Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
Development. Author manuscript; available in PMC Jul 1, 2009.
Published in final edited form as:
PMCID: PMC2704560
NIHMSID: NIHMS114036

Embryonic requirements for ErbB signaling in neural crest development and adult pigment pattern formation

SUMMARY

Vertebrate pigment cells are derived from neural crest cells and are a useful system for studying neural crest-derived traits during post-embryonic development. In zebrafish, neural crest-derived melanophores differentiate during embryogenesis to produce stripes in the early larva. Dramatic changes to the pigment pattern occur subsequently during the larva-to-adult transformation, or metamorphosis. At this time, embryonic melanophores are replaced by newly differentiating metamorphic melanophores that form the adult stripes. Mutants with normal embryonic/early larval pigment patterns but defective adult patterns identify factors required uniquely to establish, maintain, or recruit the latent precursors to metamorphic melanophores. We show that one such mutant, picasso, lacks most metamorphic melanophores and results from mutations in the ErbB gene erbb3b, encoding an EGFR-like receptor tyrosine kinase. To identify critical periods for ErbB activities, we treated fish with pharmacological ErbB inhibitors and also knocked-down erbb3b by morpholino injection. These analyses reveal an embryonic critical period for ErbB signaling in promoting later pigment pattern metamorphosis, despite the normal patterning of embryonic/early larval melanophores. We further demonstrate a peak requirement during neural crest migration that correlates with early defects in neural crest pathfinding and peripheral ganglion formation. Finally, we show that erbb3b activities are both autonomous and non-autonomous to the metamorphic melanophore lineage. These data identify a very early, embryonic, requirement for erbb3b in the development of much later metamorphic melanophores, and suggest complex modes by which ErbB signals promote adult pigment pattern development.

Keywords: ErbB, erbb3, HER3, melanophore, metamorphosis, stem cell, zebrafish

INTRODUCTION

The generation of adult form remains an enduring problem in developmental biology. An interesting system for studying the genetic and cellular mechanisms underlying adult morphology is the larva-to-adult transformation, or metamorphosis, of many amphibians and fishes (Moran, 1994; Parichy, 1998; Webb, 1999; Brown and Cai, 2007). In zebrafish, Danio rerio, metamorphosis includes dramatic changes in which an early larval morphology is transformed into that of the adult. During this time, many traits are modified including the digestive, excretory, and sensory systems, the central and peripheral nervous systems, the skeleton, fins, and integument, as well as physiology and behavior (Cubbage and Mabee, 1996; Brown, 1997; Elizondo et al., 2005; Tingaud-Sequeira et al., 2006; Engeszer et al., 2008).

One particularly accessible trait that changes during metamorphosis is the pigment pattern (Kelsh, 2004). The zebrafish early larval pigment pattern develops in the embryo from pigment cells, or chromatophores, that are derived from neural crest cells. This embryonic/early larval pigment pattern is completed by 5 days post-fertilization (dpf) and includes several stripes of black melanophores with yellow xanthophores scattered widely over the flank. This pattern persists until the onset of metamorphosis (~14 dpf) when melanophores begin to differentiate outside of the embryonic/early larval stripes. During the next two weeks, new adult stripes begin to form as some metamorphic melanophores migrate to sites of adult stripe formation (between the embryonic/early larval stripes) and other melanophores differentiate already at these sites. The result is a juvenile pigment pattern with two “primary” stripes that include melanophores, bordering an “interstripe” that includes xanthophores; iridophores are found throughout the flank.

Embryonic/early larval chromatophores and metamorphic chromatophores might be expected to have commonalities as well as differences in their genetic requirements. For example, several mutants lack chromatophore types or pigments both before and after metamorphosis [e.g., nacre, csf1r, golden (Lister et al., 1999; Parichy et al., 2000b; Lamason et al., 2005)]. Others exhibit defects in the adult but not in the embryo [e.g., leopard, jaguar/obelix, ednrb1 (Parichy et al., 2000a; Iwashita et al., 2006; Watanabe et al., 2006)]. Mutants in this latter class are particularly interesting because they identify genes uniquely required for the establishment, maintenance, or differentiation of latent precursors that contribute to adult form. Included among these mutants are two with similar phenotypes, puma and picasso, each having a grossly normal embryonic/early larval pigment pattern but fewer metamorphic melanophores (Fig. 1A,B) (Parichy and Turner, 2003b; Parichy et al., 2003; Quigley et al., 2004). Whereas puma is required autonomously to metamorphic melanophore precursors during pigment pattern metamorphosis, the cellular and temporal requirements for picasso are not known.

Fig. 1
Defective adult pigment pattern but normal embryonic/early larval pigment pattern of picasso mutants

Here, we show that picasso is allelic to erbb3b, encoding an epidermal growth factor receptor (EGFR)-like tyrosine kinase. erbb3b is one of two zebrafish orthologues of Human Epidermal Growth Factor Receptor 3 (HER3, ErbB3) and part of a larger family that includes EGFR (ErbB1), ErbB2, and ErbB4 (Stein and Staros, 2006). Ligands for ErbB receptors include EGF as well as neuregulins (NRGs) 1, 2 and 3. ErbB receptors have several roles during development, including critical functions in glial morphogenesis (Lyons et al., 2005; Britsch, 2007), and their misregulation is associated with a variety of cancers (Citri and Yarden, 2006; Linggi and Carpenter, 2006; Breuleux, 2007; Bublil and Yarden, 2007; Sergina and Moasser, 2007). The receptors form dimers with individual monomers having varying activities and ligand specificities: for instance, ErbB3 lacks endogenous kinase activity while ErbB2 lacks its own high affinity ligand. Whereas several heterodimers are possible, only a subset seem to have biological significance, with ErbB3 acting with ErbB2 (Graus-Porta et al., 1997; Jones et al., 1999; Oda et al., 2005) and potentially with EGFR as well (Soltoff et al., 1994; Frolov et al., 2007; Poumay, 2007).

In this study, we find that metamorphic melanophores express erbb3b, suggesting an autonomous activity that occurs late, during the larva-to-adult transformation. Nonetheless, we show by genetic mosaic analyses that erbb3b functions both autonomously and non-autonomously to the metamorphic melanophore lineage. Using pharmacological inhibition and morpholino knockdown, we also identify the temporal requirements for ErbB signals in adult pigment pattern metamorphosis. We demonstrate a major critical period during embryonic neural crest cell migration, at least two weeks before the larva-to-adult transformation, indicating a novel role for ErbB signals in establishing latent precursors that will subsequently contribute to the adult pigment pattern. Using sensitized genetic backgrounds, we also find cryptic requirements for ErbB signals during pigment pattern metamorphosis, suggesting redundant functions with other pathways at this later stage. Our study thus provides new insights into the development of adult form and the genetic requirements for trait expression before and after metamorphosis.

MATERIALS AND METHODS

Fish stocks

Fish were maintained at 26−28 °C, 14L:10D according to standard methods (Westerfield, 2000). picasso mutants were recovered in screens for N-ethyl-N-nitrosourea-induced mutations and mapped using the partially inbred strains, ABwp and wikwp.

Cell transplantation

Chimeric embryos were generated by transplanting cells at blastula stages (3.3−3.8 hours post-fertilization) and then were reared through metamorphosis (Parichy and Turner, 2003a).

Pharmacological ErbB inhibitor treatments

Stock solutions of AG1478 (4-(3-chloroanilino)-6,7-dimethoxyquinazoline; Calbiochem) or PD158780 (4-[(3-bromophenyl)amino]-6-(methylamino)-pyrido[3,4-d]pyridimine; Calbiochem) were diluted in DMSO. Pilot studies confirmed that treating embryos with 3 μM of either drug phenocopied an excess neuromast defect of erbb3b mutants (data not shown) (Lyons et al., 2005), whereas lower doses were less effective and higher doses caused lethality of embryos, larvae, or both. Fish were treated with either drug in 10% Hanks solution. To facilitate penetration into the tissues, 0.5% DMSO was added to all media and embryos were dechorionated prior to treatment. Fish were reared in agar-lined Petri dishes or glass beakers and solutions were changed daily. Fish reared in either drug throughout development invariably died prior to formation of the adult pigment pattern so could not be analyzed.

