![]() | ![]() |
Formats:
|
||||||||||
DNA-binding transcription factor NF-1A negatively regulates JC virus multiplication Laboratory of Molecular Medicine and Neuroscience, National Institute of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, MD 20892, USA Correspondence: Eugene O. Major, Email: majorg/at/ninds.nih.gov The publisher's final edited version of this article is available free at J Gen Virol. See other articles in PMC that cite the published article.Abstract JC virus (JCV) DNA replication occurs in the nuclei of infected cells. The level of JCV genome expression depends on nucleotide sequences in the viral regulatory region and their interaction with host-cell nuclear transcription factors. Our previous studies showed a higher level of NF-1X in JCV-permissive cells compared with the other members of the NF-1 family, NF-1A, B and C, which suggests that NF-1X plays a positive role in JCV multiplication, It remained unclear whether a reduction in the level of NF-1 A, which is expressed abundantly in JCV-non-permissive cell types, leads to an increase in JCV multiplication. In this study, we show that downregulation of NF-1A expression in JCV-non-susceptible progenitor and HeLa cells results in a reversion to susceplibitity for JCV multiplication. These data demonstrate that a higher level of NF-1A protein in JCV-non-permissive cell types, compared with the level of NF-1X, may be acting as a negative regulator at the JCV promoter to control JCV multiplication. The human polyomavirus JC virus (JCV) is responsible for central nervous system (CNS) demyelination leading to progressive multifocal leukoencephalopathy (PML) (Astrom et al, 1958). Serological studies suggest that approximately 70 % of the adult population worldwide have experienced primary JCV infection (Walker & Padgett, 1983; Hamilton et al, 2000). PML almost invariably follows from reactivation of latent JCV in patients with compromised cellular immunity (Berger & Major, 1999), particularly in patients with HIV/AIDS, but also occurs in those with leukaemia, lymphoma and connective tissue diseases. Individuals that receive immunomodulatory therapy for autoimmune disorders may also develop PML (Yousry et al, 2006). The molecular regulation of JCV expression limits the range of cell types that can serve as sites of JCV latency and reactivation (Imperiale & Major, 2007). The cellular host range of JCV depends upon a number of factors: attachment of the virus on a host cell, virus internalization and transport, uncoating and delivery of the viral genome, viral DNA transcription, viral protein propagation, virus assembly and virus release. Nuclear transcription factors, which play fundamental roles in regulating JCV multiplication, exist at the centre of these molecular pathways. Host-cell nuclear transcription factors are required for the activation of the JCV promoter/enhancer (Nathanson et al, 1997; Raj & Khalili, 1995), Nucleotide sequences that act as transcriptional promoters are located immediately upstream of the origin of DNA replication (Delbue et al., 2005; Nathanson et al, 1997). These sequences include the TATA box and binding sites for Sp1, YB1, sup2> Pur-α and NF-1. The NF-1 site is directly adjacent to an AP-I or c-jun/c-fos site (Ciappi et al., 1999; Ravichandran et al., 2006). The nuclear transcription factor recognition sites are duplicated in the tandem repeat arrangement found in JCV isolates that support viral expression in permissible cells (Delbue et al, 2005). These transcription factors are required for activation of the JCV promoter/enhancer. Cell-specific expression of JCV has been associated with several transcription factors, but the mechanisms through which the JCV promoter is controlled by these transcription factors are poorly understood. The nuclear transcription factor NF-1 is an example of a cell-specific regulator of JCV promoter/enhancer activity (Chen & Khalili, 1995). The NF-1 transcription family of DNA-binding proteins (NF-1A, NF-1B, NF-1C and NF-1X) is encoded by four genes (Gronostajski, 2000; Kruse et al., 1991; Kruse & Sippel, 1994; Sumner et al., 1996). Many NF-1-binding sites are found in the JCV promoter/enhancer region (Amemiya et al., 1992; Ciappi et al., 1999; Jeang et al., 1987; Tamura et al., 1988). Products of the four NF-1 genes form homo- and heterodimers that bind to the canonical NF-1-binding site with apparently identical affinities (Gronostajski, 2000). Mutations in the NF-1-binding sites reduce JCV expression (Amemiya et al., 1989). We have shown previously that the level of expression of NF-1 proteins differs in JCV-permissive and -non-permissive cells (Messam et al., 2003). Human