• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
Dev Biol. Author manuscript; available in PMC May 1, 2010.
Published in final edited form as:
PMCID: PMC2706370
NIHMSID: NIHMS114332

Expression profiling of zebrafish sox9 mutants reveals that Sox9 is required for retinal differentiation

Abstract

The transcription factor gene Sox9 plays various roles in development, including differentiation of the skeleton, gonads, glia, and heart. Other functions of Sox9 remain enigmatic. Because Sox9 protein regulates expression of target genes, the identification of Sox9 targets should facilitate an understanding of the mechanisms of Sox9 action. To help identify Sox9 targets, we used microarray expression profiling to compare wild-type embryos to mutant embryos lacking activity for both sox9a and sox9b, the zebrafish co-orthologs of Sox9. Candidate genes were further evaluated by whole mount in situ hybridization in wild-type and sox9 single and double mutant embryos. Results identified genes expressed in cartilage (col2a1a and col11a2), retina (calb2a, calb2b, crx, neurod, rs1, sox4a and vsx1) and pectoral fin bud (klf2b and EST AI722369) as candidate targets for Sox9. Cartilage is a well-characterized Sox9 target, which validates this strategy, whereas retina represents a novel Sox9 function. Analysis of mutant phenotypes confirmed that Sox9 helps regulate the number of Müller glia and photoreceptor cells and helps organize the neural retina. These roles in eye development were previously unrecognized and reinforce the multiple functions that Sox9 plays in vertebrate development.

Keywords: Col11a2, Calb2, transcription factor, evolution of gene function, microarray, Müller glia, photoreceptor

Introduction

Haploinsufficiency for SOX9 results in the human disease campomelic dysplasia (CD), a syndrome characterized by skeletal abnormalities and male-to-female sex reversal (Foster et al., 1994; Wagner et al., 1994). This clinical phenotype shows that Sox9 function is important for skeletal development and male sex differentiation, and these processes have been foci of Sox9 research (Bi et al., 1999; Marshall and Harley, 2000; Vidal et al., 2001). CD patients show various other clinical features, including micrognathia, cleft palate, hypoplastic lungs, defects in olfactory tissues, and heart and renal malformations (Houston et al., 1983). Most patients die in early infancy because of respiratory problems, and some survivors show hearing loss and myopia (Mansour et al., 2002). These descriptions identify various essential functions of SOX9, for example, in neural crest cells (NCC), heart, lung, ear, and other tissues. Intensive analyses of Sox9 using conditional knockout mice and other model organisms have also assigned functions to Sox9, including the differentiation of neural crest cells (Spokony et al., 2002; Mori-Akiyama et al., 2003; Saint-Germain et al., 2004; Cheung et al., 2005; Sakai et al., 2006), glial cells in the spinal cord (Stolt et al., 2003), paneth cells in the intestine (Bastide et al., 2007; Mori-Akiyama et al., 2007), notochord (Barrionuevo et al., 2006), heart valves (Akiyama et al., 2004; Lincoln et al., 2007), pancreas (Seymour et al., 2007), otic vesicle (Barrionuevo et al., 2008) and gonad (Chaboissier et al., 2004). Sox9 is now recognized as a multi-functional gene that plays essential roles in various tissues during vertebrate development.

Sox9 encodes a transcription factor of the Sry-related HMG box (Sox) family that binds to cis-regulatory DNA elements to control the transcription of down-stream target genes. Genes shown to be regulated by Sox9 include Col2a1 and Col11a2 in the skeleton and Amh/Mis in the gonad (Bell et al., 1997; Lefebvre et al., 1997; Ng et al., 1997; Bridgewater et al., 1998; De Santa Barbara et al., 1998; Arango et al., 1999; Bi et al., 1999). Recent microarray analysis using cultured human cells revealed that the calcium binding proteins S100A1 and S100B are transcriptional targets of SOX9 and its coactivators SOX5 and SOX6 (Saito et al., 2007). Given the multi-functionality of Sox9, however, most of its targets remain unidentified. Identification of Sox9 target genes will improve our understanding of the biological mechanisms by which Sox9 functions to regulate development.

Zebrafish has two copies of Sox9, called sox9a and sox9b (Chiang et al., 2001). These co-orthologs of mammalian Sox9 resulted from a whole genome duplication event that occurred after teleost lineage segregated from the tetrapod lineage and before the diversification of teleost fish (Amores et al., 1998; Postlethwait et al., 1998; Taylor et al., 2003; Jaillon et al., 2004). After the genome duplication event, duplicate gene copies often evolved in a paralog-specific manner involving, at least in part, subfunction partitioning (Force et al., 1999; Postlethwait et al., 2004). The expression patterns of sox9a and sox9b overlap in some regions and are gene-specific in other domains, and the sum of their expression patterns is similar to the mouse Sox9 expression pattern (Chiang et al., 2001; Cresko et al., 2003; Yan et al., 2005).

The zebrafish mutation jellyfish (jef), which disrupts sox9a, causes skeletal defects due to abnormal cartilage formation (Yan et al., 2002). The zebrafish sox9b deletion mutant shows reduction of cartilage, and the sox9a;sox9b double mutant shows more severe defects revealing synergistic, additive and redundant functions of the two zebrafish co-orthologs of Sox9 (Yan et al., 2005). The partitioning of Sox9 subfunctions between the two zebrafish co-orthologs facilitates the analysis of Sox9 functions that were difficult to analyze in mammals due to pleiotropy (Yan et al., 2005). In mouse, heterozygous mutants (Sox9+/-) showed skeletal abnormalities and cleft palate, and die perinatally because of haploinsufficiency, as do most human CD patients (Bi et al., 2001); thus, homozygous mutant mouse embryos are not available. Fortunately, tissue-specific conditional knockout systems allow the investigation of Sox9 function in specific tissues (Kist et al., 2002; Chaboissier et al., 2004). But if Sox9 acts in a tissue that has not been examined by tissue-specific knockouts, we will not learn the full role of Sox9 in development. Making use of the zebrafish sox9a and sox9b mutants, whose heterozygotes are viable and fertile, we performed microarray analysis to compare the expression profile between homozygous mutant and wild-type embryos. Microarray is a powerful technique that enables us to conduct a genome wide screening of changes in gene expression between different biological groups, however at the same time, any detected changes in gene expression may be due to secondary effects, including indirect non-cell-autonomous effects.

We evaluated potential Sox9 targets identified by microarray by comparing the expression patterns of putative targets with the expression patterns of sox9a and sox9b. We also tested for reduced expression of putative targets in sox9 mutant embryos by in situ hybridization. Validated downstream candidate targets of sox9 included previously known targets such as collagen type II alpha-1a (col2a1a) and collagen type XI alpha-2 (col11a2) (Bell et al., 1997; Lefebvre et al., 1997; Ng et al., 1997; Bridgewater et al., 1998; Bi et al., 1999), and novel targets, including cone rod homeobox (crx), retinoschisis 1 (rs1), calbindin 2 (calb2) genes and other genes expressed in developing retina. The demonstration that sox9b mutant embryos have eye defects supports the role of sox9 candidate targets. Sox9 is expressed in the retina of developing mouse embryos (Ihanamäki et al., 2002), but its function in the vertebrate retina has not been characterized. Thus, microarray analysis using zebrafish mutants coupled to mutant phenotypes, uncovered a previously unidentified function of Sox9. We also present here the detailed analyses of eye defects observed in the sox9b mutants and show the importance of Sox9 in retinal differentiation.

Materials and methods

Zebrafish

Zebrafish were maintained under standard conditions (Westerfield, 2000) and embryos were staged as described (Kimmel et al., 1995). The sox9a mutation jeftw37, the sox9b deletion mutant b971, and the sox9atw37;sox9bb971 double mutant stock have been described previously (Piotrowski et al., 1996; Yan et al., 2002; Yan et al., 2005). Embryos were collected from matings of sox9a;sox9b double heterozygotes. At 2 days post fertilization (dpf), sox9b mutant embryos are distinguished from wild-type embryos by a curly tail phenotype, and sox9a;sox9b double mutant embryos are distinguished by lack of otic vesicles, while sox9a mutant embryos are morphologically indistinguishable from wild-type embryos until 3 dpf. All work with vertebrate animals was approved by the University of Oregon Institutional Animal Care and Use Committee.

We use nomenclature conventions suggested by ZFIN (http://zfin.org/zf_info/nomen.html): for example, SOX9 for the human gene, Sox9 for the mouse gene, sox9a and sox9b for the zebrafish genes, and Sox9 for the protein.

RNA extraction

Total RNA was extracted from embryos using TRI reagent (Molecular Research Center, Inc. Cincinnati, OH). RNA quantity was measured using NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmingon, DE). Approximately 1 μg of total RNA was extracted from individual embryos at 2 dpf.

Microarray analysis

Zebrafish DNA microarray containing 16,399 65-mer oligonucleotides representing 16,228 gene clusters and 171 control features was kindly provided by Steve Johnson and John Rawls (Rawls et al., 2004). Microarray information is available at the NCBI Gene Expression Omnibus database (GEO; http://www.ncbi.nlm.nih.gov/geo/), platform: GPL7556. The gene clusters arise from various developmental stages and organs, including maternal RNAs, shield, early gastrulation and segmentation stage, and various adult tissues and organs, including brain, heart, kidney, retina, ovary and testis.