Morpholino injection

A previously described splice-blocking morpholino against erbb3b [TGGGCTCGCAACTGGGTGGAAACAA; (Lyons et al., 2005)] was obtained from GeneTools (Eugene, OR). One or two cell embryos were injected with 300−500 pg and reared through formation of the adult pigment pattern.

PCR, genotyping, and sequencing

For RT-PCR of isolated cell types, metamorphosing larvae were euthanized and rinsed in 10% Hanks solution, after which tissues were dissected and placed in dissociation medium (1 mg/ml collagenase type IV; 0.1 mM epinephrine; 2 mg/ml bovine serum albumin; 0.1 mg/ml trypsin inhibitor) at room temperature with gentle agitiation (Clark et al., 1987). Cells were picked and transferred to wash medium (5% fetal bovine serum in PBS) for 10 min, then picked and extracted for RNA. cDNAs were synthesized with the Superscript III CellsDirect cDNA Synthesis System (Invitrogen) and RT-PCRs were performed using the following primers (forward, reverse): erbb3b, ACTCCCTAAAAATCCCTGTGG, GGCGAAGGTGTTGAAGTAAT; erbb2, CACCGGAAGTTTACTCACCAA, GATCTCCAACATTTGACCAT; erbb3a, TGACTCCATCCACTACTGCTG, TTCTTCACCAGCACCTCTGTT; egfr, CCGTTGGTGTGTGTTTTGAG, GCTTTTCAGGAGGGAGACTTTC; dct, ACCTGTGACCAATGAGGAGATT, TACAACACCAACACGATCAACA; β-actin, GTTTTCCCCTCCATTGTT, GGTGTTGAAGGTCTCGAACA; erbb4, CTGCTGCTCAACTGGTGTGT, CCAGTGCCATCACAGCTTCT.

For genotyping of the picassowp.r2e2 mutant allele, we amplified genomic DNA (pcs-wpr2e2*: TTGGTTACCATTGTGGTTGTTT, TCTTCATGGTAGCTCAGAAACATC) from individual embryos and digested the resulting PCR products with Rsa I restriction enzyme. The wild-type amplicon cuts with Rsa I at position 219, whereas the mutant allele does not cut.

All sequencing reactions were performed with ABI Big Dye 3.1 and resolved on ABI 3100 genetic analyzers.

In situ hybridization

Analyses of mRNA distributions in embryos followed standard protocols (Parichy et al., 2000b). In situ hybridizations on larvae followed (Elizondo et al., 2005), but used overnight incubations for hybridizations and antibodies (detailed protocol available on-line, http://protist.biology.washington.edu/dparichy/). For analyses of gene expression in families segregating picasso mutant alleles, individual embryos or larvae were imaged after staining then transferred to DNA extraction buffer and prcessed as above to determine genotypes retrospectively.

Immunohistochemistry

Trunks of 12 dpf larvae were fixed in 4% PFA in PBS for 6 hrs at room temperature with gentle agitation then permeabilized by washing overnight in deionized water at room temperature. Specimens were equilibrated in PDTX (PBS containing 1% DMSO and 0.3% Triton X) three times for 30 min each, then blocked with 5% goat serum in PDTX for 4 hours at room temperature. Larvae were incubated overnight at 4°C with primary antibody mAB16A11 (Marusich et al., 1994; Henion et al., 1996) against the HuC/D antigen (1:200 in blocking solution), washed extensively in PDTX, incubated overnight at 4°C with secondary antibody (Alexa Fluor 568; Molecular Probes), then washed and visualized.

Image analyses and statistical methods

Embryos or larvae were viewed with Olympus SZX-12 or Zeiss Lumar stereomicroscopes, or with Zeiss Axioplan 2 or Zeiss Observer compound microscopes. Digital images were collected with Zeiss Axiocam HR cameras using Zeiss Axiovision 3 and corrected for contrast and color balance when necessary in Adobe Photoshop CS3.

All statistical analyses were performed with JMP 7.0 (SAS Institute, Cary NC). For counts of melanophores, individual cells were distinguished from one another by treating fish with epinephrine to contract melanosomes towards cell bodies. Densities of melanophores were determined by counting melanophores within a rectangular region of interest delimited by: anteriorly, the anterior margin of the dorsal fin insertion; posteriorly, the posterior margin of the anal fin insertion; dorsally, the posterior margin of the dorsal fin insertion; ventrally, the posterior margin of the anal fin insertion. To control for variation in larval development stage, we tested for effects of larval size (measured as flank height at the posterior margin of the anal fin, hpa) as a covariate in analyses (Parichy and Turner, 2003b), and retained this factor if P<0.05, though analyses without the cofactor yielded qualitatively equivalent results (data not shown). Analyses of melanophore densities were treated as multifactorial analyses of variance or covariance with replicates as blocks. Residuals in all analyses were examined for normality and homoscedasticity. Least squares means (correcting for size, replicate variation, or both) are presented in figures below, with significant differences assessed post hoc by Tukey-Kramer comparisons of all means to preserve an experiment-wide α=0.05.

For analyses of embryonic critical periods for ErbB signals in kit mutant larvae (see below), adult pigment patterns were scored for qualitative degree of stripe disruption. Breaks in stripes were considered present when ≤3 melanophores were present over a defined anterior–posterior length, as scaled by hpa (above): stripes exhibiting breaks no wider than 0.5 hpa were scored “0”; breaks between 0.5−1 hpa were scored “1”; breaks greater than 1 hpa were scored “2”. Dorsal and ventral stripes were scored individually, and resulting scores were summed to generate a “stripe break score” ranging from 0−4. To test for differences among treatment groups, we compared ordinal scores using both non-parametric Wilcoxon tests as well as contingency table analyses. Both methods yielded equivalent results (data not shown); for simplicity we present only the former (complete analyses available on request).

RESULTS

Metamorphic melanophore development requires erbb3b

To learn when picasso mutants first exhibit pigment pattern defects, we examined embryos and early larvae and we imaged individual fish daily from early larval stages through formation of the adult pigment pattern. Pigment cell complements of embryos and early larvae were normal (Fig. 1C,D). Subsequently, however, picasso mutants largely failed to develop metamorphic melanophores, particularly in the mid-trunk, and instead retained early larval melanophores even as adults (Fig. 1E–L). In the posterior trunk of picasso mutants, seemingly more complete melanophore stripes formed. To assess how pattern formation in this region differs from the mid-trunk, we recorded daily images from additional fish. In the posterior of both wild-type and picasso mutants, there were greater numbers of persisting embryonic/early larval melanophores as compared to the mid-trunk (Fig. 2). Concomitantly, picasso mutants exhibited more differentiating metamorphic melanophores in this region as compared to more anteriorly, perhaps reflecting community effects on melanophore survival (Parichy et al., 2000b; Parichy et al., 2003).

Fig. 2
Regulative posterior adult stripe formation in the picasso mutant

We mapped picasso to chromosome 23 in the vicinity of erbb3b and found that picasso failed to complement an excess neuromast phenotype of an erbb3b null allele (data not shown; all of these alleles are recessive and homozygous viable, though weaker than wild-type)(Talbot, personal communication)(Lyons et al., 2005). Sequencing erbb3b cDNAs revealed premature stop codons in each of two picasso alleles (Fig. 3), demonstrating that the picasso phenotype arises from mutations in erbb3b.

Fig. 3
picasso is allelic to erbb3

In embryos, erbb3b is expressed in neural crest cells and glia (Lyons et al., 2005). In metamorphosing larvae, we detected erbb3b expression in glia by in situ hybridization (Fig. 4A), consistent with the earlier embryonic expression in these cells. To see if erbb3b might be expressed in other tissues at levels below the threshold of detection by in situ hybridization, we used RT-PCR on cDNAs isolated from metamorphic melanophores, as well as juvenile caudal fin, which comprises melanophores, melanophore precursors, dermal bone, skin, vasculature, and other cell types. We detected erbb3b transcripts in both isolated melanophores and in juvenile fin (Fig. 4C). We also detected the erbb3b paralogue, erbb3a, in glia and in fin, though not in metamorphic melanophores (Fig. 4B,C). Since ErbB receptors act as heterodimers, we tested if other erbb genes are expressed in metamorphic melanophores, where they might provide heterodimerization partners for erbb3b (Fig. 4C): erbb2 was expressed in metamorphic melanophores and in fin; egfr was not expressed in metamorphic melanophores, though it was expressed in fin; and we could not detect erbb4 in melanophores or in fin (data not shown). erbb2 and egfr also are widely expressed in zebrafish embryos (Goishi et al., 2003; Lyons et al., 2005)

Fig. 4
ErbB gene expression in metamorphosing larvae

To determine what steps in metamorphic melanophore development require erbb3b, we examined molecular marker expression (Fig. 5A–F). picasso mutant larvae were deficient during metamorphosis for cells expressing early neural crest markers (crestin, sox10), as well as early and late markers of the melanophore lineage (mitfa, dct). picasso mutants also had transiently fewer cells expressing xanthophore lineage markers (xdh, csf1r) and, similar to embryonic stages (Lyons et al., 2005), fewer myelin basic protein+ (mbp+) glia (Fig. 5G,H and data not shown).

