments of URR sequences were performed with CLUSTAL X (1.82) software (39). A rooted dendrogram was constructed (data not shown) by comparing the URR (nt 7478 to 7842) sequences defined in this study with previously described HPV-16 URR sequences to determine their phylogenetic relationships to previously defined HPV-16 variants (67).

RESULTS

The E6/E7 genes, and the URRs that modulate their expression, are conserved in integrated HPV-16 DNAs from cervical carcinomas.

HPV-16 DNA isolated from a total of 32 cervical carcinoma biopsy specimens had previously been analyzed by Southern blotting (data not shown) to determine the physical status of the viral DNA. The genomic structures of those samples that contained only integrated HPV-16 DNA were determined by PCR amplification of the E1, E2, E6/E7, and L2 genes and the L1/URR segments using total cell DNA, as summarized in Fig. Fig.1.1. As noted in previous studies (13, 30, 54), disruptions of the E1, E2, and L2 genes were detected in the region upstream of E6 in some integrated HPV-16 genomes, consistent with the disruption of a single circular HPV-16 genome (type I integration). In contrast, the E6/E7 genes and the L1/URR (nt 6584 to +153) were found to be intact in all samples tested. Similar genomic-disruption patterns have also been detected in HPV-18-positive cervical carcinoma samples (35). However, many samples showed amplification of all early genes, including 16 out of 22 that displayed intact E2 coding sequences. In spite of integration of the HPV genome, an equimolar ratio of E1 to E2, as determined by hybrid capture, was present (data not shown); this result is consistent with a type 2 viral-integration pattern—a head-to-tail tandem arrangement of multiple copies of the viral genome (30). All URR segments were sequenced before their effects on viral functions were examined.

FIG. 1.
Structural mapping of integrated HPV-16 isolates. (A) Genomic organization of the HPV-16 plasmid. (B) The physical status of HPV DNA detected in clinical samples is represented as integrated (I), extrachromosomal (E), or a mixture of integrated and extrachromosomal ...

Some HPV-16 URRs isolated from cervical carcinomas exhibit increased P97 activity in vivo.

HPV-16 URR sequences derived from malignant cervical biopsy specimens were cloned into a CAT reporter, and their P97 promoter activities were monitored in transiently transfected HeLa cells, which do not support HPV replication and therefore allowed us to examine transcription driven by cellular factors in the absence of the potent HPV E2 trans-acting gene products (Fig. (Fig.2).2). Several of these P97 promoters (M46, W02, and M65) exhibited increased P97 activity (two- to fourfold) compared to the wt prototype (Fig. (Fig.2,2, clones d, e, and f), indicating that these HPV-16 URRs could have an increased capacity to alter keratinocyte growth via increased E6 and E7 expression. The observed increase in P97 promoter activity was comparable to that seen with HPV-16 promoter sequences cloned from the established SiHa and CaSki cervical carcinoma cell lines in parallel (Fig. (Fig.2,2, clones b and c). SiHa and CaSki cells harbor low-copy-number and tandem multicopy integrated HPV-16 genomes, respectively. In SiHa cells, the E2 region is disrupted, while CaSki cells contain multiple virus copies (a type 2 integration pattern). As in other HPV-positive carcinoma cell lines (19), the URR deletion (nt 7745 to 7792) within the SiHa promoter and the nucleotide substitutions found in the CaSki URR also encompass the previously defined binding site for yin yang 1 (YY1), a cellular factor that downregulates HPV transcription (43). Additional nucleotide substitutions outside of known transcription factor binding sites were also found to be common in URRs with increased P97 activity (Fig. (Fig.2,2, clones b to g).

FIG. 2.
HPV-16 promoters isolated from cervical carcinomas exhibit increased P97 promoter activity in vivo. URR segments (nt 7445 to +153) from HPV-16 DNAs isolated from malignant cervical cancer biopsy specimens were sequenced, and the 593-nt promoter ...

Some of the additional single-nucleotide substitutions within the URR sequences also potentially affect previously defined binding sites for YY1; these included the most frequently detected alteration, at nt 7520, which was shown to disrupt YY1 binding (53). Four such sequence alterations potentially affecting known YY1 motifs were introduced into the HPV-16 wt promoter construct to determine if they were sufficient to account for the observed increase in P97 promoter activities. While mutations of each individual upstream YY1 site had no effect on P97 activity (Fig. (Fig.2,2, clones ak to am), simultaneous mutations of all four upstream YY1 sites (Fig. (Fig.2,2, clone an), as noted in several of the URRs displaying an aberrant major early promoter phenotype, were sufficient to increase P97 activity. In agreement with a previous report (43), these results demonstrate that coordinated disruption of multiple YY1 sites can derepress the HPV-16 P97 promoter.

Sequence alterations in HPV-16 URRs isolated from cervical carcinomas correlate with increased P97 transcription from the intact HPV genome.