For each experiment, 20 μg of total RNA from wild-type or mutant embryos was used to synthesize cDNA labeled with Cy3 or Cy5-dUTP (PerkinElmer, Boston, MA) using SuperScript III reverse transcriptase (Invitrogen, Carlsbad, CA). The Cy3 labeled cDNA was mixed with Cy5 labeled cDNA and purified with QIAquick PCR purification kit (Qiagen, Valencia, CA), dried in a speed vac (Savant, Farmingdale, NY) and resuspended in hybridization buffer (50% formamide, 5 × SSC, 1% SDS, 1 mg/ml calf thymus DNA). After denaturing, labeled cDNA was applied onto the microarray and covered with a coverslip, incubated in a hybridization chamber (Corning, Acton, MA), and hybridized in a 42°C water bath overnight. Following the hybridization, the microarray was washed with an SSC series and dried by centrifugation. The microarray was immediately scanned using Genepix 4000B scanner (Axon Instruments, Molecular Devices, Sunnyvale, CA). Three sets of experiments with dye-swap, in total six hybridizations, were conducted using independently isolated RNA samples from three different sets of animals as biological replicates. Each microarray was scanned with two or three different laser intensities, depending on the variation in signal intensities, to recover data of wider range of gene expression. Raw data were submitted to the GEO (Gene Expression Omnibus) database under accession number: GSE13482.

GenePix Pro 3.0 image analysis software (Axon Instruments) was used to measure fluorescence signal intensities of the array elements. Ratios were normalized to the overall difference in signal intensities from each channel. Microarray data were transferred to Microsoft Excel, which was also used for calculations and data sorting. The “Median of Ratios” (MR, the median of Cy3 and Cy5 ratios taken across the array element) was used for the analyses. Each microarray has two or three scan results (MRs) obtained with different laser intensities, from which the “Median of the MR” (MeMR) and the “Maximum of the MR” (MaMR) were calculated (Supplementary Table S1-3). Data from each hybridization were merged and sorted according to the Median of the MeMR (Supplementary Table S4). The probability of rejecting the hypothesis that gene expression was not changed between wild-type and mutant (log2 = 0) was calculated by two tailed Student's t-test (Supplementary Table S4). Candidate genes were picked from the list of the summary result of the microarray. The results from each single experiment (MeMR and MaMR) and scanned images were also considered. Genes that showed inconsistent results in the dye-swap experiment were removed from further analyses.

Cloning of candidate genes and whole-mount in situ hybridization

Candidate genes were cloned by RT-PCR, except for klf2b, which was kindly provided by Bruce Barut and Len Zon (Oates et al., 2001), and calb2a and calb2b, which were obtained from the I.M.A.G.E. Consortium EST collection (http://image.llnl.gov/). PCR primers were designed based on previous descriptions or genome information from the Ensembl database (http://www.ensembl.org/Danio_rerio/index.html) (Flicek et al., 2008).

PCR primers were: collagen 11a2_F; 5′-CGGACCACCTGGACCTCCAG and collagen 11a2_R; 5′-GCTCCACCTGAGGTGTGTTC, crx_F; 5′-TCCCGCTCCTGTCCGGTCTT and crx_R; 5′-CCTCTGTACGTGTTCAGTCA, crystallin alpha a_F; 5′-AGCCTCCTACTTGCGTTCAG and crystallin alpha a_R; 5′-GCCAGATATACACTGACACC, crystallin beta b1_F; 5′-CACCATGTCTCAGACCGCCA and crystallin beta b1_R; 5′-TTGAAGCATCCGCGCTGGTG, crystallin gamma m2c_F; 5′-CTCCAGCCATGCACGGAAAG and crystallin gamma m2c_R1; 5′-CTATGATACGCCTCATGCTCA, retinoschisis 1_F; 5′-GCAGGATCTGTGGCTTCAGA and retinoschisis 1_R; 5′-GTTGTCTCTCAGGTAAGCCA, sox4a_F; 5′-CAGTCGTCTAAACCTACCGC and sox4a_R; 5′-ACCTCTGGTGTGCAGTAGTC, syndecan 2_F; 5′-CTCCACGACAGACGACCTGT and syndecan 2_R; 5′-GGAGTTTGTCGTAGTCACTG, vsx1_F; 5′-GGAAGAGAAGAAGCTACAGAT, and vsx1_R; 5′-TCCTTGTACAGCACGTGCTC, unknown ESTs, AI585100_F; 5′-ACTTCAGAAGGTGCAGGAGA and AI585100_R; 5′-ACAGAACGGGTACTCCGAGG, AI722369_F; 5′-ATGACCATTATGGACAGTCT and AI722369_R; 5′_TGTCTCTCCATGAACCTCTG, AI942960_F; 5′-GGCAACCCTAACAGCACAGA and AI942960_R; 5′-GACATCACACCTGCACGGTT, AW777642_F; 5′-GTTGTACCTCAACGTTGTGG and AW777642_R; 5′-TCATGGCAGAATCTGTCAAC.

PCR products were cloned into pCR4-TOPO vector (Invitrogen). DIG-labeled RNA probe was synthesized with T3 or T7 RNA polymerase (Promega, Madison, WI). Whole-mount in situ hybridization was performed as described in (Yan et al., 2005).

Phylogenetic analysis

Amino acid sequences were aligned using CLUSTAL X (Thompson et al., 1997) and the alignment was further checked by eye using Seaview software (Galtier et al., 1996). A neighbor-joining (NJ) tree (Saitou and Nei, 1987) was plotted using NJplot (Perrière and Gouy, 1996).

Sectioning of the whole mount in situ samples and in situ hybridization on sections

Samples from whole mount in situ hybridization were embedded in paraffin and sectioned in the Histology Facility of the University of Oregon. In situ hybridization on cryosections were performed as described (Rodríguez-Marí et al., 2005).

Immunohistochemistry and confocal observation

Retinal Müller glial cells were labeled by anti-carbonic anhydrase antibody 1:200 (Jensen et al., 2001), the photoreceptor layer was labeling using zpr-3 antibody 1:200 from the Zebrafish International Resource Center (ZIRC) (Jensen et al., 2001), and amacrine cells were labeled by anti-GABA antibody 1:1000 (Sigma Cat# A2052) (Sandell et al., 1994). Nuclear layers of the retina were stained by the nuclear dye TO-PRO-3 iodide (Invitrogen, Cat#: 642/661). Fluorescent images were analyzed using Bio-Rad Radiance 2100MP confocal microscope system.

Results

Identification of Sox9 down-stream targets

To identify genes under control of Sox9 during vertebrate embryogenesis, we compared the gene expression profile of wild-type and sox9a;sox9b double mutant zebrafish embryos at 2 dpf using a zebrafish oligonucleotide microarray (Rawls et al., 2004). The 2 dpf time point is late enough so that double mutant embryos are morphologically distinguishable from wild-type and single mutant embryos, but early enough so that most secondary effects will not have yet taken place; nevertheless, some secondary downstream genes may also be detected because sox9 genes express as early as 1 dpf (Chiang et al., 2001). The microarray represents 16,228 gene clusters from EST collections of various embryonic stages and a variety of adult organs, including brain, eye, heart, kidney, liver, testis and ovary. To minimize erroneous expression results, three sets of experiments with dye-swap were conducted using independently isolated RNA samples. Data were analyzed and sorted with GenePix Pro software and Microsoft Excel, and candidates were picked according to the criteria described in Meterials and Methods. The raw data of each hybridization can be found in the GEO database (http://www.ncbi.nlm.nih.gov/geo/) under accession number: GSE13482. Because Sox9 is a transcription activator (Südbeck et al., 1996), we focused on genes that are down-regulated in mutant embryos.

The b971 mutant allele of sox9b used in this study deletes sox9b and some surrounding genes including sox8 (Yan et al., 2005). Because the morpholino knock down of sox9b phenocopies the sox9b971 defects, the phenotype observed in sox9b971 at this developmental stage is due solely to loss of sox9b function (Yan et al., 2005). The sox8 gene is not expressed at this time in development (Yan et al., 2005). The Ensembl zebrafish genome database (http://www.ensembl.org/Danio_rerio/index.html) (Flicek et al., 2008) was used to evaluate the genomic position of candidate genes. Although pvalb1 (parvalbumin 1) and pvalb4, pvalb8 consistently appeared as down-regulated genes, they are removed by the sox9b971 deletion (Supplementary Table S5), and so are excluded from the candidates.

To test whether candidates derived from the microarray analysis were valid, we utilized in situ hybridization in wild-type and mutant embryos to evaluate potential Sox9 targets. We cloned the following candidate genes: calbindin 2a (calb2a), calbindin 2b (calb2b), collagen type II alpha-1a (col2a1a), collagen type XI alpha-2 (col11a2), cone rod homeobox (crx), crystallin alpha A (cryaa), crystallin beta B1 (crybb1), crystallin gamma M2c (crygm2c), kruppel like factor 2b (klf2b), neurod, retinoschisis (X-linked, juvenile) 1 (rs1), sox4a, syndecan 2, visual system homeobox 1 (vsx1) and unknown ESTs, AI585100, AI722369, AI942960 and AW777642. The expression of candidate genes was compared among wild-type, sox9a mutant, sox9b mutant and sox9a;sox9b double mutant embryos at 2 dpf, the same stage used for the microarray analysis. We describe below genes identified in the microarray experiments whose expression change was verified in sox9 mutant embryos. Candidate genes could be categorized into two major groups: skeletogenesis and retinal development (Table 1).

Table 1
Candidate genes for down-stream targets of sox9a and sox9b in zebrafish

col11a2 expression is regulated by both zebrafish Sox9 co-orthologs

The collagen genes col2a1a and col11a2 showed 3.148 and 1.983 times higher expression in wild-type compared with double mutants, respectively, and dye-swap experiments confirmed results. Because their mouse orthologs are known as direct targets of Sox9 (Bell et al., 1997; Lefebvre et al., 1997; Ng et al., 1997; Bridgewater et al., 1998; Bi et al., 1999; Liu et al., 2000), and because col2a1a expression is known to be reduced in sox9 mutants (Yan et al., 2005), these results validate our experimental strategy. Here, we tested whether col11a2 is a target of sox9a and/or sox9b by analyzing the expression of col11a2 in wild-type and sox9 mutants.