Fig. 5
Metamorphic deficiencies for early and late markers of neural crest-derived lineages in picasso mutant larvae

erbb3b functions autonomously and non-autonomously to the metamorphic melanophore lineage

erbb3b might promote adult pigment pattern formation by acting autonomously to the metamorphic melanophore lineage, but also could have non-autonomous effects if, for example, erbb3b-dependent cells provide signals required by metamorphic melanophores or their precursors. To test these possibilities, we constructed genetic mosaics by transplanting cells between blastula stage embryos.

If erbb3b acts autonomously to the metamorphic melanophore lineage, then wild-type melanophores should develop in picasso mutants and these cells should form wild-type stripes. If erbb3b acts non-autonomously, then wild-type melanophores should develop where picasso mutant melanophores develop (anteriorly and posteriorly), but not where picasso mutant melanophores are absent (mid-trunk) (Fig. 1B). Wild-type (β-actin::EGFP+) → picasso chimeras developed wild-type metamorphic melanophores at high density anteriorly and posteriorly (Figs. 6A,B) but often developed few if any metamorphic melanophores in the mid-trunk (Figs. 6A,C), similar to picasso mutants (Figs. 1, ,2).2). In reciprocal picasso (β-actin::EGFP+) → wild-type chimeras, we never found donor, picasso mutant metamorphic melanophores in the adult pigment pattern. These findings suggest both non-autonomous and autonomous roles for erbb3b in promoting adult pigment pattern development.

Fig. 6
Autonomous and non-autonomous roles for erbb3b in pigment pattern metamorphosis

Given that metamorphic melanophores express both erbb3b and erbb2, we sought to further test the role of ErbB signaling within this lineage. We reasoned that intrinsic differences between wild-type and erbb3b mutant melanophores could be further revealed as differences in their abilities to populate the flank in a background lacking endogenous melanophores. We therefore transplanted wild-type or picasso mutant cells to nacrew2 mutant hosts, which lack their own melanophores owing to a mutation in mitfa, a transcription factor required cell-autonomously in melanophore specification (Lister et al., 1999; Parichy and Turner, 2003a). In wild-type → nacre chimeras, embryonic/early larval melanophores often developed and metamorphic melanophores differentiated during the larva-to-adult transformation to form patches of stripes (Fig. 6D). In picassonacre chimeras, embryonic/early larval melanophores developed about as often, but metamorphic melanophores did not appear and, instead, embryonic/early larval melanophores persisted into the adult (Fig. 6E). These results suggest autonomous differences in the development of picasso mutant metamorphic melanophores compared to the wild-type. Interestingly, metamorphic melanophores failed to develop in picassonacre chimeras even in the furthest anterior and posterior regions of the flank, where metamorphic melanophores normally develop in picasso mutants; this difference may arise because the melanophore-free nacre background would preclude community effects from contributing to pattern regulation in these regions (Fig. 2) (Parichy et al., 2000b; Parichy and Turner, 2003b). Together, genetic mosaic analyses indicate that ErbB signals are required both autonomously and non-autonomously during metamorphic melanophore development.

ErbB activity is required during embryogenesis for metamorphic melanophore development

The adult pigment pattern defect of picasso mutant larvae could reflect erbb3b activities early or late in metamorphic melanophore development. For example, erbb3b could function early to establish a population of precursors that differentiates at metamorphosis. Or, erbb3b could act later in maintaining or expanding such a population, or still later, during differentiation into metamorphic melanophores. To distinguish among these possibilities, we blocked ErbB signaling at stages ranging from embryo to metamorphosing larva using two pharmacological inhibitors, AG1478 (Levitzki and Gazit, 1995; Lyons et al., 2005; Levitzki and Mishani, 2006) and PD158780 (Fry et al., 1997; Rewcastle et al., 1998; Frohnert et al., 2003). Preliminary analyses showed that treating wild-type embryos with either AG1478 or PD158780 resulted in an excess neuromast defect that phenocopies an excess neuromast defect of erbb3b mutants (data not shown)(Lyons et al., 2005). As both drugs inhibit kinase activity by interfering with ATP-binding sites, and wild-type ErbB3 already has impaired or absent kinase activity (Guy et al., 1994), inhibitor effects presumably reflect abrogation of signals associated with erbb3b:erbb2, erbb3:egfr or other heterodimers (see Introduction). By contrast, potential activities of these receptors that are independent of the kinase function should not be affected.

Wild-type embryos treated with AG1478 developed embryonic/early larval pigment patterns indistinguishable from wild-type and picasso mutants. When these same fish reached metamorphosis, however, they were markedly deficient for metamorphic melanophores: both pigment patterns and melanophore densities were indistinguishable from picasso mutants (Fig. 7B,E). By contrast, fish treated with AG1478 during the pre-metamorphic (early larval) period, or during metamorphosis, developed adult pigment patterns and melanophore densities indistinguishable from controls (Fig. 7A,C–E; but see below). Treatment of embryos with a structurally distinct ErbB inhibitor, PD158780, yielded identical results (Fig. 8 and data not shown).

Fig. 7
Embryonic requirement for ErbB signaling in pigment pattern metamorphosis
Fig 8
Treatment of embryos with ErbB inhibitor PD158780 results in adult pigment pattern defect similar to erbb3b null alleles

To test if this embryonic requirement for ErbB signaling is unique to zebrafish, we examined two more species (Quigley et al., 2004; Quigley et al., 2005). We chose D. albolineatus because its more uniform pigment pattern (Fig. 7F) might depend on mechanisms different than the stripes of zebrafish (Mills et al., 2007). Danio albolineatus embryos developed gross defects in metamorphic melanophores similar to D. rerio when treated with AG1478 (Fig. 7G) or PD158780 (data not shown). We also examined D. nigrofasciatus (Fig. 7H), in which few metamorphic melanophores develop and, instead, most embryonic/early larval melanophores persist and reorganize to form adult stripes (Quigley et al., 2004). If AG1478 effects are limited to metamorphic melanophores, then the D. nigrofasciatus pigment pattern should be relatively refractory to perturbation. Consistent with this prediction, D. nigrofasciatus embryos treated with AG1478 developed adult pigment pattern defects (Fig. 7I), but these defects were less severe than those we observed in zebrafish or D. albolineatus.

In mammalian systems in vitro, AG1478 is highly selective for EGFR-dependent signals and shows lesser effectiveness against other ErbB receptors (Levitzki and Gazit, 1995) whereas PD158780 is highly effective against all ErbB family members (Fry et al., 1997; Frohnert et al., 2003; Stonecypher et al., 2005). The specificity of these inhibitors for zebrafish, in vivo, is not known. While the similarity of adult pigment patterns between drug-treated fish and the picasso mutant is consistent with abrogation of erbb3b-dependent signals, we would expect these inihibitors to affect signaling through other ErbB receptors as well, particularly since protein tyrosine kinase domains are highly conserved between zebrafish and human orthologues (e.g., domain-specific identities, similarities: ErbB2, 84%, 92%; EGFR, 87%, 95%; ErbB3, 75%, 87%). We therefore repeated these experiments on picasso mutants: if signals independent of erbb3b are inhibited, we should see an enhancement of the picasso phenotype. When we treated sibling picassowp.r2e2 and picassowp.r2e2/+ embryos with AG1478 for the first 4 d of development, homozygotes unexpectedly developed edema and died by 7 dpf. The simplest explanation for this result is that a single functional allele of erbb3b is sufficient to protect against lethality due to AG1478 kinase-inhibition. This implies that erbb3b has activities that are independent of kinase activity (which is itself presumably mediated by erbb3b:erbb2 or erbb3b:egfr heterodimers). Consistent with this idea are results from several studies that have revealed kinase-independent activities of various receptor tyrosine kinases, including ErbB3 (Offterdinger et al., 2002; Rawls and Johnson, 2003; Massie and Mills, 2006; Hsu and Hung, 2007).