While the reporter assays provided a suitable method of screening URR sequences for changes in major early gene promoter activity, as in previous studies, these assays could not examine the effects of these sequence alterations on the life cycle of the virus. We therefore examined the roles of some of the nucleotide substitutions common to members of this subset of viral sequences in P97 transcription and initial HPV-16 plasmid amplification in the context of the intact viral genomes expressing biologically relevant levels of the full complement of viral gene products. We subcloned promoter segments displaying aberrant P97 transcription phenotypes into the transcription/replication-competent HPV-16 W12E genome and transfected these constructs into the HPV-negative squamous cell carcinoma cell line SCC13. The functional transcription, replication, and immortalization capacities of the HPV-16 W12E parent plasmid made it an effective baseline with which to compare the effects of detected nucleotide substitutions within the URR sequences. Furthermore, the W12E URR fragment varies by only a single nucleotide substitution from the HPV-16 prototype sequence, which exhibited no effect on early promoter activity (Fig. (Fig.2,2, clone aj). Consistent with the results from our promoter activity assays, steady-state P97 transcription from the intact HPV-16 genome was activated 2- to 3.5-fold in viral genomes containing altered promoter segments (M46, M65, and W02) compared to the wt control in duplicate RNase protection assays (Fig. (Fig.3A,3A, lanes 5 to 7 and 12 to 14). The YY1x4 mut genome, however, exhibited P97 transcription similar to that of the wt (Fig. (Fig.3A,3A, lanes 4 and 11). The P97 transcription level displayed by the replication-defective E1 plasmid (Fig. (Fig.3A,3A, lanes 9 and 16) was also similar to that of the wt plasmid, confirming that the transcription phenotypes observed in this assay were not replication dependent.

FIG. 3.
Single-nucleotide substitutions found in HPV-16 early promoters from cervical carcinomas upregulate transient P97 transcription and initial plasmid amplification. (A) The HPV-16 URR segments from cervical carcinomas were cloned into the HPV-16 W12 parent ...

Sequence alterations in HPV-16 P97 promoters isolated from cervical carcinomas are correlated with enhanced ori function and increased initial plasmid amplification.

We also examined the effects of these single-nucleotide substitutions on initial HPV plasmid amplification in transiently transfected SCC13 cells. Simultaneous mutation of four YY1 sites in the HPV-16 wt URR (Fig. (Fig.3B,3B, lane 2) resulted in a twofold increase in initial plasmid amplification as measured by Southern blotting. Nucleotide substitutions found in at least three of the URR sequences, M46, M65, and W02, displayed 4- to 10-fold-increased amplification compared to the wt (Fig. (Fig.3B,3B, lanes 3 to 5). In contrast, nucleotide substitutions found in the early promoter of the W14 isolate did not fall within YY1 sites potentially altered in the M46, W02, and M65 constructs and were associated with a twofold increase in P97 promoter activity (Fig. (Fig.2,2, clone g) and no measurable effect on plasmid amplification (data not shown). The deletion of nt 7793 to 7902, previously described as an HPV-16 URR displaying increased P97 promoter activity in CAT reporter constructs (43), showed P97 transcription levels comparable to wt levels in the context of the intact viral genome in RNase protection assays (Fig. (Fig.3A,3A, lanes 8 and 15) but did not exhibit increased transient replication activity (Fig. (Fig.3B,3B, lane 6). In fact, it amplified poorly in comparison to the HPV-16 wt plasmid; this negative effect was likely due to the collateral loss of E1 binding to the partially deleted HPV-16 origin of replication and loss of E1 expression from the recently described P14 promoter (38).

We observed in parallel studies (37, 38) that replication of distinct complementing species of full-length HPV-16 genomes could be examined in initial plasmid amplification assays. We adapted this novel methodology to examine the effects of URR sequence alterations on ori function in an origin competition assay (Fig. (Fig.4).4). In this assay, amplification of a replication-defective, HPV-16 wt ori genome that does not express E2 is rescued by cotransfection with a second HPV-16 genome that expresses the E2 gene product and harbors either a wt or altered URR. Since the termination linker inserted into the E2 DBD (E2 DBD) (Fig. (Fig.4,4, lane 1), introduces a novel XbaI site, digestion of total extracted DNA with both BamHI and XbaI results in discrete fragments generated from the two equimolar input genomes that can be resolved by electrophoresis and quantified by Southern blotting. These experiments revealed that when both input genomes contained wt URR sequences, they amplified to similar levels, as demonstrated by the comparable intensities of the 7.9-kb and 5.4-kb digestion products, yielding an ori ratio of 1:1 (Fig. (Fig.4,4, lane 2). When genomes with altered URRs were cotransfected with the wt ori plasmid, amplification of the altered ori-containing genomes was markedly increased while that of the genome with wt ori was not (Fig. (Fig.4,4, lanes 3 to 6). In contrast, as we reported previously (37), when expression of the HPV-16 E8^E2 gene product is disrupted in our complementation assays, replication of both wt ori plasmid species increased (Fig. (Fig.4,4, lane 9) due to the loss of this potent trans-acting replication and transcription repressor. Since the plasmid genome species used in this complementation assay together express the full complement of trans-acting viral products necessary and sufficient for HPV-16 amplification, we conclude that the increase in replication of the altered URR-harboring genomes over the wt ori genome is solely due to a cis-dependent increase in ori function.

FIG. 4.
URR alterations enhance ori function. An origin competition assay detected Dpn-I-resistant fragments by Southern blotting. Respective 7.9-kb and 5.4-kb fragments from BamHI/XbaI digestion were derived from equimolar quantities of the respective HPV-16 ...

Single-nucleotide substitutions found in HPV-16 URRs from cervical carcinomas are correlated with increased HPV-mediated immortalization of primary human keratinocytes.