In situ hybridization experiments showed that at 2 dpf, col11a2 was expressed in neurocranial cartilages (eg. ethmoid plate), pharyngeal cartilages (eg, mandibular cartilage), otic vesicle, and pectoral fin bud (Fig. 1A, E). In sox9a mutants, expression of col11a2 disappeared from the neurocranium and pharyngeal arches, and was reduced in the opercle (Fig. 1B, F). This expression pattern was consistent with the previously described sox9a mutant phenotype in which all neurocranial cartilage elements and most pharyngeal arch cartilages were missing from sox9a mutants; dermal bone elements, however, were present but small in sox9a mutant embryos (Piotrowski et al., 1996; Yan et al., 2002; Yan et al., 2005). The expression of col11a2 was also affected in sox9b mutants, but in a fashion different than in sox9a mutants: col11a2 expression was greatly reduced in the mandibular and ceratohyal cartilages in sox9b mutants, but was retained in the ethmoid plate and trabeculae of the neurocranium (Fig. 1C, G), consistent with the sox9b mutant phenotype (Yan et al., 2005). In sox9a;sox9b double mutants, expression of col11a2 disappeared in all neurocranial and pharyngeal cartilages. Because the otic vesicle is usually missing in double mutants (Yan et al., 2005), col11a2 expression in the otic vesicle vanished in sox9a;sox9b double mutant embryos. Expression of col11a2 in the pectoral fin bud was greatly reduced in the sox9a;sox9b double mutant (Fig. 1D, H).

Fig. 1
Differential regulation of col11a2 expression by sox9a and sox9b. (A-D) Lateral view and (E-H) ventral view of 2 dpf embryos. Expression of col11a2 appeared in neurocranium (ethmoid plate, arrowhead), pharyngeal arches (mandibular and ceratohyal, arrows), ...

Expression patterns of the two zebrafish sox9 genes can help explain the observed phenotypic differences between the sox9a and sox9b mutants: At 2 dpf, sox9a is expressed in the ethmoid plate, mandibular and ceratohyal (Fig. 1I), whereas sox9b is expressed in the mandibular and ceratohyal cartilages, but not in the ethmoid plate (Fig. 1J). These expression patterns are consistent with the col11a2 expression phenotype in the mutants: col11a2 expression in the neurocranium depends on sox9a function, but expression in the pharyngeal cartilages depends on both sox9a and sox9b. We conclude that both sox9a and sox9b regulate col11a2 in a tissue-specific fashion related to the sox9 genes' expression domains. Thus, the regulatory relationship between Sox9 and Col11a2 is conserved from teleost fish to mammals.

Regulation of retinal genes by Sox9

A group of genes expressed in the eye was down regulated in mutant embryos at 2 dpf. Because the size of the eye was reduced in sox9b and sox9a;sox9b double mutant embryos compared to wild-type and sox9a mutant embryos, we sought to test the hypothesis that sox9b is required for eye development.

crx

In situ hybridization experiments showed broad expression of crx throughout wild-type retinas at 2 dpf (Fig. 2A). The expression of crx was severely affected in retinas of sox9b mutants and sox9a;sox9b double mutant embryos (Fig. 2B, C), except for a small patch of cells in the ventral part of the retina (Fig. 2B, C). Crx is a member of the otd/Otx family of paired-like homeobox genes and is essential for retinal photoreceptor cell differentiation and maintenance in mouse (Furukawa et al., 1997; Furukawa et al., 1999). Zebrafish crx is expressed in the epiphysis and in proliferating retinal progenitors (Liu et al., 2001) and may function in the differentiation of photoreceptors and other cells of the retina (Shen and Raymond, 2004).

Fig. 2
Expression of candidate sox9 down-stream targets analyzed by in situ hybridization analysis in 2 dpf embryos, the same stage as used for microarray analysis. Anterior to the left. Lateral views of crx (A-C), rs1 (D-F) and vsx1 (G-I) show that they are ...

rs1

In wild-type embryos (Fig. 2D), rs1 was expressed strongly throughout the entire retina (Thisse and Thisse, 2004). In contrast, in sox9b mutants and double mutants (Fig. 2E, F), rs1 expression was retained only in the ventral part of the retina in the same domain as found previously for crx (Fig. 2E, F). Rs1 is a secreted protein with putative functions in cell adhesion and/or signaling (Wu et al., 2005; Molday et al., 2007). Mutations in the human RS1 gene cause X-linked retinoschisis (OMIM +312700), a disease involving intraretinal splitting due to degeneration (Sauer et al., 1997). Zebrafish rs1 was cloned in the Zebrafish Gene Collection Project (ZGC) (GeneBank acc.# BC076183), and the ZFIN database reported its expression pattern to include a few cells in branchial arches, epiphysis, and dorsal telencephalon in addition to the retina (Thisse and Thisse, 2004).

vsx1

Consistent with previous work (Passini et al., 1997; Passini et al., 1998), we found expression of vsx1 in the developing retina of wild-type embryos (Fig. 2G). In the retina of sox9b and sox9a;sox9b double mutant embryos, expression of vsx1 was down-regulated, with the dorsal and caudal portions of the eye most severely reduced (Fig. 2H, I). Vsx1 is a paired-like homeobox protein, first isolated from goldfish retina (Levine et al., 1997). Gene knockout analyses in mouse showed that Vsx1 is required for retinal cone bipolar cell differentiation (Chow et al., 2004; Ohtoshi et al., 2004).

neurod

Our in situ hybridization analyses (Fig. 2J) confirmed that neurod is expressed in both outer and inner nuclear layers of the retina and in the telencephalon in wild-type embryos (Korzh et al., 1998; Mueller and Wullimann, 2002; Rauch et al., 2003; Ochocinska and Hitchcock, 2007). Expression of neurod in the retina was severely reduced in sox9b and sox9a;sox9b double mutant embryos (Fig. 2K, L). Because the expression of neurod was normal in the telencephalon, we conclude that sox9b is important for neurod expression in the retina but not in other parts of the nervous system. NeuroD is a basic helix-loop-helix (bHLH) transcription factor that can convert epidermal cells into neurons (Lee et al., 1995) and activate insulin gene transcription (Naya et al., 1995; Chae et al., 2004).

sox4a

Our results confirmed expression of sox4a in the retina and developing brain of wild-type embryos (Fig. 2M)(Rauch et al., 2003; Thisse and Thisse, 2004), but showed that sox4a was not expressed in the retina of sox9b mutants and sox9a;sox9b double mutants; in contrast to the retina, expression of sox4a in the telencephalon and diencephalon was not affected in mutant animals (Fig. 2N, O). Sox4 is a Sox family transcription factor belonging to the SoxC group (Sox4, -11, and -12), while Sox8, -9, and -10 are in the SoxE group (Bowles et al., 2000). Sox4 is required for development of lymphocytes, heart and pancreas (Schilham et al., 1996; Ya et al., 1998; Wilson et al., 2005). Zebrafish has two co-orthologs of Sox4 called sox4a and sox4b, that appear to have evolved in a duplication event at the base of the teleost radiation (Mavropoulos et al., 2005). In zebrafish, sox4a is widely expressed in the central nervous system including telencephalon, diencephalon, midbrain, rhombomeres, and retina (Rauch et al., 2003; Thisse and Thisse, 2004).

These expression results show that the full retinal expression of crx, rs1, vsx1, neurod and sox4a depends on sox9b but not sox9a function. This conclusion is consistent with the expression pattern of zebrafish sox9a and sox9b: at 2 dpf, sox9b is expressed in the ciliary marginal zone of the retina (Fig. 2S, T) but sox9a is not (Fig. 2P, Q) (Chiang et al., 2001; Cresko et al., 2003; Yan et al., 2005).

Co-orthologs of Calb2 are down-regulated in the sox9b mutant retina

The calcium binding proteins calbindin 2a (calb2a, previously known as calb2 or calretinin) and its closely related paralog calbindin 2b (calb2b, previously known as calbindin 2-like) were down-regulated in sox9b and sox9a;sox9b double mutant embryos. These two genes have not previously been well characterized in zebrafish. Our phylogenetic analysis showed that Calb2a and Calb2b proteins branch as sisters of the tetrapod Calb2 clade with high bootstrap support (Fig. 3A).

Fig. 3
Candidate target genes calb2a and calb2b are co-orthologs of tetrapod Calb2 and their expression was lost in the sox9b mutant retina. (A) Phylogenetic analysis of Calbindin family proteins using the neighbor-joining method. Numbers on the branches are ...

To evaluate the evolutionary origin of the zebrafish calb2 genes, we analyzed conserved synteny around calb2a and calb2b using our orthology and conserved synteny database based on reciprocal best blast hit (RBH) analysis (Catchen et al., 2008). Red dots in Fig. 3B represent the chromosomal positions of zebrafish orthologs of a 20 Mb segment of human chromosome 16 (Hsa16) surrounding the CALB2 gene. Orthologous chromosome segments appear as clusters of red dots. This analysis showed that a chromosomal segment of zebrafish chromosome 7 (Dre7) around calb2a and a segment of Dre18 around calb2b correspond to duplicated copies of the region surrounding CALB2 in Hsa16 (Fig. 3B). These results show that calb2a and calb2b are co-orthologs of tetrapod Calb2 and likely arose in the genome duplication that preceded the teleost radiation (Amores et al., 1998; Postlethwait et al., 1998; Jaillon et al., 2004).

Our expression analysis showed that in wild-type embryos, calb2a was expressed in the retina and in neurons of the cranial ganglia and in rhombomeres of the hindbrain (Fig. 3C), confirming directly submitted data in ZFIN (Rauch et al., 2003; Thisse and Thisse, 2004). The expression of calb2b appeared in the ganglion cell layer of the retina, in the olfactory placode, tegmentum, midbrain-hindbrain boundary (MHB) and ventral hindbrain (Fig. 3F), which confirms data in ZFIN (Rauch et al., 2003; Thisse and Thisse, 2004). Both calb2 genes were expressed in developing retina, but their expression patterns differed: calb2a was expressed widely in the retina including the ganglion cell layer, but calb2b was expressed only in the ganglion cell layer of the retina (Fig. 3C, F). In other parts of the nervous system, calb2a was expressed in cranial ganglia and rhombomeres of the hindbrain, whereas calb2b was expressed in the olfactory placode, tegmentum, MHB and ventral hindbrain. In mouse, high-throughput gene expression analyses by RNA in situ hybridization showed that Calb2 is expressed in developing retina, olfactory bulb, tegmentum and hindbrain (Visel et al., 2004)(Gene Expression Data in MGI, Mouse Genome Informatics website: http://www.informatics.jax.org/). Although description of the Calb2 expression pattern in mouse is not detailed enough to know its cellular distribution within the retina, this domain appears to be ancient and conserved in mouse Calb2 and partitioned into zebrafish co-orthologs calb2a and calb2b.