Given the preceding results, we treated embryos with ErbB inhibitors for shorter periods: wild-type embryos treated for only 2 dpf developed pigment patterns similar to wild-type embryos treated for 4 dpf (Fig. 9A,B); moreover, both picassowp.r2e2 and picassowp.r2e2/+ embryos treated for 2 dpf survived and developed pigment patterns indistinguishable from untreated picassowp.r2e2 controls (Fig. 9C,D; log-transformed melanophore densities: F1,25=2.46, P=0.13). We observed identical outcomes with PD158780 (data not shown). By comparison with the picassowp.r2e2 null phenotype, these data suggest that the drug effects we observed on adult pigment patterns were largely or exclusively mediated by abrogation of signals that depend on erbb3b.

Fig 9
ErbB inhibitor treatment for 48 hpf does not enhance the picasso null phenotype

Inhibitor effects support a model in which ErbB signals are required in embryos for adult pigment pattern formation. To further test the role of erbb3b specifically, we sought an independent means of blocking erbb3b activity. We reasoned that the limited perdurance of morpholino oligonucleotides (3−5 d) should allow us to knock-down erbb3b activity at early stages, while permitting later activity during metamorphosis (Nasevicius and Ekker, 2000; Mellgren and Johnson, 2004). We therefore injected single cell embryos with a morpholino oligonucleotide against erbb3b (Lyons et al., 2005) and raised these embryos into adults. Morpholino-injected fish showed defects qualitatively similar to picasso mutants (Fig. 7K).

Overall then, two independent lines of evidence show that erbb3b is required early for much later adult pigment pattern development. Specifically, the erbb3b mutant adult pigment pattern phenotype can be phenocopied in wild-type fish by: (i) embryonic knockdown of erbb3b by morpholino injection; and (ii) treating embryos with either of two pharmacological inhibitors that are specific to erbb3b-dependent signals (as evidenced by their failure to enhance the pigment pattern phenotype of an erbb3b presumptive null allele).

Adult pigment pattern requirement for ErbB activity during neural crest migration

The critical period for ErbB signaling elucidated above includes the time of neural crest migration. To further test for a coincidence with neural crest development, we treated embryos with ErbB inhibitors for shorter intervals. Preliminary analyses with wild-type revealed extensive variation in the severity of defects among individuals, perhaps due to stochastic differences in the extent of pattern regulation during metamorphosis (Parichy and Turner, 2003b; Yamaguchi et al., 2007). We therefore used a sensitized background, the kitb5 mutant, to reveal the early critical period more precisely. kit mutants lose embryonic/early larval melanophores and subsequently develop late metamorphic melanophores already in stripes. A defect in pattern regulation is indicated by a failure to regenerate normal fin pigment patterns after fin amputation (Johnson et al., 1995; Parichy et al., 1999; Rawls and Johnson, 2000).

We treated kit mutant embryos with ErbB inhibitors beginning between 8 hpf and 70 hpf for periods of 2 h to 26 h depending on the time of initiation. Such analyses across multiple independent experiments revealed peak sensitivities for adult pigment pattern formation between ~14−22 hpf, with affected individuals developing stripe defects reminiscent of picasso mutants (AG1478: Fig. 10A–C,E,F; PD158780: data not shown). Since adult pigment patterns were comparatively refractory to treatments after ~22 hpf, we asked whether extending the duration of treatment at later stages would enhance the frequency or severity of adult pattern defects. Treating embryos between 26−48 hpf did not significantly alter later phenotypes (Fig. 10F), consistent with an earlier critical period. Finally, because erbb3b, erbb2, and egfr are expressed as early as 8−11 hpf [(Goishi et al., 2003; Thisse and Thisse, 2004; Lyons et al., 2005); data not shown] we further tested whether ErbB signals might have reiterated activities by treating individual embryos with inhibitors at two different periods. When early treatments (8−11 hpf) were combined with later treatments (beginning ≥22 hpf), we observed more severe melanophore deficiencies in the adult pigment pattern, with defects extending further anteriorly and posteriorly than in the picasso mutant. Remarkably, treatments ≥8 h apart often resulted in spatially separated melanophore-deficient patches (e.g., Fig. 10D). The increased severity of these defects compared to those of embryos treated just once suggests early and late functions for ErbB signals: defects arising from early abrogation of ErbB kinase activity can presumably be regulated, provided ErbB function is allowed subsequently.

Fig. 10
kit mutant reveals critical period for ErbB activity during neural crest migration

The major critical period for ErbB signals defined above (~14−22 hpf) corresponds approximately to the time when neural crest cells are migrating at the axial levels affected in the picasso mutant (Raible et al., 1992; Vaglia and Hall, 2000). Therefore, we sought to explore the role of erbb3b specifically in the early patterning of neural crest-derived cells using molecular markers. In comparison with wild-type siblings, picasso mutant embryos at 26 hpf had similar numbers of cells expressing the pan-neural crest marker crestin, but these cells did not localize at sites of ganglion formation in the medial migratory pathway (between neural tube or notochord and somites) and were instead found further ventrally (Fig. 11A). We observed a similar patterning defect for cells expressing mitfa (Fig. 11B), identifying putative melanophore and xanthophore precursors (Lister et al., 1999; Parichy et al., 2000b). By contrast, we did not find clear defects in the distributions of committed dct+ melanoblasts (Fig. 11C) or cells in the lateral migratory pathway (between epidermis and somites), consistent with the normal patterning of picasso mutant embryonic/early larval melanophores. Finally, given the defects in ventromedial migrating cells described above, as well as defects in the peripheral nervous system of mammalian erbb3 and erbb2 mutants (Britsch et al. 1998; Britsch, 2007), we examined dorsal root and sympathetic ganglia by immunohistochemistry. We observed gross reductions in the numbers of dorsal root and sympathetic ganglia in picasso mutant larvae at 12 dpf (Fig. 11D), consistent with the findings of Honjo et al. (submitted). These data reveal an erbb3b-dependence of neural crest morphogenesis that correlates with the early erbb3b-dependence of adult pigment pattern formation.

Fig. 11
picasso mutant embryos have defects in neural crest morphogenesis

Sensitized genetic backgrounds reveal requirements for ErbB signals during metamorphosis

The preceding experiments demonstrated a critical period for ErbB signaling during embryogenesis. During later development, metamorphic melanophores express both erbb3b and erbb2 (Fig. 4C), but wild-type larvae treated with pharmacological inhibitors of ErbB signaling during metamorphosis failed to exhibit adult pigment pattern defects (Fig. 7C,E). Resistance at these stages could indicate redundancies between ErbB signals and other pathways, regulation in cell behaviors, poor penetration into tissues, or higher thresholds of inhibition for the salient processes, as compared to embryonic stages. Given these possibilities, we sought to further test roles for ErbB signals during metamorphosis. Since higher doses of inhibitors were lethal and so could not be tested for the durations required, we re-tested the ErbB-dependence of pigment pattern formation during metamorphosis using sensitized backgrounds: kit mutant and csf1rj4e1 mutant D. rerio; phenotypically wild-type, doubly heterozygous kit/+; csf1r/+ mutant D. rerio; and D. albolineatus. We chose these zebrafish mutants because previous analyses identified temporally and genetically distinct populations of metamorphic melanophores that are revealed by the kit and csf1r mutant phenotypes (Johnson et al., 1995; Parichy et al., 1999, 2000b). kit mutants are missing early metamorphic melanophores, but retain late metamorphic melanophores. Conversely, csf1r mutants retain early metamorphic melanophores, but are missing late metamorphic melanophores. Comparing further deficits in residual melanophores should therefore indicate whether one or the other metamorphic melanophore population exhibits a greater requirement for ErbB signaling. Finally, we also examined D. albolineatus because of the differences in melanophore development in this species compared to zebrafish, including fewer melanophores overall, increased frequency of melanophore death, and reduced melanophore migration (Quigley et al., 2005; Mills et al., 2007).