Having demonstrated that the subtle nucleotide changes observed in these URR sequences can confer increased viral early gene expression and initial plasmid amplification in transient assays, we transfected primary HFK with these HPV-16 genomes to determine their capacity to form immortalized keratinocyte cultures harboring stably replicating HPV-16 plasmids.

In contrast to previous studies, we also quantified the abilities of these genomes to efficiently immortalize keratinocytes in a colony-forming assay. This test assesses the capacities of HPV-16 genomes to initially form individual colonies and the relative abilities of these clonal cultures to survive subsequent expansion. Cells containing the HPV-16 genomes M46, M65, and YY1x4 mut formed colonies three- to fivefold more efficiently than the HPV-16 W12 wt did (Fig. (Fig.5A);5A); this effect was correlated with the increased P97 promoter activities (Fig. (Fig.2)2) and plasmid amplification phenotypes (Fig. (Fig.3B3B and and4)4) observed with these constructs. The physical status of the HPV-16 DNA in each of the stably transfected mass cultures was assayed by Southern blotting and was found to be present predominantly as replicating extrachromosomal DNA. The replication-defective HPV-16 genome harbored the 7793-to-7902 deletion but formed no surviving colonies (Fig. (Fig.5A5A).

FIG. 5.
Single-nucleotide substitutions found in HPV-16 URRs from cervical carcinomas correlate with increased HPV immortalization of primary human keratinocytes. (A) Colony formation in stable HPV transfections of primary HFK. The gray bars represent the ratios ...

Individual colonies were subsequently isolated and expanded to yield clonal HPV+ HFK cell lines harboring integrated or persistently replicating extrachromosomal HPV genomes in individual clones stemming from independent virus-cell interactions. This approach allowed us to examine the cell growth phenotypes and viral copy numbers that would otherwise be masked in heterogeneous cell populations in mass cultures. In contrast to previous studies, these results indicated that these altered HPV-16 genomes can maintain a persistent copy number comparable to that of the wt (Fig. (Fig.5B5B and Table Table1)1) and can extend the life span of primary keratinocytes in culture.

TABLE 1.
Clonal HPV+ HFK cultures display altered growth phenotypesa

To determine if alterations in early gene expression in HPV-immortalized keratinocytes were correlated with increased immortalization efficiencies, we examined the steady-state levels of the E6/E7 transcripts from the P97 promoter in representative clonal cultures using RNase protection assays (Fig. (Fig.5C).5C). In clonal cultures harboring stably replicating HPV-16 genomes beyond 35 PDs, no consistent increase in E6/E7 expression could account for the increased immortalization efficiencies observed with the altered URR constructs (Fig. (Fig.5C,5C, lanes 1, 3, and 5). However, the significantly increased E6/E7 expression in the M65 clonal culture (Fig. (Fig.5C,5C, lane 7), for example, could potentially be correlated with the dramatic decrease in PD time observed in subsequent assays (Table (Table1).1). Integration of HPV genomes has been associated with increased E6/E7 expression (31); however, consistent with recent observations (23), the integration of wt or mutant constructs in these assays did not necessarily lead to increased P97 transcription (Fig. (Fig.5C,5C, lanes 2 and 4).

The majority of the clonal cultures contained stably replicating plasmids with a viral load (averaged from two to eight clones) ranging from 6 to 12 copies per cell (Table (Table1).1). Clonal cultures exhibited an increased growth rate (measured as a PD time, expressed in days) compared to the untransfected parental primary keratinocytes. These clonal cultures have persisted in culture and retained replicating viral plasmids beyond 35 PDs. Introduction of the HPV-16 wt plasmid decreased the PD time two- to threefold compared to that of the HPV-negative parental HFK isolates, indicating an increased capacity to alter the growth phenotype of the host cell (Table (Table11).

We also examined the abilities of a subset of these clonal HPV-16/HFK cultures to stratify in organotypic rafts by hematoxylin and eosin staining of raft sections (Fig. (Fig.6).6). Both the HPV-16 YY1x4/HFK and HPV-16 M65/HFK cultures generated stratified epithelia similar to HFK immortalized with the wt parent plasmid, resembling a partially dysplastic phenotype characterized by minimal basal thickening and nearly normal maturation (Fig. 6A to C). In contrast, rafts formed with the W12E cells (30) displayed a distinctly different phenotype, exhibiting pronounced parabasal cell atypia with loss of maturation (Fig. (Fig.6D6D).

FIG. 6.
HPV-16-immortalized keratinocytes display a dysplastic phenotype in organotypic rafts. (A to C) Clonal HPV-16-immortalized keratinocytes derived from stable transfection of the HPV-16 W12 “wt” plasmid (16) (A), the YY1x4 construct (B), ...

Taken together, these results demonstrate that some of the nucleotide changes found in the URRs from HPV-16-positive carcinomas can derepress early viral-gene expression, as well as directly stimulate the viral ori function. As a consequence, these alterations lead to increased plasmid amplification and more efficient establishment of persistent infection, with a concomitant extension of the cellular life span.