Expression analysis in sox9 mutant embryos verified our microarray results. In sox9b mutants and in sox9a;sox9b double mutants, calb2a expression did not appear in the eye, although other calb2a expression domains, including the cranial ganglia and rhombomeres of the hindbrain, were not affected (Fig. 3D, E). Likewise, in sox9b mutant embryos and in sox9a;sox9b double mutant embryos, calb2b expression was missing from the retina, although other expression domains were not affected (Fig. 3G, H).

These results show that sox9b regulates expression of both calb2a and calb2b in the developing retina. As mentioned above, calb2a and calb2b are teleost fish co-orthologs of the tetrapod Calb2 gene. Although the expression patterns of calb2a and calb2b have diverged, expression of both genes in the retina depends on sox9b, suggesting that this relationship likely existed in the pre-duplication ancestral gene.

sox9b controls genes expressed in several retinal layers

As Figures 2 and and33 show, a number of genes expressed in the retina were down-regulated in sox9b mutants. To learn which specific retinal cell types are regulated by Sox9, we investigated detailed expression domains in tissue sections. In wild-type embryos, vsx1 was expressed in the outer part of the inner nuclear layer (Fig. 4A), but in sox9b mutants and in sox9a;sox9b double mutants, the expression domain was reduced dorsally (Fig. 4B, C). Expression of rs1 was observed in the outer part of the inner nuclear layer and the outer nuclear layer in the wild-type retina (Fig. 4D), while in mutant embryos, rs1 expression was reduced (Fig. 4E) or not detected (Fig. 4F). Expression of calb2a was observed in the inner nuclear layer (Fig. 4G) and calb2b was expressed in the ganglion cell layer (Fig. 4J). These expression domains were both severely reduced in mutant embryos with a small portion of ventral expression occasionally remaining (Fig. 4H, I, K, L). These results show that sox9b plays important roles in several different retinal cell layers, including the ganglion cell layer, inner nuclear layer and outer nuclear layer.

Fig. 4
Candidate genes were expressed in different layers in the developing retina. (A-C), vsx1; (D-F), rs1; (H-I), calb2a; (J-L), calb2b. Expression of vsx1 was observed in the outer part of the inner nuclear layer (A). Expression was reduced especially in ...

Retinal differentiation in zebrafish sox9 mutants in later development

Expression profiling of wild-type and sox9a;sox9b double mutants identified seven genes expressed in the developing retina as downstream of Sox9 and hence potentially early Sox9 targets. As shown previously, sox9b is expressed in the developing eye by 24 hpf (Chiang et al., 2001; Cresko et al., 2003; Yan et al., 2005), and continues to be expressed in the retina at 2 dpf (Fig. 2S, T), so it is reasonable to conclude that Sox9 functions in retinal differentiation by regulating down-stream target genes in the zebrafish embryo.

To learn how mutant phenotypes change after 2 dpf, we examined the expression of putative sox9 targets in 3 dpf embryos. At 3 dpf, calb2a was expressed in the ganglion cell layer and inner nuclear layer (Fig. 5Aa), and calb2b was expressed in the ganglion cell layer and in certain cells in the inner nuclear layer of wild-type embryos (Fig. 5Ba). The expression of neither calb2a nor calb2b was affected in sox9a mutants, but expression of both genes was reduced in the dorsal and ventral retina in sox9b mutants and in sox9a;sox9b double mutants (Fig. 5Ac, Ad, Bc, Bd). The outer and inner nuclear layers both expressed crx (Fig. 5Ca). In sox9b mutants and sox9a;sox9b double mutants, the same layers expressed crx, but expression was reduced in the most dorsal and most ventral expression domains (Fig. 5Cc, Cd). Expression of neurod was observed in the outer nuclear layer and in a few cells in the inner nuclear layer (Fig. 5Da), as previously reported (Ochocinska and Hitchcock, 2007). Expression of neurod was not affected in sox9a mutants (Fig. 5Db), but expression of neurod in the outer nuclear layer was less clear in sox9b and sox9a;sox9b double mutants, perhaps because retinal layers did not form properly in these mutants (Fig. 5Dc, Dd). The outer and inner nuclear layers both expresed rs1, except for the ciliary marginal zone (Fig. 5Ea). The expression was reduced only in the dorsal-most and ventral-most expression domains in sox9b mutants and in sox9a;sox9b double mutants (Fig. 5Ec, Ed). Expression of sox4a appeared in a proportion of inner nuclear layer cells and in some cells in the dorsal and ventral parts of the ganglion cell layer in wild types and sox9a mutants (Fig. 5Fa, Fb). In sox9b and double mutants, however, sox4a expression in the inner nuclear layer appeared to be a bit stronger than in the wild-type retina (Fig. 5Fc, Fd), suggesting an expansion of the sox4a+ cell type. Sections showed that vsx1 was expressed in the inner nuclear layer (Fig. 5Ga), but expression in the dorsal and ventral parts of the retina was reduced in sox9b and in sox9a;sox9b double mutants (Fig. 5Gc, Gd).

Fig. 5
Expression of candidate genes in retina at 3 dpf. In situ hybridization on histological sections with calb2a (Aa, wild-type; Ab, sox9a mutant; Ac, sox9b mutant; Ad, double mutant), calb2b (Ba-Bd), crx (Ca-Cd), neurod (Da-Dd), rs1 (Ea-Ed), sox4a (Fa-Fd), ...

Expression of col2a1a, a known target of Sox9 in cartilaginous tissue, appeared in the iris (Fig. 5Ha). In contrast to cartilaginous tissue, col2a1a expression in the iris was retained in sox9a mutants, sox9b mutants, and in sox9a;sox9b double mutant embryos (Fig. 5Hb, Hc, Hd). These results showed that the regulatory relationship of Sox9 → Col2a1 that is well established for cartilage does not hold for the iris.

Taken together, expression analysis on tissue sections suggest that sox9b, but not sox9a, is required for retinal development. The requirement for Sox9 is most evident around 2 dpf and becomes milder at 3 dpf in sox9b mutants and in sox9a;sox9b double mutants, suggesting that other gene(s) can partially compensate for the lack of sox9b function on the expression of the candidate genes at 3 dpf. Because candidate genes were expressed in the ciliary marginal zone and were sensitive to loss of sox9b function at 3 dpf, sox9b may function in cell proliferation and/or retinal layer organization.

Independent of the microarray analysis, we had noticed that sox9b mutants have smaller eyes than wild types. We investigated eye development in wild-types and in sox9a, sox9b and double mutants to elucidate the function of Sox9 in retinal differentiation in larval fish. By 5 dpf, most cell types in the retina have already differentiated (Fadool and Dowling, 2008). Antibody staining for specific cell layers revealed that cells expressing the Müller glial cell marker carbonic anhydrase (Fig. 6A, E, I, M) (Jensen et al., 2001) and the photoreceptor cell marker zpr-3 (Fig. 6B, F, J, N) (Jensen et al., 2001) are reduced in number and disorganized in the retinas of sox9b mutants and sox9a;sox9b double mutants (Fig. 6I, J, M, N). In contrast, sox9a mutant retinas had no obvious defects, even though sox9a is expressed in the inner nuclear layer at 68 hpf (Fig. 2R). These results on 5dpf animals show that sox9b is required for differentiation of the Müller glial cell layer and photoreceptor cell layer in zebrafish. Glial cells are required for proper migration of neurons, so the disorganized retina might be secondary due to a primary defect in Müller glial cells. Sox9 is involved in glial cell development in mouse spinal cord (Stolt et al., 2003), and here we showed that sox9b is required for retinal Müller glial cells. Although different glial types are involved, the role of Sox9 in glial cell development may be conserved between Müller glia and glia of the central nervous system.

Fig. 6
Fluorescent antibody staining of retinal cell types in wild-type and sox9 single and double mutant larvae. (A-P) 5 dpf and (Q-T) 4 dpf. Eye morphology in sox9a mutants was generally similar to that in wild-type siblings. In contrast, sox9b mutants and ...

Expression of klf2b and EST AI722369 in the pectoral fin bud disappeared in sox9 mutants

The microarray experiments showed that klf2b was down regulated 2.344 fold in double mutants. Expression of klf2b was observed in the central mesenchyme of the pectoral fin bud and in the adjacent cleithrum of the shoulder girdle (Fig. 7A, C), as previously described (Oates et al., 2001; Thisse et al., 2001). In double sox9 mutants, expression of klf2b in the fin bud disappeared but expression in the cleithrum was not affected (Fig. 7B, D). Consistent with these defects, sox9a and sox9b were expressed in the pectoral fin bud, but the cleithrum expressed neither sox9a nor sox9b (Yan et al., 2005). This result is consistent with the appendage defect observed in the sox9 mutant pectoral fin: only the cleithrum was retained while other fin structures were greatly reduced in sox9a;sox9b double mutants (Yan et al., 2005).

Fig. 7
Expression of candidate genes in the pectoral fin bud. (A, B) Lateral view and (C, D) dorsal view of klf2b expression. In wild-type embryos, klf2b was expressed in the mesenchyme of the pectoral fin bud and in the adjacent cleithrum (A, C). Expression ...