In each sensitized background, we observed moderate to severe reductions in metamorphic melanophore numbers upon treatment with AG1478 or PD158780 during metamorphosis (Fig. 12; 19−58% fewer melanophores than corresponding controls), changes that were considerably more severe than observed for wild-type larvae (Fig. 7E; 3% fewer melanophores than controls). Furthermore, kit mutant and csf1r mutant zebrafish exhibited similar reductions in residual melanophore numbers, suggesting that ErbB signals are required by precursors to both early and late metamorphic melanophores. Consistent with the specificity of these effects for erbb3b-dependent signals, the picassowp.r2e2 mutant pigment pattern defect was not enhanced under these conditions and kit mutants treated with AG1478 exhibited pigment patterns that fell within the range of severities observed for fish doubly mutant for kit and picassowp.r2e2 (data not shown). These data support a model in which ErbB signals are essential during embryogenesis but also function redundantly with other pathways during metamorphosis to promote adult pigment pattern development.

Fig. 12
Cryptic ErbB requirements during metamorphosis revealed by sensitized genetic backgrounds

DISCUSSION

We have identified a crucial role for ErbB signaling in danio adult pigment pattern development. While picasso mutants homozygous for erbb3b null alleles exhibit normal embryonic/early larval pigment patterns, they are grossly deficient for metamorphic melanophores of the adult pigment pattern. Unexpectedly, metamorphic melanophore precursors require ErbB signals during neural crest development, ~2 weeks before they begin to differentiate, and also exhibit a cryptic requirement for ErbB signals during pigment pattern metamorphosis. Genetic mosaic analyses further suggest complex modes by which ErbB signals promote adult pigment pattern formation, with effects that are both autonomous and non-autonomous to the metamorphic melanophore lineage.

The requirement for ErbB signals by glia is well documented (Riethmacher et al., 1997; Britsch et al., 1998; Lyons et al., 2005; Pogoda et al., 2006; Britsch, 2007), but roles in pigment cell development have remained obscure. Normal human melanocytes express EGFR, ErbB2, ErbB3, and ErbB4, and stimulation with ligand promotes migration in vitro (Gordon-Thomson et al., 2001; Stove et al., 2003; Gordon-Thomson et al., 2005; Mirmohammadsadegh et al., 2005). ErbB receptors also are expressed in melanoma cells and are associated with melanoma progression in a teleost model (Wellbrock et al., 2002; Gomez et al., 2004) and with human melanoma proliferation in vitro (Stove et al., 2003; Gordon-Thomson et al., 2005; Funes et al., 2006). Our finding that the picasso mutant phenotype results from lesions in erbb3b provides the first evidence that ErbB signals are required for pigment cell development in vivo.

Our analyses indicate that adult pigment pattern formation exhibits an early critical period for ErbB signaling. This conclusion is supported by effects of ErbB inhibitors on both wild-type and sensitized genetic backgrounds. While the specificities of pharmacological inhibitors are difficult to know with certainty, several lines of evidence suggest that effects in this study reflect inhibition of ErbB-dependent signals. First, we observed the same phenotypes with two inhibitors that are structurally distinct. Second, induced pigment pattern defects phenocopy mutants for erbb3b null alleles. Third, inhibitors failed to enhance pigment pattern defects of these erbb3b null alleles. Fourth, qualitatively similar pigment pattern defects resulted from knockdown of erbb3b via zygotic morpholino injection. While more definitive evidence will require the generation of conditional alleles that are beyond the scope of this study, our results do point to a model in which ErbB signals—depending in part on erbb3b—play an essential role during embryogenesis to promote much later adult pigment pattern formation.

This early critical period contrasts markedly with other genes involved in adult pigment pattern formation. For instance, analyses of temperature-sensitive csf1r and puma mutant alleles indicate critical periods during pigment pattern metamorphosis (Parichy and Turner, 2003a; Parichy et al., 2003). Likewise, studies of a temperature-sensitive kit allele during regeneration of the fin pigment pattern indicate a role during pattern formation, rather than prior to this time (Rawls and Johnson, 2001). The critical period for ErbB signals also may be earlier than that in mouse for Ednrb, which is required during melanoblast migration to the dermis, rather than during earlier neural crest dispersal (Shin et al., 1999). Nevertheless, even our analyses in a sensitized genetic background can suggest only a range of times: both drugs act very rapidly and in a quickly reversible manner (Fry et al., 1997; Lenferink et al., 2001; Levitzki and Mishani, 2006), but we do not know how long it takes for effective concentrations to reach beneath the epidermis, or to be cleared after embryos are transferred to inhibitor-free solution. The peak sensitivity observed for embryos treated between 14−22 hpf may thus indicate somewhat later critical periods in promoting adult pigment pattern formation, presumably during neural crest migration. Although we cannot absolutely exclude effects on earlier steps of neural crest specification, these appear somewhat less likely as treated fish did not exhibit gross defects typical of mutants affecting such processes (Nguyen et al., 1998; Dutton et al., 2001).

We can envisage at least two complementary modes by which embryonic ErbB signaling contributes to later metamorphic melanophore development. In the first mode, these signals would act autonomously to promote the early establishment of a precursor population that will subsequently generate metamorphic melanophores. This activity could be specific to metamorphic melanophores, if fate-restricted precursors exist this early in development, but the activity could equally well affect a broader range of neural crest derivatives. For example, both pigment cells and glia are thought to share a bipotent embryonic precursor (Dutton et al., 2001; Dupin and Le Douarin, 2003; Dupin et al., 2003), both can be generated by multipotent adult neural crest-derived stem cells in the skin (Sieber-Blum et al., 2004; Amoh et al., 2005; Wong et al., 2006), and both are affected by the erbb3b mutation and by ErbB inhibitor treatments. ErbB signals could have a direct role in establishing such precursors. Or, ErbB signals could serve to expand the population of multipotent neural crest cells, with regulation allowing for some neural crest derivatives to form apparently normally (Milos and Dingle, 1978; Raible and Eisen, 1994; Vaglia and Hall, 2000; Yang and Johnson, 2006). Such regulation could explain why the embryonic/early larval pigment pattern is normal in erbb3b mutants: if multipotent cells are allocated to fill a defined number of “embryonic/early larval niches”, before the filling of “metamorphic niches”, a depleted total number of cells could leave metamorphic niches vacant.

A second mode by which early ErbB signals could promote later adult pigment pattern formation is through activity that is non-autonomous to the metamorphic melanophore lineage. This could occur either if ErbB-expressing cells provide trophic support to metamorphic melanophore precursors, or if they contribute otherwise to a microenvironment where these precursors reside. Such interactions could be identical to, or in addition to, the non-autonomous mechanisms by which ErbB signals in glia promote neuronal survival and nerve integrity (Riethmacher et al., 1997; Chen et al., 2003; Sharghi-Namini et al., 2006). These observations raise the possibility that peripheral nerves or ganglia serve as niches for metamorphic melanophore precursors. Consistent with this idea is the early mispatterning of neural crest-derived cells that would form ganglia (this study); subsequent defects in dorsal root ganglia, sympathethetic ganglia, and other peripheral nerves, particularly at the axial levels with later pigment pattern defects (this study, Figs. 5A, 11D; Honjo et al., submitted); and the presence in other model organisms of multipotent neural crest-derived cells in peripheral nerves or ganglia that are able to produce melanocytes and other cell types (Nichols et al., 1977; Nichols and Weston, 1977; Ciment et al., 1986; Nataf and Le Douarin, 2000; Rizvi et al., 2002; Joseph et al., 2004). A more direct test of this idea in zebrafish will require both ablating these structures, which has not yet been possible owing to regeneration (Reyes et al., 2004)(unpublished data), and identifying very early markers of the metamorphic melanophore lineage.

Beyond the embryonic critical period for ErbB signals, our data also suggest a role during metamorphosis as treating sensitized backgrounds with either of two ErbB inhibitors resulted in melanophore deficiencies, albeit of differing magnitudes. As at embryonic stages, ErbB signals may act autonomously to metamorphic melanophores, consistent with their expression of erbb3b and erbb2. Non-autonomous roles also could be manifested if interactions among melanophores promote the survival, proliferation, or differentiation of these cells, consistent with community effects in other mutant backgrounds (Parichy et al., 2000b; Parichy and Turner, 2003b).