DISCUSSION

HPV DNAs isolated from cervical and head and neck carcinomas frequently contain nucleotide sequence alterations in the URR. Our study addressed the roles such sequence changes may play in critical early events in the efficiency of establishing HPV persistence and altered keratinocyte growth. We have found that a subset of altered URR sequences from a series of HPV-16-harboring carcinomas increased the potential of HPV-16 to amplify and establish persistent, cell growth-altering viral-genome replication up to fivefold. Somewhat surprisingly, this aggressive phenotype in culture was not solely due to increased viral transcription: we have demonstrated that the altered URR motifs associated with increased viral transcription also significantly augment HPV-16 ori replication. The nucleotide sequence changes associated with the more aggressive phenotype in culture correlate with those previously described in the distinct geographical NA1 and AA HPV-16 variants that are associated with more aggressive disease in epidemiologic studies. Our results thus provide experimental evidence that these sequence alterations could serve as potential prognostic markers of HPV-associated carcinogenesis.

HPVs have coevolved with their human hosts over millions of years and are relatively invariant in sequence in comparison to rapidly replicating and rapidly evolving viruses. Nevertheless, there are major intratypic HPV variants defined by geographic distribution that differ by nucleotide substitutions from the prototypical wt sequences. For HPV-16, the E variant is most common among European populations and their descendants, while the NA1 and AA variants are common in the Americas and Southeast Asia (10, 11, 57, 60, 61, 64, 65). The NA1 and AA variants have been found to be associated with increased viral persistence and more aggressive cervical disease in epidemiologic studies (61, 64-66). HPV-16 URR sequences obtained in this study share nucleotide substitutions characteristic of these variants; the majority are closest to the E variant. P97 promoter activities of the E variant-type URRs, both in reporter assay screens and in the context of the autoregulated whole HPV-16 genome, were comparable to that of the prototypical wt HPV-16 URR in this study. In contrast, those URR sequences that exhibited enhanced P97 promoter activity in both assays shared characteristic nucleotide substitutions with URRs of the NA or AA variants, similar to reporter assay results in a previous study (32).

HPV early gene expression initially depends on, and is modulated throughout the virus life cycle by, cellular transcription factors that interact with cognate cis sites in the HPV URR (12, 29, 63). Cellular transcription activators cooperatively trigger and maintain immediate-early viral transcription, as we recently demonstrated in the related bovine papillomavirus (24). In contrast, the cellular factor YY1, which can function as either a positive or a negative regulator of cellular- and viral-gene transcription (4, 21, 22, 55, 62), predominantly downmodulates HPV early gene expression. The major early gene promoters of HPV-16 (P97) (44), HPV-18 (P105) (5), and HPV-31 (P99) (33) are repressed by upstream YY1 binding in reporter assays. Furthermore, HPV-18 and HPV-16 DNAs from malignant clinical samples have been shown to harbor nucleotide alterations or deleted YY1 binding sites in the URR (43, 46, 52, 53, 56, 60) similar to those we detected among our activated URR sequences. Therefore, the modification of YY1 binding to specific sites, site combinations, or numbers is one critical determinant of the altered URRs' transcription levels and has an effect on the establishment of viral persistence and cell growth changes.

Additional host transcription factors are likely to contribute to the differential regulation of early gene transcription in the altered HPV-16 URR sequences. Nucleotide substitutions within the promoter-proximal Sp1 binding site (at nt +31) in isolates W12 and W05, which effectively abolished binding of this transcription activator in mobility shift assays (data not shown), resulted in decreased P97 promoter activities. This is in contrast to single-nucleotide substitutions described in HPV-16 and HPV-18 DNA isolates, which resulted in increased Sp1 binding in vitro (14, 51) and were correlated with enhanced promoter activity in vivo. Nucleotide substitutions in sequences outside of previously mapped transcription factor recognition sites may represent additional, as yet undefined cellular factor-binding motifs.

It is apparent that other alterations within the HPV genome may play important roles in its infectivity and carcinogenic potential. Sequence alterations outside of the URR within the coding regions of the early genes E6 (3, 40), E7 (34), E5 (7, 18), and E2 (57) may influence the disease outcome; these viral-protein coding sequences also are under diversifying selection (11). While we have not studied potential sequence changes outside the URR, our results nevertheless demonstrate that regulatory sequence modifications have a profound effect on the disease-inducing potential of HPV-16.

While a previous study demonstrated that defined HPV-16 variant reference genomes can display increased replication (27), it could not distinguish which viral functions were responsible for the altered replication phenotypes. Here, we utilized novel assays to dissect the mechanism underlying the enhanced replication phenotype (37, 38). In cotransfection assays, two wt ori HPV-16 genomes replicate at equimolar copy numbers. However, amplification of the altered ori-containing HPV-16 genome greatly exceeded that of the wt ori control in parallel, demonstrating that the ori function itself was augmented by the sequence alterations. While increased production of the viral replication factor E1 and/or E2 or of other viral early gene products can augment plasmid amplification in trans, our results demonstrate that the increased replication of the altered URR constructs derived from cervical carcinomas is primarily due to an increase in ori function in cis. This could be the result of enhanced recruitment of cellular replication factors due to their higher affinity for the altered motifs or to the abrogation of the binding of negative factors. In addition, the nucleotide changes could affect the ori structure, permitting more efficient replisome assembly and ori unwinding. The additional specific contributions of these sequence alterations to the expression of E1 and E2, as well as other viral factors critical to plasmid replication and early gene expression, will also need to be elucidated in future studies.