An EST of unknown function (AI722369) was 5.673 times down regulated in double mutant embryos. The AI722369 nucleotide sequence has more than 98% identity over about 500 nucleotides to sequences assigned to at least five different chromosomes in the Ensembl genome database, suggesting that related sequences are dispersed in the zebrafish genome. AI722369 is similar to the uncharacterized human hypothetical protein LOC100131068. Despite appearing to be a repeated element, AI722369 was expressed in a strongly specific manner in time and space: in the pectoral fin bud in two parallel domains in the position of presumptive pectoral fin muscle (Fig. 7E). Furthermore, AI722369 expression disappeared from sox9a;sox9b double mutants (Fig. 7F), suggesting that it is downstream of Sox9 activity. In the wild-type pectoral apparatus, sox9a is expressed strongly in the scapulocoracoid of the pectoral girldle but was weaker in the blade of the fin bud and did not appear in the cleithrum of the pectoral girdle. Reciprocally, sox9b is expressed strongly in the chondrogenic core of the fin bud but not in the scapulocoracoid or the cleithrum of the pectoral girdle (Yan et al., 2005) (Fig7G, H). In sox9a;sox9b double mutants, both the scapulocoracoid and the extension of the fin bud are missing or severely reduced (Yan et al., 2005). We conclude that the reduced expression of klf2b and AI722369 in mutant embryos arises from fin bud hypogenesis downstream of Sox9 and so these genes may not be direct targets of Sox9.

Discussion

Because Sox9 encodes a transcription factor that functions by regulating the transcription of down-stream target genes, the identification of targets is an appropriate way to understand the various roles of Sox9 in development. Although several downstream targets of Sox9 are known, many others remain to be identified. A genome-wide screening for the identification of targets provides a fruitful method for recognizing previously unknown targets, and hence for identifying unrecognized functions of Sox9. To implement this strategy, we compared the gene expression profile of wild-type and sox9-deficient mutant embryos using a microarray representing 16,228 gene clusters. Because Sox9 generally acts as a transcriptional activator (Südbeck et al., 1996), we focused on genes whose expression was down-regulated in mutant embryos. We identified several types of candidate target genes, including genes expressed in cartilage, retina, and pectoral fin bud. A comparison of sox9 expression patterns in the retina to the phenotypes of sox9 mutants and the expression patterns of candidate targets in wild-type and sox9 mutant embryos uncovered a previously unrecognized requirement for Sox9 in development of the retina.

Down-stream targets of Sox9

Microarray is a powerful tool to identify genes whose expression is different among experimental groups (Schena et al., 1995; Hoheisel, 2006). Expression differences between groups could arise due either to direct, primary effects, or to subsequent, secondary effects. A direct target of Sox9 should be co-expressed with sox9 in space. A secondary target would be turned on in response to a primary target in a regulatory cascade, and so might be first expressed well after sox9 or be expressed in cells that do not express sox9. To confirm microarray results, we compared the expression patterns of candidate genes and sox9 genes among wild-type, sox9a, sox9b and sox9a;sox9b double mutant embryos by whole mount in situ hybridization. Our microarray experiments identified potential Sox9 target genes in two major developmental processes, skeletogenesis and retinogenesis, as well as several genes likely to represent secondary effects.

Targets involved in skeletogenesis

Microarray analysis showed that the collagen genes col2a1a and col11a2 were down-regulated in mutants. Because the mouse and human orthologs of col2a1a and col11a2 are well characterized direct targets of Sox9 (Bell et al., 1997; Lefebvre et al., 1997; Ng et al., 1997; Bridgewater et al., 1998; Bi et al., 1999; Sekiya et al., 2000), these genes validate the method. Indeed, it has already been shown in zebrafish embryos that the expression of col2a1a is down-regulated in sox9a, sox9b and double mutant embryos (Yan et al., 2005).

This study presents the first description of col11a2 expression in zebrafish. At 2dpf, col11a2 was expressed in neurocranial cartilages, pharyngeal cartilages, otic vesicle and pectoral fin bud. This expression pattern is consistent with mouse Col11a2, which is expressed in cartilaginous tissues, such as chondrocranium, hyoid, Meckel's, and limb cartilages (Sugimoto et al., 1998). Our results showed that the expression of zebrafish col11a2 was affected differently in sox9a, sox9b, and sox9a;sox9b double mutant embryos. Thus, we conclude that both sox9a and sox9b both regulate col11a2 expression in tissues in which each sox9 gene is expressed. After the sox9 gene duplication event, regulatory elements controlling the expression of sox9 co-orthologs apparently partitioned in a tissue-specific fashion, but the Sox9 proteins encoded by sox9a and sox9b retained the ability to regulate col11a2, presumably by binding to regulatory sites for the col11a2 gene. Other known or potential Sox9 targets, like aggrecan, hapln1b, runx2a and runx2b were not spotted on the array.

Targets involved in retinogenesis

Microarray analysis detected down-regulation of genes expressed in the retina, including calb2a, calb2b, crx, neurod, rs1, sox4a and vsx1; whole mount in situ hybridization experiments confirmed reduced expression of these genes in mutant retinas. Our analysis revealed the detailed expression pattern of calb2a, calb2b, rs1 and sox4a in developing retina, which had not previously been characterized in detail, although some data had been deposited in the high-throughput expression database in ZFIN (Rauch et al., 2003; Thisse and Thisse, 2004).

In situ hybridization results for calb2b were similar to the previously reported antibody staining for the Calretinin, which labels ganglion, amacrine and bipolar cells (Bernardos et al., 2005). Although calretinin is an alternative name for calb2a in zebrafish, the popularly used anti-Calretinin polyclonal antibody (AB5054 from Chemicon International, Temecula, CA) seems likely to recognize also Calb2b in zebrafish. Mouse Calretinin (Calb2) is a marker for ganglion and amacrine cells in retinas, and the same cell types express calb2b in zebrafish. Expression results suggest an evolutionary models: the ancestral expression domain of Calb2 was in ganglion and amacrine cells of the retina, and that this pattern was preserved by Calb2 in mouse and by calb2b in zebrafish, while zebrafish calb2a might have acquired an expanded expression domain in the inner nuclear layer of the retina. Another possible model would be that the ancestral Calb2 was expressed in a pattern that equals the sum of the zebrafish calb2a and calb2b domains, that these domains partitioned between two zebrafish calb2 genes, and that the mouse lineage preserved only the ganglion and amacrine expression domains.

Human RS1 is associated with X-linked retinoschisis, a common form of macular degeneration (Sauer et al., 1997). Rs1 encodes a protein containing a single discoidin domain shared with receptors for collagen (Vogel, 1999; Vogel et al., 2006). Although it has not been shown that Rs1 protein interacts with collagen, Rs1 is interesting as a candidate target for Sox9 because the collagens Col2a, Col9a1 and Col11a2 are known as Sox9 targets (Bell et al., 1997; Lefebvre et al., 1997; Ng et al., 1997; Bridgewater et al., 1998; Bi et al., 1999; Sekiya et al., 2000; Zhang et al., 2003; Genzer and Bridgewater, 2007). Mouse Rs1 is down-regulated in the retina of Crx knockout mice (Livesey et al., 2000; Blackshaw et al., 2001). The down-regulation of zebrafish rs1 in sox9 mutant retinas could thus either be a secondary effect due to the primary down-regulation of crx, or it might directly result from regulation by Sox9.

In zebrafish, crx is expressed in proliferating retinal progenitors and its expression was diminished in sox9b mutants. Our preliminary comparative genomic analyses identified a conserved non-coding element (CNE) near the crx gene that has Sox9 consensus binding sites (data not shown). Although we haven't confirmed its enhancer activity on crx gene expression, it is possible that Sox9 binds to these cis-elements and directly activates crx gene expression.

Our result showed that expression of vsx1 became down-regulated in sox9b mutants, and it has been published that expression of vsx1 also down-regulates in zebrafish crx morpholino injected embryos (Shen and Raymond, 2004). Thus, the reduction in vsx1 expression in sox9b mutant embryos could result from either a direct effect of sox9b loss or a secondary effect caused by the reduced crx activity that is associated with loss of sox9b. Both crx and vsx1 have predicted Sox9 binding sites (data not shown), as expected by the hypothesis that they are directly regulated by Sox9.

A novel function for Sox9 in retinal development

The retina of zebrafish, human, and other vertebrates consists of seven major cell types: six types of neurons and a glial cell type, all of which differentiate from the neural epithelium (Malicki, 2000; Stenkamp, 2007). In zebrafish, retinal neurogenesis proceeds sequentially; ganglion cells are generated from 24 to 36 hpf, cells of the inner nuclear layer arise from 36 to 48 hpf, and outer nuclear layer cells are born from 48 to 60 hpf (Stenkamp, 2007). Differentiation initiates in the ventral retina and then spreads dorsally around over time (Fadool and Dowling, 2008; Stenkamp, 2007). One of the zebrafish sox9 genes, sox9b, begins to be expressed in the eye by 24 hpf (Chiang et al., 2001), and at 2 dpf, localizes to the ciliary marginal zone of the retina, where retinal progenitors proliferate. In the retina of sox9b mutants, expression of candidate genes was severely reduced at 2 dpf in the outer nuclear layer, inner nuclear layer and ganglion nuclear layer, suggested that sox9b is required for differentiation of most of the retina. Although the expression of candidate genes became milder at 3 dpf, gene expression close to the ciliary marginal zone was still reduced, and Müller glial cells and photoreceptor cells were diminished in number and were disorganized in location at 5 dpf. Considering the expression pattern of sox9b, the expression of candidate genes in sox9b mutants, and the phenotype observed in the retina of sox9b mutants, we conclude that sox9b is essential for retinal development. The requirement of sox9b for retinal development is most prominent at 2 dpf, and it becomes less essential at 3 dpf but still required for organization and proliferation of Müller glial cells and photoreceptor cells; thus, these results uncover a novel function for Sox9.