Together, our data support a model in which ErbB signals, mediated at least in part through erbb3b, are required during embryogenesis to establish a population of latent precursors that will subsequently generate metamorphic melanophores. Later, during metamorphosis, ErbB signals contribute to melanophore development but appear to be partly or entirely redundant with other pathways. Furthermore, our analyses show that both early-appearing, kit-dependent metamorphic melanophores, and later-appearing kit-independent (csf1r-dependent) metamorphic melanophores require ErbB signals. We speculate that erbb3b both promotes the development of latent precursors intrinsically and also is required extrinsically in forming a niche where they will reside until recruited to differentiate at metamorphosis.

ACKNOWLEDGEMENTS

Thanks to members of the Parichy lab for helpful discussions and for assistance with fish rearing, to Will Talbot's lab for complementation testing of picasso against erbb3b, and to Judith Eisen and Yasuko Hondo for sharing data prior to publication. Supported by NIH R01 GM62182 to D.M.P.

REFERENCES

  • Amoh Y, Li L, Katsuoka K, Penman S, Hoffman RM. Multipotent nestin-positive, keratin-negative hair-follicle bulge stem cells can form neurons. Proc Natl Acad Sci U S A. 2005;102:5530–4. [PMC free article] [PubMed]
  • Breuleux M. Role of heregulin in human cancer. Cell Mol Life Sci. 2007;64:2358–77. [PubMed]
  • Britsch S. The neuregulin-I/ErbB signaling system in development and disease. Adv Anat Embryol Cell Biol. 2007;190:1–65. [PubMed]
  • Britsch S, Li L, Kirchhoff S, Theuring F, Brinkmann V, Birchmeier C, Riethmacher D. The ErbB2 and ErbB3 receptors and their ligand, neuregulin-1, are essential for development of the sympathetic nervous system. Genes Dev. 1998;12:1825–36. [PMC free article] [PubMed]
  • Brosamle C, Halpern ME. Characterization of myelination in the developing zebrafish. Glia. 2002;39:47–57. [PubMed]
  • Brown DD. The role of thyroid hormone in zebrafish and axolotl development. Proc Natl Acad Sci U S A. 1997;94:13011–6. [PMC free article] [PubMed]
  • Brown DD, Cai L. Amphibian metamorphosis. Dev Biol. 2007;306:20–33. [PMC free article] [PubMed]
  • Bublil EM, Yarden Y. The EGF receptor family: spearheading a merger of signaling and therapeutics. Curr Opin Cell Biol. 2007;19:124–34. [PubMed]
  • Chen S, Rio C, Ji RR, Dikkes P, Coggeshall RE, Woolf CJ, Corfas G. Disruption of ErbB receptor signaling in adult non-myelinating Schwann cells causes progressive sensory loss. Nat Neurosci. 2003;6:1186–93. [PubMed]
  • Ciment G, Glimelius B, Nelson DM, Weston JA. Reversal of a developmental restriction in neural crest-derived cells of avian embryos by a phorbol ester drug. Dev Biol. 1986;118:392–8. [PubMed]
  • Citri A, Yarden Y. EGF-ERBB signalling: towards the systems level. Nat Rev Mol Cell Biol. 2006;7:505–16. [PubMed]
  • Clark CR, Taylor JD, Tchen TT. Purification of Black Moor goldfish melanophores and responses to epinephrine. In Vitro Cell Dev Biol. 1987;23:417–21. [PubMed]
  • Cubbage CC, Mabee PM. Development of the cranium and paired fins in the zebrafish Danio rerio (ostariophysi, Cyprinidae). J. Morphol. 1996;229:121–160.
  • Dupin E, Le Douarin NM. Development of melanocyte precursors from the vertebrate neural crest. Oncogene. 2003;22:3016–23. [PubMed]
  • Dupin E, Real C, Glavieux-Pardanaud C, Vaigot P, Le Douarin NM. Reversal of developmental restrictions in neural crest lineages: transition from Schwann cells to glial-melanocytic precursors in vitro. Proc Natl Acad Sci U S A. 2003;100:5229–33. [PMC free article] [PubMed]
  • Dutton KA, Pauliny A, Lopes SS, Elworthy S, Carney TJ, Rauch J, Geisler R, Haffter P, Kelsh RN. Zebrafish colourless encodes sox10 and specifies non-ectomesenchymal neural crest fates. Development. 2001;128:4113–25. [PubMed]
  • Elizondo MR, Arduini BL, Paulsen J, MacDonald EL, Sabel JL, Henion PD, Cornell RA, Parichy DM. Defective skeletogenesis with kidney stone formation in dwarf zebrafish mutant for trpm7. Curr Biol. 2005;15:667–71. [PubMed]
  • Engeszer RE, Alberici da Barbiano L, Ryan MJ, Parichy DM. Timing and plasticity of shoaling behaviour in the zebrafish, Danio rerio. Animal Behaviour. 2007 In press, doi:10.1016/j.anbehav.2007.01.032. [PMC free article] [PubMed]
  • Frohnert PW, Stonecypher MS, Carroll SL. Constitutive activation of the neuregulin-1/ErbB receptor signaling pathway is essential for the proliferation of a neoplastic Schwann cell line. Glia. 2003;43:104–18. [PubMed]
  • Frolov A, Schuller K, Tzeng CW, Cannon EE, Ku BC, Howard JH, Vickers SM, Heslin MJ, Buchsbaum DJ, Arnoletti JP. ErbB3 expression and dimerization with EGFR influence pancreatic cancer cell sensitivity to erlotinib. Cancer Biol Ther. 2007;6:548–54. [PubMed]
  • Fry DW, Nelson JM, Slintak V, Keller PR, Rewcastle GW, Denny WA, Zhou H, Bridges AJ. Biochemical and antiproliferative properties of 4-[ar(alk)ylamino]pyridopyrimidines, a new chemical class of potent and specific epidermal growth factor receptor tyrosine kinase inhibitor. Biochem Pharmacol. 1997;54:877–87. [PubMed]
  • Funes M, Miller JK, Lai C, Carraway KL, 3rd, Sweeney C. The mucin Muc4 potentiates neuregulin signaling by increasing the cell-surface populations of ErbB2 and ErbB3. J Biol Chem. 2006;281:19310–9. [PubMed]
  • Gilmour DT, Maischein HM, Nusslein-Volhard C. Migration and function of a glial subtype in the vertebrate peripheral nervous system. Neuron. 2002;34:577–88. [PubMed]
  • Goishi K, Lee P, Davidson AJ, Nishi E, Zon LI, Klagsbrun M. Inhibition of zebrafish epidermal growth factor receptor activity results in cardiovascular defects. Mech Dev. 2003;120:811–22. [PubMed]
  • Gomez A, Volff JN, Hornung U, Schartl M, Wellbrock C. Identification of a second egfr gene in Xiphophorus uncovers an expansion of the epidermal growth factor receptor family in fish. Mol Biol Evol. 2004;21:266–75. [PubMed]
  • Gordon-Thomson C, Jones J, Mason RS, Moore GP. ErbB receptors mediate both migratory and proliferative activities in human melanocytes and melanoma cells. Melanoma Res. 2005;15:21–8. [PubMed]
  • Gordon-Thomson C, Mason RS, Moore GP. Regulation of epidermal growth factor receptor expression in human melanocytes. Exp Dermatol. 2001;10:321–8. [PubMed]
  • Graus-Porta D, Beerli RR, Daly JM, Hynes NE. ErbB-2, the preferred heterodimerization partner of all ErbB receptors, is a mediator of lateral signaling. Embo J. 1997;16:1647–55. [PMC free article] [PubMed]
  • Guy PM, Platko JV, Cantley LC, Cerione RA, Carraway KL., 3rd Insect cell-expressed p180erbB3 possesses an impaired tyrosine kinase activity. Proc Natl Acad Sci U S A. 1994;91:8132–6. [PMC free article] [PubMed]
  • Henion PD, Raible DW, Beattie CE, Stoesser KL, Weston JA, Eisen JS. Screen for mutations affecting development of Zebrafish neural crest. Dev Genet. 1996;18:11–7. [PubMed]