In summary, we have identified HPV-16 isolates from malignant cervical lesions that harbor multiple sequence alterations in critical cis control elements in the viral URR. Several of these altered URRs increased early viral transcription, viral ori function, and plasmid amplification and exhibited an enhanced capacity to establish viral persistence and to immortalize primary HFK. These features may be associated with an increased potential to establish persistent HPV infection as the precursor to HPV-associated malignancy. Our results suggest that the detection of such HPV sequence alterations could serve as a potential prognostic marker of HPV-associated carcinogenesis.

Acknowledgments

We thank K. Thorsten Jäkel and Greg Thomas for assistance with plasmid subcloning and Aloysius Klingelhutz and Alice Fulton for critical reviews of the manuscript.

L.P.T. and T.H.H. were supported by merit awards from the Department of Veterans Affairs.

Footnotes

[down-pointing small open triangle]Published ahead of print on 20 May 2009.

REFERENCES

1. Alencar, T. R., D. M. Cerqueira, M. R. da Cruz, P. S. Wyant, E. D. Ramalho, and C. R. Martins. 2007. New HPV-16 European and non-European variants in Central Brazil. Virus Genes 351-4. [PubMed]
2. Arias-Pulido, H., C. L. Peyton, N. Torrez-Martinez, D. N. Anderson, and C. M. Wheeler. 2005. Human papillomavirus type 18 variant lineages in United States populations characterized by sequence analysis of LCR-E6, E2, and L1 regions. Virology 33822-34. [PubMed]
3. Asadurian, Y., H. Kurilin, H. Lichtig, A. Jackman, P. Gonen, M. Tommasino, I. Zehbe, and L. Sherman. 2007. Activities of human papillomavirus 16 E6 natural variants in human keratinocytes. J. Med. Virol. 791751-1760. [PubMed]
4. Baritaki, S., S. Sifakis, S. Huerta-Yepez, I. K. Neonakis, G. Soufla, B. Bonavida, and D. A. Spandidos. 2007. Overexpression of VEGF and TGF-β1 mRNA in Pap smears correlates with progression of cervical intraepithelial neoplasia to cancer: implication of YY1 in cervical tumorigenesis and HPV infection. Int. J. Oncol. 3169-79. [PubMed]
5. Bauknecht, T., P. Angel, H. D. Royer, and H. zur Hausen. 1992. Identification of a negative regulatory domain in the human papillomavirus type 18 promoter: interaction with the transcriptional repressor YY1. EMBO J. 114607-4617. [PMC free article] [PubMed]
6. Berumen, J., R. M. Ordonez, E. Lazcano, J. Salmeron, S. C. Galvan, R. A. Estrada, E. Yunes, A. Garcia-Carranca, G. Gonzalez-Lira, and A. Madrigal-De La Campa. 2001. Asian-American variants of human papillomavirus 16 and risk for cervical cancer: a case-control study. J. Natl. Cancer Inst. 931325-1330. [PubMed]
7. Bible, J. M., C. Mant, J. M. Best, B. Kell, W. G. Starkey, K. Shanti Raju, P. Seed, C. Biswas, P. Muir, J. E. Banatvala, and J. Cason. 2000. Cervical lesions are associated with human papillomavirus type 16 intratypic variants that have high transcriptional activity and increased usage of common mammalian codons. J. Gen. Virol. 811517-1527. [PubMed]
8. Calleja-Macias, I. E., L. L. Villa, J. C. Prado, M. Kalantari, B. Allan, A. L. Williamson, L. P. Chung, R. J. Collins, R. E. Zuna, S. T. Dunn, T. Y. Chu, H. A. Cubie, K. Cuschieri, M. von Knebel-Doeberitz, C. R. Martins, G. I. Sanchez, F. X. Bosch, N. Munoz, and H. U. Bernard. 2005. Worldwide genomic diversity of the high-risk human papillomavirus types 31, 35, 52, and 58, four close relatives of human papillomavirus type 16. J. Virol. 7913630-13640. [PMC free article] [PubMed]
9. Cerqueira, D. M., T. Raiol, N. M. Veras, N. von Gal Milanezi, F. A. Amaral, M. de Macedo Brigido, and C. R. Martins. 2008. New variants of human papillomavirus type 18 identified in central Brazil. Virus Genes 37282-287. [PubMed]
10. Chan, S. Y., L. Ho, C. K. Ong, V. Chow, B. Drescher, M. Dürst, J. ter Meulen, L. Villa, J. Luande, H. N. Mgaya, and H. U. Bernard. 1992. Molecular variants of human papillomavirus type 16 from four continents suggest ancient pandemic spread of the virus and its coevolution with humankind. J. Virol. 662057-2066. [PMC free article] [PubMed]
11. Chen, Z., M. Terai, L. Fu, R. Herrero, R. DeSalle, and R. D. Burk. 2005. Diversifying selection in human papillomavirus type 16 lineages based on complete genome analyses. J. Virol. 797014-7023. [PMC free article] [PubMed]
12. Cripe, T. P., A. Alderborn, R. D. Anderson, S. Parkkinen, P. Bergman, T. H. Haugen, U. Pettersson, and L. P. Turek. 1990. Transcriptional activation of the human papillomavirus-16 P97 promoter by an 88-nucleotide enhancer containing distinct cell-dependent and AP-1-responsive modules. New Biol. 2450-463. [PubMed]