Evolution of functions of zebrafish Sox9 co-orthologs

After gene duplication, preserved duplicates often experience reciprocal loss of gene subfunctions (Force et al., 1999; Postlethwait et al., 2004), for example, the zebrafish Sox9 co-orthologs, sox9a and sox9b, appear to have partitioned the ancestral craniofacial skeleton expression domain between the two genes. In other domains, both duplicates preserve ancestral functions, for example, both sox9a and sox9b are expressed in the otic vesicle. Because Col11a2 is a direct target of Sox9 (Bridgewater et al., 1998; Liu et al., 2000), and also because col11a2 was isolated as a candidate sox9 target in this study, the expression of col11a2 would be a good marker for visualizing functions of sox9, and for tracing the partitioning of subfunctions between sox9a and sox9b.

In the neurocranium, the ethmoid plate expresses sox9a but not sox9b, and the ethmoid plate is deleted in sox9a mutants but not in sox9b mutants; thus, our results show that col11a2 expression in the ethmoid plate depends on sox9a but not sox9b. On the other hand, wild-type pharyngeal arches express both sox9a and sox9b, with sox9a in the mesenchyme and sox9b in the epithelium (Yan et al., 2005), but neither sox9a nor sox9b single mutant embryos express col11a2 in pharyngeal arches. This result shows that the activity of both Sox9 co-orthologs is required in the pharyngeal arches to regulate col11a2. Both sox9a and sox9b are expressed in the otic vesicles, but in different, though overlapping domains (Chiang et al., 2001; Yan et al., 2005). Likewise, sox9a and sox9b single mutant embryos both express col11a2 in the otic vesicle, but in somewhat different patterns, and the function of both genes must be missing to ensure that the entire ear is gone. This result shows that, like the pharyngeal arches, the two Sox9 co-orthologs likely induce col11a2 expression in the domains of the otic vesicle in which they are expressed. We conclude that the regulatory relationship between sox9 genes and col11a2 differs among tissues: sox9a is sufficient for col11a2 expression in the ethmoid plate, both sox9a and sox9b are essential in pharyngeal arches, and each of the duplicates controls col11a2 expression in different parts of the otic vesicles.

Although Sox9 function in the eye is not yet well characterized in mouse or human, in mouse, Sox9 protein is expressed in eye (Ihanamäki et al., 2002), and human patients heterozygous for dominant SOX9 mutant alleles sometime experience reduced eye function (Mansour et al., 2002). These results suggest that the requirement of Sox9 in retinal development is conserved among vertebrates. The function of Sox9 in retinal development has not yet been discovered in mouse, probably because very few homozygous mouse embryos have been studied and tissue-specific knockout mutations have not yet targeted Sox9 knockout to the eye.

We propose that a requirement for Sox9 function in retinal development already existed in the last common ancestor of tetrapods and teleost fish, and that after the genome duplication in the teleost fish lineage, retinal function mostly partitioned to sox9b, which now acts to control cell numbers and organization during retinal development by activating, directly or indirectly, genes identified by our expression profiling study. Future experiments should be directed towards the identification of specific DNA elements responsible for this newly discovered role of Sox9.