  • Honjo Y, Kniss J, Eisen JS. Neuregulin-mediated ErbB3 signaling is required for formation of zebrafish dorsal root ganglion neurons. Development. submitted. [PMC free article] [PubMed]
  • Hsu SC, Hung MC. Characterization of a novel tripartite nuclear localization sequence in the EGFR family. J Biol Chem. 2007;282:10432–40. [PubMed]
  • Iwashita M, Watanabe M, Ishii M, Chen T, Johnson SL, Kurachi Y, Okada N, Kondo S. Pigment pattern in jaguar/obelix zebrafish is caused by a Kir7.1 mutation: Implications for the regulation of melanosome movement. Plos Genetics. 2006;2:1861–1870. [PMC free article] [PubMed]
  • Johnson SL, Africa D, Walker C, Weston JA. Genetic control of adult pigment stripe development in zebrafish. Dev. Biol. 1995;167:27–33. [PubMed]
  • Jones JT, Akita RW, Sliwkowski MX. Binding specificities and affinities of egf domains for ErbB receptors. FEBS Lett. 1999;447:227–31. [PubMed]
  • Joseph NM, Mukouyama YS, Mosher JT, Jaegle M, Crone SA, Dormand EL, Lee KF, Meijer D, Anderson DJ, Morrison SJ. Neural crest stem cells undergo multilineage differentiation in developing peripheral nerves to generate endoneurial fibroblasts in addition to Schwann cells. Development. 2004;131:5599–612. [PMC free article] [PubMed]
  • Kelsh RN. Genetics and evolution of pigment patterns in fish. Pigment Cell Res. 2004;17:326–36. [PubMed]
  • Kelsh RN, Schmid B, Eisen JS. Genetic analysis of melanophore development in zebrafish embryos. Dev Biol. 2000;225:277–93. [PubMed]
  • Lamason RL, Mohideen MA, Mest JR, Wong AC, Norton HL, Aros MC, Jurynec MJ, Mao X, Humphreville VR, Humbert JE, et al. SLC24A5, a putative cation exchanger, affects pigmentation in zebrafish and humans. Science. 2005;310:1782–6. [PubMed]
  • Lenferink AE, Busse D, Flanagan WM, Yakes FM, Arteaga CL. ErbB2/neu kinase modulates cellular p27(Kip1) and cyclin D1 through multiple signaling pathways. Cancer Res. 2001;61:6583–91. [PubMed]
  • Levitzki A, Gazit A. Tyrosine kinase inhibition: an approach to drug development. Science. 1995;267:1782–8. [PubMed]
  • Levitzki A, Mishani E. Tyrphostins and other tyrosine kinase inhibitors. Annu Rev Biochem. 2006;75:93–109. [PubMed]
  • Linggi B, Carpenter G. ErbB receptors: new insights on mechanisms and biology. Trends Cell Biol. 2006;16:649–56. [PubMed]
  • Lister JA, Robertson CP, Lepage T, Johnson SL, Raible DW. nacre encodes a zebrafish microphthalmia-related protein that regulates neural-crest-derived pigment cell fate. Development. 1999;126:3757–67. [PubMed]
  • Luo R, An M, Arduini BL, Henion PD. Specific pan-neural crest expression of zebrafish Crestin throughout embryonic development. Dev Dyn. 2001;220:169–74. [PubMed]
  • Lyons DA, Pogoda HM, Voas MG, Woods IG, Diamond B, Nix R, Arana N, Jacobs J, Talbot WS. erbb3 and erbb2 are essential for schwann cell migration and myelination in zebrafish. Curr Biol. 2005;15:513–24. [PubMed]
  • Marusich MF, Furneaux HM, Henion PD, Weston JA. Hu neuronal proteins are expressed in proliferating neurogenic cells. J Neurobiol. 1994;25:143–55. [PubMed]
  • Massie C, Mills IG. The developing role of receptors and adaptors. Nat Rev Cancer. 2006;6:403–9. [PubMed]
  • Mellgren EM, Johnson SL. A requirement for kit in embryonic zebrafish melanocyte differentiation is revealed by melanoblast delay. Dev Genes Evol. 2004;214:493–502. [PubMed]
  • Mills MG, Nuckels RJ, Parichy DM. Deconstructing evolution of adult phenotypes: genetic analyses of kit reveal homology and evolutionary novelty during adult pigment pattern development of Danio fishes. Development. 2007;134:1081–90. [PubMed]
  • Milos N, Dingle AD. Dynamics of pigment pattern formation in the zebrafish, Brachydanio rerio. II. Lability of lateral line stripe formation and regulation of pattern defects. J. exp. Zool. 1978;205:217–224.
  • Mirmohammadsadegh A, Hassan M, Gustrau A, Doroudi R, Schmittner N, Nambiar S, Tannapfel A, Ruzicka T, Hengge UR. Constitutive expression of epidermal growth factor receptors on normal human melanocytes. J Invest Dermatol. 2005;125:392–4. [PubMed]
  • Moran NA. Adaptation and constraint in the complex life cycles of animals. Ann. Rev. Ecol. Syst. 1994;25:573–600.
  • Nasevicius A, Ekker SC. Effective targeted gene ‘knockdown’ in zebrafish. Nat Genet. 2000;26:216–20. [PubMed]
  • Nataf V, Le Douarin NM. Induction of melanogenesis by tetradecanoylphorbol-13 acetate and endothelin 3 in embryonic avian peripheral nerve cultures. Pigment Cell Res. 2000;13:172–8. [PubMed]
  • Nguyen VH, Schmid B, Trout J, Connors SA, Ekker M, Mullins MC. Ventral and lateral regions of the zebrafish gastrula, including the neural crest progenitors, are established by a bmp2b/swirl pathway of genes. Dev Biol. 1998;199:93–110. [PubMed]
  • Nichols DH, Kaplan RA, Weston JA. Melanogenesis in cultures of peripheral nervous tissue. II. Environmental factors determining the fate of pigment-forming cells. Dev Biol. 1977;60:226–37. [PubMed]
  • Nichols DH, Weston JA. Melanogenesis in cultures of peripheral nervous tissue. I. The origin and prospective fate of cells giving rise to melanocytes. Dev Biol. 1977;60:217–25. [PubMed]
  • Oda K, Matsuoka Y, Funahashi A, Kitano H. A comprehensive pathway map of epidermal growth factor receptor signaling. Mol Syst Biol. 2005;1:0010. 2005. [PMC free article] [PubMed]
  • Offterdinger M, Schofer C, Weipoltshammer K, Grunt TW. c-erbB-3: a nuclear protein in mammary epithelial cells. J Cell Biol. 2002;157:929–39. [PMC free article] [PubMed]
  • Parichy DM. Experimental analysis of character coupling across a complex life cycle: pigment pattern metamorphosis in the tiger salamander, Ambystoma tigrinum tigrinum. J Morphol. 1998;237:53–67. [PubMed]
  • Parichy DM, Mellgren EM, Rawls JF, Lopes SS, Kelsh RN, Johnson SL. Mutational analysis of endothelin receptor b1 (rose) during neural crest and pigment pattern development in the zebrafish Danio rerio. Dev Biol. 2000a;227:294–306. [PubMed]
  • Parichy DM, Ransom DG, Paw B, Zon LI, Johnson SL. An orthologue of the kit-related gene fms is required for development of neural crest-derived xanthophores and a subpopulation of adult melanocytes in the zebrafish, Danio rerio. Development. 2000b;127:3031–44. [PubMed]
  • Parichy DM, Rawls JF, Pratt SJ, Whitfield TT, Johnson SL. Zebrafish sparse corresponds to an orthologue of c-kit and is required for the morphogenesis of a subpopulation of melanocytes, but is not essential for hematopoiesis or primordial germ cell development. Development. 1999;126:3425–36. [PubMed]
  • Parichy DM, Turner JM. Temporal and cellular requirements for Fms signaling during zebrafish adult pigment pattern development. Development. 2003a;130:817–33. [PubMed]
  • Parichy DM, Turner JM. Zebrafish puma mutant decouples pigment pattern and somatic metamorphosis. Dev Biol. 2003b;256:242–57. [PubMed]
  • Parichy DM, Turner JM, Parker NB. Essential role for puma in development of postembryonic neural crest-derived cell lineages in zebrafish. Dev Biol. 2003;256:221–41. [PubMed]