13. Cullen, A. P., R. Reid, M. Campion, and A. T. Lörincz. 1991. Analysis of the physical state of different human papillomavirus DNAs in intraepithelial and invasive cervical neoplasm. J. Virol. 65606-612. [PMC free article] [PubMed]
14. Dong, X. P., and H. Pfister. 1999. Overlapping YY1- and aberrant SP1-binding sites proximal to the early promoter of human papillomavirus type 16. J. Gen. Virol. 802097-2101. [PubMed]
15. Dong, X. P., F. Stubenrauch, E. Beyer-Finkler, and H. Pfister. 1994. Prevalence of deletions of YY1-binding sites in episomal HPV 16 DNA from cervical cancers. Int. J. Cancer 58803-808. [PubMed]
16. Doorbar, J. 2005. The papillomavirus life cycle. J. Clin. Virol. 32(Suppl.)7-15. [PubMed]
17. Dürst, M., L. Gissmann, H. Ikenberg, and H. zur Hausen. 1983. A papillomavirus DNA from a cervical carcinoma and its prevalence in cancer biopsy samples from different geographic regions. Proc. Natl. Acad. Sci. USA 803812-3815. [PMC free article] [PubMed]
18. Eriksson, A., J. R. Herron, T. Yamada, and C. M. Wheeler. 1999. Human papillomavirus type 16 variant lineages characterized by nucleotide sequence analysis of the E5 coding segment and the E2 hinge region. J. Gen. Virol. 80595-600. [PubMed]
19. Ferris, R. L., I. Martinez, N. Sirianni, J. Wang, A. Lopez-Albaitero, S. M. Gollin, J. T. Johnson, and S. Khan. 2005. Human papillomavirus-16 associated squamous cell carcinoma of the head and neck (SCCHN): a natural disease model provides insights into viral carcinogenesis. Eur. J. Cancer. 41807-815. [PubMed]
20. Flores, E. R., and P. F. Lambert. 1997. Evidence for a switch in the mode of human papillomavirus type 16 DNA replication during the viral life cycle. J. Virol. 717167-7179. [PMC free article] [PubMed]
21. Galvin, K. M., and Y. Shi. 1997. Multiple mechanisms of transcriptional repression by YY1. Mol. Cell. Biol. 173723-3732. [PMC free article] [PubMed]
22. Gordon, S., G. Akopyan, H. Garban, and B. Bonavida. 2005. Transcription factor YY1: structure, function, and therapeutic implications in cancer biology. Oncogene 251125-1142. [PubMed]
23. Hafner, N., C. Driesch, M. Gajda, L. Jansen, R. Kirchmayr, I. B. Runnebaum, and M. Durst. 2008. Integration of the HPV16 genome does not invariably result in high levels of viral oncogene transcripts. Oncogene 271610-1617. [PubMed]
24. Haugen, T. H., M. J. Lace, T. Ishiji, A. Sameshima, J. R. Anson, and L. P. Turek. Cellular factors are required to activate bovine papillomavirus-1 early gene transcription and to establish viral plasmid persistence but are not required for cellular transformation. Virology, in press. [PubMed]
25. Hebner, C. M., and L. A. Laimins. 2006. Human papillomaviruses: basic mechanisms of pathogenesis and oncogenicity. Rev. Med. Virol. 1683-97. [PubMed]
26. Heinzel, P. A., S. Y. Chan, L. Ho, M. O'Connor, P. Balaram, M. S. Campo, K. Fujinaga, N. Kiviat, J. Kuypers, H. Pfister, et al. 1995. Variation of human papillomavirus type 6 (HPV-6) and HPV-11 genomes sampled throughout the world. J. Clin. Microbiol. 331746-1754. [PMC free article] [PubMed]
27. Hubert, W. G. 2005. Variant upstream regulatory region sequences differentially regulate human papillomavirus type 16 DNA replication throughout the viral life cycle. J. Virol. 795914-5922. [PMC free article] [PubMed]
28. Hubert, W. G., T. Kanaya, and L. A. Laimins. 1999. DNA replication of human papillomavirus type 31 is modulated by elements of the upstream regulatory region that lie 5′ of the minimal origin. J. Virol. 731835-1845. [PMC free article] [PubMed]
29. Ishiji, T., M. J. Lace, S. Parkkinen, R. D. Anderson, T. H. Haugen, T. P. Cripe, J. H. Xiao, I. Davidson, P. Chambon, and L. P. Turek. 1992. Transcriptional enhancer factor (TEF)-1 and its cell-specific co-activator activate human papillomavirus-16 E6 and E7 oncogene transcription in human keratinocytes and cervical carcinoma cells. EMBO J. 112271-2281. [PMC free article] [PubMed]
30. Jeon, S., B. L. Allen-Hoffmann, and P. F. Lambert. 1995. Integration of human papillomavirus type 16 into the human genome correlates with a selective growth advantage of cells. J. Virol. 692989-2997. [PMC free article] [PubMed]
31. Jeon, S., and P. F. Lambert. 1995. Integration of human papillomavirus type 16 DNA into the human genome leads to increased stability of E6 and E7 mRNAs: implications for cervical carcinogenesis. Proc. Natl. Acad. Sci. USA 921654-1658. [PMC free article] [PubMed]