Supplementary Material

Acknowledgments

We thank Steve Johnson and John Rawls for kindly providing the microarray, and Bruce Barut and Len Zon for sending us the klf2b plasmid, the Zebrafish International Resource Center (ZIRC, supported by grant P40 RR012546 from the NIH-NCRR) for providing the antibody zpr-3. We thank Joy Murphy, Amber Starks, Amanda Rapp and the University of Oregon Zebrafish Facility for providing animals and excellent fish care, and Poh Kheng Loi and Amber Selix of the Histology Facility for sectioning, and Jerry Gleason of the Bio-Optics Lab for help. We are grateful to the University of Oregon zebrafish ‘groupie’ attendees for helpful and friendly input. This work was supported by the National Center for Research Resources (5R01RR020833) and National Institutes of Health (P01 HD22486); the contents of this study are solely the responsibility of the authors and do not necessarily represent the official views of NCRR or NIH.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • Akiyama H, Chaboissier MC, Behringer RR, Rowitch DH, Schedl A, Epstein JA, de Crombrugghe B. Essential role of Sox9 in the pathway that controls formation of cardiac valves and septa. Proc Natl Acad Sci U S A. 2004;101:6502–6507. [PMC free article] [PubMed]
  • Amores A, Force A, Yan YL, Joly L, Amemiya C, Fritz A, Ho RK, Langeland J, Prince V, Wang YL, Westerfield M, Ekker M, Postlethwait JH. Zebrafish hox clusters and vertebrate genome evolution. Science. 1998;282:1711–1714. [PubMed]
  • Arango NA, Lovell-Badge R, Behringer RR. Targeted mutagenesis of the endogenous mouse Mis gene promoter: in vivo definition of genetic pathways of vertebrate sexual development. Cell. 1999;99:409–419. [PubMed]
  • Barrionuevo F, Naumann A, Bagheri-Fam S, Speth V, Taketo MM, Scherer G, Neubuser A. Sox9 is required for invagination of the otic placode in mice. Dev Biol. 2008;317:213–224. [PubMed]
  • Barrionuevo F, Taketo MM, Scherer G, Kispert A. Sox9 is required for notochord maintenance in mice. Dev Biol. 2006;295:128–140. [PubMed]
  • Bastide P, Darido C, Pannequin J, Kist R, Robine S, Marty-Double C, Bibeau F, Scherer G, Joubert D, Hollande F, Blache P, Jay P. Sox9 regulates cell proliferation and is required for Paneth cell differentiation in the intestinal epithelium. J Cell Biol. 2007;178:635–648. [PMC free article] [PubMed]
  • Bell DM, Leung KK, Wheatley SC, Ng LJ, Zhou S, Ling KW, Sham MH, Koopman P, Tam PP, Cheah KS. SOX9 directly regulates the type-II collagen gene. Nat Genet. 1997;16:174–178. [PubMed]
  • Bernardos RL, Lentz SI, Wolfe MS, Raymond PA. Notch-Delta signaling is required for spatial patterning and Muller glia differentiation in the zebrafish retina. Dev Biol. 2005;278:381–395. [PubMed]
  • Bi W, Deng JM, Zhang Z, Behringer RR, de Crombrugghe B. Sox9 is required for cartilage formation. Nat Genet. 1999;22:85–89. [PubMed]
  • Bi W, Huang W, Whitworth DJ, Deng JM, Zhang Z, Behringer RR, de Crombrugghe B. Haploinsufficiency of Sox9 results in defective cartilage primordia and premature skeletal mineralization. Proc Natl Acad Sci U S A. 2001;98:6698–6703. [PMC free article] [PubMed]
  • Blackshaw S, Fraioli RE, Furukawa T, Cepko CL. Comprehensive analysis of photoreceptor gene expression and the identification of candidate retinal disease genes. Cell. 2001;107:579–589. [PubMed]
  • Bowles J, Schepers G, Koopman P. Phylogeny of the SOX family of developmental transcription factors based on sequence and structural indicators. Dev Biol. 2000;227:239–255. [PubMed]
  • Bridgewater LC, Lefebvre V, de Crombrugghe B. Chondrocyte-specific enhancer elements in the Col11a2 gene resemble the Col2a1 tissue-specific enhancer. J Biol Chem. 1998;273:14998–15006. [PubMed]
  • Catchen JM, Conery JS, Postlethwait JH. Inferring ancestral gene order. Methods Mol Biol. 2008;452:365–383. [PubMed]
  • Chaboissier MC, Kobayashi A, Vidal VI, Lützkendorf S, van de Kant HJ, Wegner M, de Rooij DG, Behringer RR, Schedl A. Functional analysis of Sox8 and Sox9 during sex determination in the mouse. Development. 2004;131:1891–1901. [PubMed]
  • Chae JH, Stein GH, Lee JE. NeuroD: the predicted and the surprising. Mol Cells. 2004;18:271–288. [PubMed]
  • Cheung M, Chaboissier MC, Mynett A, Hirst E, Schedl A, Briscoe J. The transcriptional control of trunk neural crest induction, survival, and delamination. Dev Cell. 2005;8:179–192. [PubMed]
  • Chiang EF, Pai CI, Wyatt M, Yan YL, Postlethwait J, Chung B. Two Sox9 genes on duplicated zebrafish chromosomes: expression of similar transcription activators in distinct sites. Dev Biol. 2001;231:149–163. [PubMed]
  • Chow RL, Volgyi B, Szilard RK, Ng D, McKerlie C, Bloomfield SA, Birch DG, McInnes RR. Control of late off-center cone bipolar cell differentiation and visual signaling by the homeobox gene Vsx1. Proc Natl Acad Sci U S A. 2004;101:1754–1759. [PMC free article] [PubMed]
  • Cresko WA, Yan YL, Baltrus DA, Amores A, Singer A, Rodríguez-Marí A, Postlethwait JH. Genome duplication, subfunction partitioning, and lineage divergence: Sox9 in stickleback and zebrafish. Dev Dyn. 2003;228:480–489. [PubMed]
  • De Santa Barbara P, Bonneaud N, Boizet B, Desclozeaux M, Moniot B, Sudbeck P, Scherer G, Poulat F, Berta P. Direct interaction of SRY-related protein SOX9 and steroidogenic factor 1 regulates transcription of the human anti-Mullerian hormone gene. Mol Cell Biol. 1998;18:6653–6665. [PMC free article] [PubMed]
  • Fadool JM, Dowling JE. Zebrafish: a model system for the study of eye genetics. Prog Retin Eye Res. 2008;27:89–110. [PMC free article] [PubMed]
  • Flicek P, Aken BL, Beal K, Ballester B, Caccamo M, Chen Y, Clarke L, Coates G, Cunningham F, Cutts T, Down T, Dyer SC, Eyre T, Fitzgerald S, Fernandez-Banet J, Graf S, Haider S, Hammond M, Holland R, Howe KL, Howe K, Johnson N, Jenkinson A, Kahari A, Keefe D, Kokocinski F, Kulesha E, Lawson D, Longden I, Megy K, Meidl P, Overduin B, Parker A, Pritchard B, Prlic A, Rice S, Rios D, Schuster M, Sealy I, Slater G, Smedley D, Spudich G, Trevanion S, Vilella AJ, Vogel J, White S, Wood M, Birney E, Cox T, Curwen V, Durbin R, Fernandez-Suarez XM, Herrero J, Hubbard TJ, Kasprzyk A, Proctor G, Smith J, Ureta-Vidal A, Searle S. Ensembl 2008. Nucleic Acids Res. 2008;36:D707–714. [PMC free article] [PubMed]
  • Force A, Lynch M, Pickett FB, Amores A, Yan YL, Postlethwait J. Preservation of duplicate genes by complementary, degenerative mutations. Genetics. 1999;151:1531–1545. [PMC free article] [PubMed]
  • Foster JW, Dominguez-Steglich MA, Guioli S, Kowk G, Weller PA, Stevanović M, Weissenbach J, Mansour S, Young ID, Goodfellow PN, et al. Campomelic dysplasia and autosomal sex reversal caused by mutations in an SRY-related gene. Nature. 1994;372:525–530. [PubMed]
  • Furukawa T, Morrow EM, Cepko CL. Crx, a novel otx-like homeobox gene, shows photoreceptor-specific expression and regulates photoreceptor differentiation. Cell. 1997;91:531–541. [PubMed]
  • Furukawa T, Morrow EM, Li T, Davis FC, Cepko CL. Retinopathy and attenuated circadian entrainment in Crx-deficient mice. Nat Genet. 1999;23:466–470. [PubMed]
  • Galtier N, Gouy M, Gautier C. SEAVIEW and PHYLO_WIN: two graphic tools for sequence alignment and molecular phylogeny. Comput Appl Biosci. 1996;12:543–548. [PubMed]
  • Genzer MA, Bridgewater LC. A Col9a1 enhancer element activated by two interdependent SOX9 dimers. Nucleic Acids Res. 2007;35:1178–1186. [PMC free article] [PubMed]
  • Hoheisel JD. Microarray technology: beyond transcript profiling and genotype analysis. Nat Rev Genet. 2006;7:200–210. [PubMed]
  • Houston CS, Opitz JM, Spranger JW, Macpherson RI, Reed MH, Gilbert EF, Herrmann J, Schinzel A. The campomelic syndrome: review, report of 17 cases, and follow-up on the currently 17-year-old boy first reported by Maroteaux et al in 1971. Am J Med Genet. 1983;15:3–28. [PubMed]
  • Ihanamäki T, Säämänen AM, Suominen J, Pelliniemi LJ, Harley V, Vuorio E, Salminen H. Expression of Sox9 and type IIA procollagen during ocular development and aging in transgenic Del1 mice with a mutation in the type II collagen gene. Eur J Ophthalmol. 2002;12:450–458. [PubMed]
  • Jaillon O, Aury JM, Brunet F, Petit JL, Stange-Thomann N, Mauceli E, Bouneau L, Fischer C, Ozouf-Costaz C, Bernot A, Nicaud S, Jaffe D, Fisher S, Lutfalla G, Dossat C, Segurens B, Dasilva C, Salanoubat M, Levy M, Boudet N, Castellano S, Anthouard V, Jubin C, Castelli V, Katinka M, Vacherie B, Biemont C, Skalli Z, Cattolico L, Poulain J, De Berardinis V, Cruaud C, Duprat S, Brottier P, Coutanceau JP, Gouzy J, Parra G, Lardier G, Chapple C, McKernan KJ, McEwan P, Bosak S, Kellis M, Volff JN, Guigo R, Zody MC, Mesirov J, Lindblad-Toh K, Birren B, Nusbaum C, Kahn D, Robinson-Rechavi M, Laudet V, Schachter V, Quetier F, Saurin W, Scarpelli C, Wincker P, Lander ES, Weissenbach J, Roest Crollius H. Genome duplication in the teleost fish Tetraodon nigroviridis reveals the early vertebrate proto-karyotype. Nature. 2004;431:946–957. [PubMed]
  • Jensen AM, Walker C, Westerfield M. mosaic eyes: a zebrafish gene required in pigmented epithelium for apical localization of retinal cell division and lamination. Development. 2001;128:95–105. [PubMed]
  • Kimmel CB, Ballard WW, Kimmel SR, Ullmann B, Schilling TF. Stages of embryonic development of the zebrafish. Dev Dyn. 1995;203:253–310. [PubMed]
  • Kist R, Schrewe H, Balling R, Scherer G. Conditional inactivation of Sox9: a mouse model for campomelic dysplasia. Genesis. 2002;32:121–123. [PubMed]
  • Korzh V, Sleptsova I, Liao J, He J, Gong Z. Expression of zebrafish bHLH genes ngn1 and nrd defines distinct stages of neural differentiation. Dev Dyn. 1998;213:92–104. [PubMed]
  • Lee JE, Hollenberg SM, Snider L, Turner DL, Lipnick N, Weintraub H. Conversion of Xenopus ectoderm into neurons by NeuroD, a basic helix-loop-helix protein. Science. 1995;268:836–844. [PubMed]
  • Lefebvre V, Huang W, Harley VR, Goodfellow PN, de Crombrugghe B. SOX9 is a potent activator of the chondrocyte-specific enhancer of the pro alpha1(II) collagen gene. Mol Cell Biol. 1997;17:2336–2346. [PMC free article] [PubMed]
  • Levine EM, Passini M, Hitchcock PF, Glasgow E, Schechter N. Vsx-1 and Vsx-2: two Chx10-like homeobox genes expressed in overlapping domains in the adult goldfish retina. J Comp Neurol. 1997;387:439–448. [PubMed]
  • Lincoln J, Kist R, Scherer G, Yutzey KE. Sox9 is required for precursor cell expansion and extracellular matrix organization during mouse heart valve development. Dev Biol. 2007;305:120–132. [PMC free article] [PubMed]
  • Liu Y, Li H, Tanaka K, Tsumaki N, Yamada Y. Identification of an enhancer sequence within the first intron required for cartilage-specific transcription of the alpha2(XI) collagen gene. J Biol Chem. 2000;275:12712–12718. [PubMed]
  • Liu Y, Shen Y, Rest JS, Raymond PA, Zack DJ. Isolation and characterization of a zebrafish homologue of the cone rod homeobox gene. Invest Ophthalmol Vis Sci. 2001;42:481–487. [PubMed]
  • Livesey FJ, Furukawa T, Steffen MA, Church GM, Cepko CL. Microarray analysis of the transcriptional network controlled by the photoreceptor homeobox gene Crx. Curr Biol. 2000;10:301–310. [PubMed]