  • Pogoda HM, Sternheim N, Lyons DA, Diamond B, Hawkins TA, Woods IG, Bhatt DH, Franzini-Armstrong C, Dominguez C, Arana N, et al. A genetic screen identifies genes essential for development of myelinated axons in zebrafish. Dev Biol. 2006;298:118–31. [PubMed]
  • Poumay YG. The dumb ErbB receptor helps healing. J Invest Dermatol. 2007;127:995–7. [PubMed]
  • Quigley IK, Manuel JL, Roberts RA, Nuckels RJ, Herrington ER, Macdonald EL, Parichy DM. Evolutionary diversification of pigment pattern in Danio fishes: differential fms dependence and stripe loss in D. albolineatus. Development. 2005;132:89–104. [PubMed]
  • Quigley IK, Turner JM, Nuckels RJ, Manuel JL, Budi EH, Macdonald EL, Parichy DM. Pigment pattern evolution by differential deployment of neural crest and post-embryonic melanophore lineages in Danio fishes. Development. 2004;131:6053–6069. [PubMed]
  • Raible DW, Eisen JS. Restriction of neural crest cell fate in the trunk of the embryonic zebrafish. Development. 1994;120:495–503. [PubMed]
  • Raible DW, Wood A, Hodsdon W, Henion PD, Weston JA, Eisen JS. Segregation and early dispersal of neural crest cells in the embryonic zebrafish. Dev Dyn. 1992;195:29–42. [PubMed]
  • Rawls JF, Johnson SL. Zebrafish kit mutation reveals primary and secondary regulation of melanocyte development during fin stripe regeneration. Development. 2000;127:3715–3724. [PubMed]
  • Rawls JF, Johnson SL. Requirements for the kit receptor tyrosine kinase during regeneration of zebrafish fin melanocytes. Development. 2001;128:1943–9. [PubMed]
  • Rawls JF, Johnson SL. Temporal and molecular separation of the kit receptor tyrosine kinase's roles in zebrafish melanocyte migration and survival. Dev Biol. 2003;262:152–61. [PubMed]
  • Rewcastle GW, Murray DK, Elliott WL, Fry DW, Howard CT, Nelson JM, Roberts BJ, Vincent PW, Showalter HD, Winters RT, et al. Tyrosine kinase inhibitors. 14. Structure-activity relationships for methylamino-substituted derivatives of 4-[(3-bromophenyl)amino]-6-(methylamino)-pyrido[3,4-d]pyrimidine (PD 158780), a potent and specific inhibitor of the tyrosine kinase activity of receptors for the EGF family of growth factors. J Med Chem. 1998;41:742–51. [PubMed]
  • Reyes R, Haendel M, Grant D, Melancon E, Eisen JS. Slow degeneration of zebrafish Rohon-Beard neurons during programmed cell death. Dev Dyn. 2004;229:30–41. [PubMed]
  • Riethmacher D, Sonnenberg-Riethmacher E, Brinkmann V, Yamaai T, Lewin GR, Birchmeier C. Severe neuropathies in mice with targeted mutations in the ErbB3 receptor. Nature. 1997;389:725–30. [PubMed]
  • Rizvi TA, Huang Y, Sidani A, Atit R, Largaespada DA, Boissy RE, Ratner N. A novel cytokine pathway suppresses glial cell melanogenesis after injury to adult nerve. J Neurosci. 2002;22:9831–40. [PMC free article] [PubMed]
  • Sergina NV, Moasser MM. The HER family and cancer: emerging molecular mechanisms and therapeutic targets. Trends Mol Med. 2007 [PMC free article] [PubMed]
  • Sharghi-Namini S, Turmaine M, Meier C, Sahni V, Umehara F, Jessen KR, Mirsky R. The structural and functional integrity of peripheral nerves depends on the glial-derived signal desert hedgehog. J Neurosci. 2006;26:6364–76. [PubMed]
  • Shin MK, Levorse JM, Ingram RS, Tilghman SM. The temporal requirement for endothelin receptor-B signalling during neural crest development. Nature. 1999;402:496–501. [PubMed]
  • Sieber-Blum M, Grim M, Hu YF, Szeder V. Pluripotent neural crest stem cells in the adult hair follicle. Dev Dyn. 2004;231:258–69. [PubMed]
  • Soltoff SP, Carraway KL, 3rd, Prigent SA, Gullick WG, Cantley LC. ErbB3 is involved in activation of phosphatidylinositol 3-kinase by epidermal growth factor. Mol Cell Biol. 1994;14:3550–8. [PMC free article] [PubMed]
  • Stein RA, Staros JV. Insights into the evolution of the ErbB receptor family and their ligands from sequence analysis. BMC Evol Biol. 2006;6:79. [PMC free article] [PubMed]
  • Stonecypher MS, Byer SJ, Grizzle WE, Carroll SL. Activation of the neuregulin-1/ErbB signaling pathway promotes the proliferation of neoplastic Schwann cells in human malignant peripheral nerve sheath tumors. Oncogene. 2005;24:5589–605. [PubMed]
  • Stove C, Stove V, Derycke L, Van Marck V, Mareel M, Bracke M. The heregulin/human epidermal growth factor receptor as a new growth factor system in melanoma with multiple ways of deregulation. J Invest Dermatol. 2003;121:802–12. [PubMed]
  • Thisse B, Thisse C. Fast release clones: a high throughput expression analysis. ZFIN Direct Data Submission. 2004. ( http://zfin.org)
  • Tingaud-Sequeira A, Forgue J, Andre M, Babin PJ. Epidermal transient down-regulation of retinol-binding protein 4 and mirror expression of apolipoprotein Eb and estrogen receptor 2a during zebrafish fin and scale development. Dev Dyn. 2006;235:3071–9. [PubMed]
  • Vaglia JL, Hall BK. Patterns of migration and regulation of trunk neural crest cells in zebrafish (Danio rerio). Int J Dev Biol. 2000;44:867–81. [PubMed]
  • Watanabe M, Iwashita M, Ishii M, Kurachi Y, Kawakami A, Kondo S, Okada N. Spot pattern of leopard Danio is caused by mutation in the zebrafish connexin41.8 gene. EMBO Rep. 2006 [PMC free article] [PubMed]
  • Webb JF. In: Larvae in fish development and evolution. Hall BK, Wake MH, editors. Academic Press; New York, NY: 1999. pp. 109–158.
  • Wellbrock C, Gomez A, Schartl M. Melanoma development and pigment cell transformation in xiphophorus. Microsc Res Tech. 2002;58:456–63. [PubMed]
  • Westerfield M. The Zebrafish Book. A Guide for the Laboratory Use of Zebrafish (Danio rerio). 4th ed. University of Oregon Press; Eugene, Oregon: 2000.
  • Wong CE, Paratore C, Dours-Zimmermann MT, Rochat A, Pietri T, Suter U, Zimmermann DR, Dufour S, Thiery JP, Meijer D, et al. Neural crest-derived cells with stem cell features can be traced back to multiple lineages in the adult skin. J Cell Biol. 2006;175:1005–15. [PMC free article] [PubMed]
  • Yamaguchi M, Yoshimoto E, Kondo S. Pattern regulation in the stripe of zebrafish suggests an underlying dynamic and autonomous mechanism. Proc Natl Acad Sci U S A. 2007;104:4790–3. [PMC free article] [PubMed]
  • Yang CT, Johnson SL. Small molecule-induced ablation and subsequent regeneration of larval zebrafish melanocytes. Development. 2006;133:3563–73. [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

  • Gene
    Gene
    Gene links
  • Gene (nucleotide)
    Gene (nucleotide)
    Records in Gene identified from shared sequence links
  • GEO Profiles
    GEO Profiles
    Related GEO records
  • HomoloGene
    HomoloGene
    HomoloGene links
  • MedGen
    MedGen
    Related information in MedGen
  • Nucleotide
    Nucleotide
    Published Nucleotide sequences
  • Pathways + GO
    Pathways + GO
    Pathways, annotations and biological systems (BioSystems) that cite the current article.
  • Protein
    Protein
    Published protein sequences
  • PubMed
    PubMed
    PubMed citations for these articles

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...