32. Kammer, C., U. Warthorst, N. Torrez-Martinez, C. M. Wheeler, and H. Pfister. 2000. Sequence analysis of the long control region of human papillomavirus type 16 variants and functional consequences for P97 promoter activity. J. Gen. Virol. 811975-1981. [PubMed]
33. Kanaya, T., S. Kyo, and L. A. Laimins. 1997. The 5′ region of the human papillomavirus type 31 upstream regulatory region acts as an enhancer which augments viral early expression through the action of YY1. Virology 237159-169. [PubMed]
34. Kim, Y. B., Y. S. Song, Y. T. Jeon, J. S. Park, S. J. Um, J. W. Kim, N. H. Park, S. B. Kang, and H. P. Lee. 2005. Sequence variation and the transcriptional activity of the upstream regulatory region in human papillomavirus 16 E7 variants in cervical cancer of Korean women. Oncol. Rep. 14459-464. [PubMed]
35. Kitagawa, K., H. Yoshikawa, T. Onda, T. Kawana, Y. Taketani, H. Yoshikura, and A. Iwamoto. 1996. Genomic organization of human papillomavirus type 18 in cervical cancer specimens. Jpn. J. Cancer Res. 87263-268. [PubMed]
36. Kurvinen, K., M. Yliskoski, S. Saarikoski, K. Syrjanen, and S. Syrjanen. 2000. Variants of the long control region of human papillomavirus type 16. Eur. J. Cancer 361402-1410. [PubMed]
37. Lace, M. J., J. R. Anson, G. S. Thomas, L. P. Turek, and T. H. Haugen. 2008. The E8-E2 gene product of human papillomavirus type 16 represses early transcription and replication but is dispensable for viral plasmid persistence in keratinocytes. J. Virol. 8210841-10853. [PMC free article] [PubMed]
38. Lace, M. J., J. R. Anson, L. P. Turek, and T. H. Haugen. 2008. Functional mapping of the human papillomavirus type 16 E1 cistron. J. Virol. 8210724-10734. [PMC free article] [PubMed]
39. Larkin, M. A., G. Blackshields, N. P. Brown, R. Chenna, P. A. McGettigan, H. McWilliam, F. Valentin, I. M. Wallace, A. Wilm, R. Lopez, J. D. Thompson, T. J. Gibson, and D. G. Higgins. 2007. Clustal W and Clustal X version 2.0. Bioinformatics 232947-2948. [PubMed]
40. Lichtig, H., M. Algrisi, L. E. Botzer, T. Abadi, Y. Verbitzky, A. Jackman, M. Tommasino, I. Zehbe, and L. Sherman. 2006. HPV16 E6 natural variants exhibit different activities in functional assays relevant to the carcinogenic potential of E6. Virology 350216-227. [PubMed]
41. Lizano, M., J. Berumen, M. C. Guido, L. Casas, and A. Garcia-Carranca. 1997. Association between human papillomavirus type 18 variants and histopathology of cervical cancer. J. Natl. Cancer Inst. 891227-1231. [PubMed]
42. Lizano, M., and A. Garcia-Carranca. 1997. Molecular variants of human papillomaviruses types 16, 18, and 45 in tumors of the uterine cervix in Mexico. Gac. Med. Mex. 133(Suppl. 1)43-48. (In Spanish.) [PubMed]
43. May, M., X. P. Dong, E. Beyer-Finkler, F. Stubenrauch, P. G. Fuchs, and H. Pfister. 1994. The E6/E7 promoter of extrachromosomal HPV16 DNA in cervical cancers escapes from cellular repression by mutation of target sequences for YY1. EMBO J. 131460-1466. [PMC free article] [PubMed]
44. O'Connor, M. J., S. H. Tan, C. H. Tan, and H. U. Bernard. 1996. YY1 represses human papillomavirus type 16 transcription by quenching AP-1 activity. J. Virol. 706529-6539. [PMC free article] [PubMed]
45. Ong, C. K., S. Y. Chan, M. S. Campo, K. Fujinaga, P. Mavromara-Nazos, V. Labropoulou, H. Pfister, S. K. Tay, J. ter Meulen, L. L. Villa, and H. U. Bernard. 1993. Evolution of human papillomavirus type 18: an ancient phylogenetic root in Africa and intratype diversity reflect coevolution with human ethnic groups. J. Virol. 676424-6431. [PMC free article] [PubMed]
46. Pande, S., N. Jain, B. K. Prusty, S. Bhambhani, S. Gupta, R. Sharma, S. Batra, and B. C. Das. 2008. Human papillomavirus type 16 variant analysis of E6, E7, and L1 genes and long control region in biopsy samples from cervical cancer patients in north India. J. Clin. Microbiol. 461060-1066. [PMC free article] [PubMed]
47. Park, J. S., E. S. Hwang, C. J. Lee, C. J. Kim, J. G. Rha, S. J. Kim, S. E. Namkoong, and S. J. Um. 1999. Mutational and functional analysis of HPV-16 URR derived from Korean cervical neoplasia. Gynecol. Oncol. 7423-29. [PubMed]
48. Pista, A., A. Oliveira, A. Barateiro, H. Costa, N. Verdasca, and M. T. Paixao. 2007. Molecular variants of human papillomavirus type 16 and 18 and risk for cervical neoplasia in Portugal. J. Med. Virol. 791889-1897. [PubMed]
49. Psyrri, A., and D. DiMaio. 2008. Human papillomavirus in cervical and head-and-neck cancer. Nat. Clin. Pract. Oncol. 524-31. [PubMed]