  • Malicki J. Harnessing the power of forward genetics--analysis of neuronal diversity and patterning in the zebrafish retina. Trends Neurosci. 2000;23:531–541. [PubMed]
  • Mansour S, Offiah AC, McDowall S, Sim P, Tolmie J, Hall C. The phenotype of survivors of campomelic dysplasia. J Med Genet. 2002;39:597–602. [PMC free article] [PubMed]
  • Marshall OJ, Harley VR. Molecular mechanisms of SOX9 action. Mol Genet Metab. 2000;71:455–462. [PubMed]
  • Mavropoulos A, Devos N, Biemar F, Zecchin E, Argenton F, Edlund H, Motte P, Martial JA, Peers B. sox4b is a key player of pancreatic alpha cell differentiation in zebrafish. Dev Biol. 2005;285:211–223. [PubMed]
  • Molday LL, Wu WW, Molday RS. Retinoschisin (RS1), the protein encoded by the X-linked retinoschisis gene, is anchored to the surface of retinal photoreceptor and bipolar cells through its interactions with a Na/K ATPase-SARM1 complex. J Biol Chem. 2007;282:32792–32801. [PubMed]
  • Mori-Akiyama Y, Akiyama H, Rowitch DH, de Crombrugghe B. Sox9 is required for determination of the chondrogenic cell lineage in the cranial neural crest. Proc Natl Acad Sci U S A. 2003;100:9360–9365. [PMC free article] [PubMed]
  • Mori-Akiyama Y, van den Born M, van Es JH, Hamilton SR, Adams HP, Zhang J, Clevers H, de Crombrugghe B. SOX9 is required for the differentiation of paneth cells in the intestinal epithelium. Gastroenterology. 2007;133:539–546. [PubMed]
  • Mueller T, Wullimann MF. Expression domains of neuroD (nrd) in the early postembryonic zebrafish brain. Brain Res Bull. 2002;57:377–379. [PubMed]
  • Naya FJ, Stellrecht CM, Tsai MJ. Tissue-specific regulation of the insulin gene by a novel basic helix-loop-helix transcription factor. Genes Dev. 1995;9:1009–1019. [PubMed]
  • Ng LJ, Wheatley S, Muscat GE, Conway-Campbell J, Bowles J, Wright E, Bell DM, Tam PP, Cheah KS, Koopman P. SOX9 binds DNA, activates transcription, and coexpresses with type II collagen during chondrogenesis in the mouse. Dev Biol. 1997;183:108–121. [PubMed]
  • Oates AC, Pratt SJ, Vail B, Yan Y, Ho RK, Johnson SL, Postlethwait JH, Zon LI. The zebrafish klf gene family. Blood. 2001;98:1792–1801. [PubMed]
  • Ochocinska MJ, Hitchcock PF. Dynamic expression of the basic helix-loop-helix transcription factor neuroD in the rod and cone photoreceptor lineages in the retina of the embryonic and larval zebrafish. J Comp Neurol. 2007;501:1–12. [PubMed]
  • Ohtoshi A, Wang SW, Maeda H, Saszik SM, Frishman LJ, Klein WH, Behringer RR. Regulation of retinal cone bipolar cell differentiation and photopic vision by the CVC homeobox gene Vsx1. Curr Biol. 2004;14:530–536. [PubMed]
  • Passini MA, Kurtzman AL, Canger AK, Asch WS, Wray GA, Raymond PA, Schechter N. Cloning of zebrafish vsx1: expression of a paired-like homeobox gene during CNS development. Dev Genet. 1998;23:128–141. [PubMed]
  • Passini MA, Levine EM, Canger AK, Raymond PA, Schechter N. Vsx-1 and Vsx-2: differential expression of two paired-like homeobox genes during zebrafish and goldfish retinogenesis. J Comp Neurol. 1997;388:495–505. [PubMed]
  • Perrière G, Gouy M. WWW-query: an on-line retrieval system for biological sequence banks. Biochimie. 1996;78:364–369. [PubMed]
  • Piotrowski T, Schilling TF, Brand M, Jiang YJ, Heisenberg CP, Beuchle D, Grandel H, van Eeden FJ, Furutani-Seiki M, Granato M, Haffter P, Hammerschmidt M, Kane DA, Kelsh RN, Mullins MC, Odenthal J, Warga RM, Nusslein-Volhard C. Jaw and branchial arch mutants in zebrafish II: anterior arches and cartilage differentiation. Development. 1996;123:345–356. [PubMed]
  • Postlethwait J, Amores A, Cresko W, Singer A, Yan YL. Subfunction partitioning, the teleost radiation and the annotation of the human genome. Trends Genet. 2004;20:481–490. [PubMed]
  • Postlethwait JH, Yan YL, Gates MA, Horne S, Amores A, Brownlie A, Donovan A, Egan ES, Force A, Gong Z, Goutel C, Fritz A, Kelsh R, Knapik E, Liao E, Paw B, Ransom D, Singer A, Thomson M, Abduljabbar TS, Yelick P, Beier D, Joly JS, Larhammar D, Rosa F, Westerfield M, Zon LI, Johnson SL, Talbot WS. Vertebrate genome evolution and the zebrafish gene map. Nat Genet. 1998;18:345–349. [PubMed]
  • Rauch GJ, Lyons DA, Middendorf I, Friedlander B, Arana N, Reyes T, Talbot WS. Submission and Curation of Gene Expression Data. ZFIN Direct Data Submission. 2003. http://zfin.org.
  • Rawls JF, Samuel BS, Gordon JI. Gnotobiotic zebrafish reveal evolutionarily conserved responses to the gut microbiota. Proc Natl Acad Sci U S A. 2004;101:4596–4601. [PMC free article] [PubMed]
  • Rodríguez-Marí A, Yan YL, Bremiller RA, Wilson C, Cañestro C, Postlethwait JH. Characterization and expression pattern of zebrafish anti-Müllerian hormone (amh) relative to sox9a, sox9b, and cyp19a1a, during gonad development. Gene Expr Patterns. 2005;5:655–667. [PubMed]
  • Saint-Germain N, Lee YH, Zhang Y, Sargent TD, Saint-Jeannet JP. Specification of the otic placode depends on Sox9 function in Xenopus. Development. 2004;131:1755–1763. [PubMed]
  • Saito T, Ikeda T, Nakamura K, Chung UI, Kawaguchi H. S100A1 and S100B, transcriptional targets of SOX trio, inhibit terminal differentiation of chondrocytes. EMBO Rep. 2007;8:504–509. [PMC free article] [PubMed]
  • Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol. 1987;4:406–425. [PubMed]
  • Sakai D, Suzuki T, Osumi N, Wakamatsu Y. Cooperative action of Sox9, Snail2 and PKA signaling in early neural crest development. Development. 2006;133:1323–1333. [PubMed]
  • Sandell JH, Martin SC, Heinrich G. The development of GABA immunoreactivity in the retina of the zebrafish (Brachydanio rerio) J Comp Neurol. 1994;345:596–601. [PubMed]
  • Sauer CG, Gehrig A, Warneke-Wittstock R, Marquardt A, Ewing CC, Gibson A, Lorenz B, Jurklies B, Weber BH. Positional cloning of the gene associated with X-linked juvenile retinoschisis. Nat Genet. 1997;17:164–170. [PubMed]
  • Schena M, Shalon D, Davis RW, Brown PO. Quantitative monitoring of gene expression patterns with a complementary DNA microarray. Science. 1995;270:467–470. [PubMed]
  • Schilham MW, Oosterwegel MA, Moerer P, Ya J, de Boer PA, van de Wetering M, Verbeek S, Lamers WH, Kruisbeek AM, Cumano A, Clevers H. Defects in cardiac outflow tract formation and pro-B-lymphocyte expansion in mice lacking Sox-4. Nature. 1996;380:711–714. [PubMed]
  • Sekiya I, Tsuji K, Koopman P, Watanabe H, Yamada Y, Shinomiya K, Nifuji A, Noda M. SOX9 enhances aggrecan gene promoter/enhancer activity and is up-regulated by retinoic acid in a cartilage-derived cell line, TC6. J Biol Chem. 2000;275:10738–10744. [PubMed]
  • Seymour PA, Freude KK, Tran MN, Mayes EE, Jensen J, Kist R, Scherer G, Sander M. SOX9 is required for maintenance of the pancreatic progenitor cell pool. Proc Natl Acad Sci U S A. 2007;104:1865–1870. [PMC free article] [PubMed]
  • Shen YC, Raymond PA. Zebrafish cone-rod (crx) homeobox gene promotes retinogenesis. Dev Biol. 2004;269:237–251. [PubMed]
  • Spokony RF, Aoki Y, Saint-Germain N, Magner-Fink E, Saint-Jeannet JP. The transcription factor Sox9 is required for cranial neural crest development in Xenopus. Development. 2002;129:421–432. [PubMed]
  • Stenkamp DL. Neurogenesis in the fish retina. Int Rev Cytol. 2007;259:173–224. [PMC free article] [PubMed]
  • Stolt CC, Lommes P, Sock E, Chaboissier MC, Schedl A, Wegner M. The Sox9 transcription factor determines glial fate choice in the developing spinal cord. Genes Dev. 2003;17:1677–1689. [PMC free article] [PubMed]
  • Südbeck P, Schmitz ML, Baeuerle PA, Scherer G. Sex reversal by loss of the C-terminal transactivation domain of human SOX9. Nat Genet. 1996;13:230–232. [PubMed]
  • Sugimoto M, Kimura T, Tsumaki N, Matsui Y, Nakata K, Kawahata H, Yasui N, Kitamura Y, Nomura S, Ochi T. Differential in situ expression of alpha2(XI) collagen mRNA isoforms in the developing mouse. Cell Tissue Res. 1998;292:325–332. [PubMed]
  • Taylor JS, Braasch I, Frickey T, Meyer A, Van de Peer Y. Genome duplication, a trait shared by 22000 species of ray-finned fish. Genome Res. 2003;13:382–390. [PMC free article] [PubMed]
  • Thisse B, Pflumio S, Fürthauer M, Loppin B, Heyer V, Degrave A, Woehl R, Lux A, Steffan T, Charbonnier XQ, Thisse C. Expression of the zebrafish genome during embryogenesis (NIH R01 RR15402). ZFIN Direct Data Submission. 2001. http://zfin.org.
  • Thisse B, Thisse C. Fast Release Clones: A High Throughput Expression Analysis. ZFIN Direct Data Submission. 2004. http://zfin.org.
  • Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997;25:4876–4882. [PMC free article] [PubMed]
  • Vidal VP, Chaboissier MC, de Rooij DG, Schedl A. Sox9 induces testis development in XX transgenic mice. Nat Genet. 2001;28:216–217. [PubMed]
  • Visel A, Thaller C, Eichele G. GenePaint.org: an atlas of gene expression patterns in the mouse embryo. Nucleic Acids Res. 2004;32:D552–556. [PMC free article] [PubMed]
  • Vogel W. Discoidin domain receptors: structural relations and functional implications. Faseb J. 1999;13(Suppl):S77–82. [PubMed]
  • Vogel WF, Abdulhussein R, Ford CE. Sensing extracellular matrix: an update on discoidin domain receptor function. Cell Signal. 2006;18:1108–1116. [PubMed]
  • Wagner T, Wirth J, Meyer J, Zabel B, Held M, Zimmer J, Pasantes J, Bricarelli FD, Keutel J, Hustert E, et al. Autosomal sex reversal and campomelic dysplasia are caused by mutations in and around the SRY-related gene SOX9. Cell. 1994;79:1111–1120. [PubMed]
  • Westerfield M. The zebrafish book; A guide for the laboratory use of zebrafish (Danio rerio) University of Oregon Press; Eugene, OR: 2000.
  • Wilson ME, Yang KY, Kalousova A, Lau J, Kosaka Y, Lynn FC, Wang J, Mrejen C, Episkopou V, Clevers HC, German MS. The HMG box transcription factor Sox4 contributes to the development of the endocrine pancreas. Diabetes. 2005;54:3402–3409. [PubMed]
  • Wu WW, Wong JP, Kast J, Molday RS. RS1, a discoidin domain-containing retinal cell adhesion protein associated with X-linked retinoschisis, exists as a novel disulfide-linked octamer. J Biol Chem. 2005;280:10721–10730. [PubMed]
  • Ya J, Schilham MW, de Boer PA, Moorman AF, Clevers H, Lamers WH. Sox4-deficiency syndrome in mice is an animal model for common trunk. Circ Res. 1998;83:986–994. [PubMed]
  • Yan YL, Miller CT, Nissen RM, Singer A, Liu D, Kirn A, Draper B, Willoughby J, Morcos PA, Amsterdam A, Chung BC, Westerfield M, Haffter P, Hopkins N, Kimmel C, Postlethwait JH. A zebrafish sox9 gene required for cartilage morphogenesis. Development. 2002;129:5065–5079. [PubMed]
  • Yan YL, Willoughby J, Liu D, Crump JG, Wilson C, Miller CT, Singer A, Kimmel C, Westerfield M, Postlethwait JH. A pair of Sox: distinct and overlapping functions of zebrafish sox9 co-orthologs in craniofacial and pectoral fin development. Development. 2005;132:1069–1083. [PubMed]
  • Zhang P, Jimenez SA, Stokes DG. Regulation of human COL9A1 gene expression. Activation of the proximal promoter region by SOX9. J Biol Chem. 2003;278:117–123. [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links