50. Rheinwald, J. G., and M. A. Beckett. 1981. Tumorigenic keratinocyte lines requiring anchorage and fibroblast support cultures from human squamous cell carcinomas. Cancer Res. 411657-1663. [PubMed]
51. Rose, B., G. Steger, X. P. Dong, C. Thompson, Y. Cossart, M. Tattersall, and H. Pfister. 1998. Point mutations in Sp1 motifs in the upstream regulatory region of human papillomavirus type 18 isolates from cervical cancers increase promoter activity. J. Gen. Virol. 791659-1663. [PubMed]
52. Rose, B. R., C. H. Thompson, J. Zhang, M. Stoeter, A. Stephen, H. Pfister, M. H. Tattersall, and Y. E. Cossart. 1997. Sequence variation in the upstream regulatory region of HPV 18 isolates from cervical cancers. Gynecol. Oncol. 66282-289. [PubMed]
53. Schmidt, M., W. Kedzia, and A. Gozdzicka-Jozefiak. 2001. Intratype HPV16 sequence variation within LCR of isolates from asymptomatic carriers and cervical cancers. J. Clin. Virol. 2365-77. [PubMed]
54. Schwarz, E., U. K. Freese, L. Gissmann, W. Mayer, B. Roggenbuck, A. Stremlau, and H. zur Hausen. 1985. Structure and transcription of human papillomavirus sequences in cervical carcinoma cells. Nature 314111-114. [PubMed]
55. Shi, Y., J. S. Lee, and K. M. Galvin. 1997. Everything you have ever wanted to know about Yin Yang 1. Biochim. Biophys. Acta 1332F49-F66. [PubMed]
56. Stephen, A. L., C. H. Thompson, M. H. Tattersall, Y. E. Cossart, and B. R. Rose. 2000. Analysis of mutations in the URR and E6/E7 oncogenes of HPV 16 cervical cancer isolates from central China. Int. J. Cancer 86695-701. [PubMed]
57. Swan, D. C., M. Rajeevan, G. Tortolero-Luna, M. Follen, R. A. Tucker, and E. R. Unger. 2005. Human papillomavirus type 16 E2 and E6/E7 variants. Gynecol. Oncol. 96695-700. [PubMed]
58. Tornesello, M. L., M. L. Duraturo, S. Losito, G. Botti, S. Pilotti, B. Stefanon, G. De Palo, A. Gallo, L. Buonaguro, and F. M. Buonaguro. 2008. Human papillomavirus genotypes and HPV16 variants in penile carcinoma. Int. J. Cancer 122132-137. [PubMed]
59. Ushikai, M., M. J. Lace, Y. Yamakawa, M. Kono, J. Anson, T. Ishiji, S. Parkkinen, N. Wicker, M. E. Valentine, I. Davidson, L. P. Turek, and T. H. Haugen. 1994. trans activation by the full-length E2 proteins of human papillomavirus type 16 and bovine papillomavirus type 1 in vitro and in vivo: cooperation with activation domains of cellular transcription factors. J. Virol. 686655-6666. [PMC free article] [PubMed]
60. Veress, G., M. Murvai, K. Szarka, A. Juhasz, J. Konya, and L. Gergely. 2001. Transcriptional activity of human papillomavirus type 16 variants having deletions in the long control region. Eur. J. Cancer. 371946-1952. [PubMed]
61. Villa, L. L., L. Sichero, P. Rahal, O. Caballero, A. Ferenczy, T. Rohan, and E. L. Franco. 2000. Molecular variants of human papillomavirus types 16 and 18 preferentially associated with cervical neoplasia. J. Gen. Virol. 812959-2968. [PubMed]
62. Weill, L., E. Shestakova, and E. Bonnefoy. 2003. Transcription factor YY1 binds to the murine beta interferon promoter and regulates its transcriptional capacity with a dual activator/repressor role. J. Virol. 772903-2914. [PMC free article] [PubMed]
63. Wooldridge, T. R., and L. A. Laimins. 2008. Regulation of human papillomavirus type 31 gene expression during the differentiation-dependent life cycle through histone modifications and transcription factor binding. Virology 374371-380. [PMC free article] [PubMed]
64. Xi, L. F., N. B. Kiviat, A. Hildesheim, D. A. Galloway, C. M. Wheeler, J. Ho, and L. A. Koutsky. 2006. Human papillomavirus type 16 and 18 variants: race-related distribution and persistence. J. Natl. Cancer Inst. 981045-1052. [PubMed]
65. Xi, L. F., L. A. Koutsky, A. Hildesheim, D. A. Galloway, C. M. Wheeler, R. L. Winer, J. Ho, and N. B. Kiviat. 2007. Risk for high-grade cervical intraepithelial neoplasia associated with variants of human papillomavirus types 16 and 18. Cancer Epidemiol. Biomarkers Prev. 164-10. [PubMed]
66. Yamada, T., M. M. Manos, J. Peto, C. E. Greer, N. Munoz, F. X. Bosch, and C. M. Wheeler. 1997. Human papillomavirus type 16 sequence variation in cervical cancers: a worldwide perspective. J. Virol. 712463-2472. [PMC free article] [PubMed]
67. Yamada, T., C. M. Wheeler, A. L. Halpern, A. C. Stewart, A. Hildesheim, and S. A. Jenison. 1995. Human papillomavirus type 16 variant lineages in United States populations characterized by nucleotide sequence analysis of the E6, L2, and L1 coding segments. J. Virol. 697743-7753. [PMC free article] [PubMed]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...