progenitor-derived astrocyte cells that support JCV infection expressed high levels of NF-1X when compared with the non-permissive cell line HeLa. JCV-susceptible cells showed higher levels of NF-1X and lower levels of NF-1A compared with JCV-non-susceptible cells. While all NF-1 proteins appear to bind to the same DNA sequence, differences in function among NF-1 gene products have been observed in a number of systems. The promoters of several genes were shown to be activated by NF-1 proteins (Bisgrove et al., 2000; Jones et al., 1987; Shaul et al., 1986). Genes that are negatively regulated by NF-1 also exist (Fazi et al., 2005; Kleene et al., 2001; Wong et al., 2007). Since NF-1A is shown to function as a negative regulator of many genes, the current study aims to determine whether higher levels of NF-1A expressed in JCV-non-susceptible cells act as a negative regulator for JCV multiplication. We used different techniques to decrease the level of NF-1A in JCV-non-susceptible cell types and observed an increase in JCV multiplication. This indicates an essential negative regulatory role of NF-1A in JCV tropism. Human brain-derived progenitor cells (referred to here as progenitors) were obtained from the telencephalon of an 8-week gestational fetal brain, in accordance with NIH guidelines as described previously (Messam et al., 2003). Progenitor cultures grown at 10–40% confluence were at least 98% positive for nestin staining and did not express glial fibrillary acidic protein (GFAP). Differentiation of progenitors into an astrocytic lineage (referred to as progenitor-derived astrocytes; PDA) was initiated by culture medium substitution as described before (Messam & Major, 2000). HeLa cells were grown with MEM supplemented with 10% fetal bovine serum. For induction of TGF-β1 signalling, cultures were treated with 5 ng recombinant TGF-β1 ml−1 (R&D Systems), Progenitor, PDA or HeLa cultures were exposed to JCV (Mad-4 variant) at 100 haemagglutination units (HAU) per 5 × 105 cells in a minimal covering of appropriate serum-free medium. After overnight JCV exposure, cultures were washed and replenished with appropriate fresh media. All JCV-exposed cultures were processed 4 days after JCV exposure. siRNA against NF-1A or NF-1B (Dharmacon) or control siRNA (SantaCruz) (final concentration of 10 nM) was used to transfect cells using appropriate nucleofector reagents (Amaxa, Inc.). Human miR-223 (hsa-miR-223; Dharmacon) was transfected into progenitor cells (final concentration 10 nM) using nucleofector reagent (Amaxa, Inc.). At 16 h post-transfection, the culture medium was replaced with fresh medium containing JCV at 100 HAU per 5 × 105 cells. After 8 h of JCV exposure, viral medium was removed by aspiration, the cells were washed once and fresh medium was added. Four days after the transfection (3 days after JCV exposure), nuclear fractions or whole-cell lysates were prepared for use in Western blot experiments with appropriate antibodies as described before (Ravichandran et al., 2007). The antibodies used were: anti-JCV-VP-1 (rabbit polyclonal antibody developed in our laboratory), anti-JVC-VP-1 (monoclonal; Novocastra), anti-SV40 T-antigen (Oncogene), anti-β-actin (Sigma), anti-NF-1A (Geneka/Active Motif). anti-NF-1B (Geneka/Active Motif) and anti-NF-1X (Geneka/Active Motif). Bound primary antibodies were detected using either an anti-rabbit or anti-mouse horseradish peroxidase-conjugated secondary antibody combined with the SuperSignal West Pico Chemiluminescent substrate kit (Pierce), according to the manufacturer’s protocol. RT-PCR was performed as follows. Four days after the transfection of miR-223 into progenitor cells, total RNA was isolated using the RNeasy total RNA isolation system (Qiagen) followed by treatment for 60 min with DNase I [10 U (μg RNA)−1; Boehringer Mannheim], First-strand cDNA synthesis was performed on 1 μg total RNA using oligo dT primers and Superscript II reverse transcriptase (Invitrogen). cDNA product (2 μl) served as the template for specific PCR amplification. The PCR primers for NFI-A were 5′-GTCAGCTTCACTTGGCTGGC (5′ primer) and 5′-AGCTTTATCTTTCCGTAACTTGGCCCGGATATCAAGGCCAAGTTACGGAAAGATATCG (3′ primer). PCR amplification consisted of 30 cycles of 30 s at 95 °C, 30 s at 55 °C and 1 min at 72 °C using a Perkin-Elmer 2400 thermal cycler. PCR products (20 μl) were subjected to 1.5% agarose gel electrophoresis, stained with ethidium bromide and photographed. Four days after the transfection of miR-223 into progenitor cells (3 days after JCV exposure) or 4 days after treatments with or without TGF-β1, HeLa cells grown with JCV on chamber slides were fixed with 4 % paraformaldehyde in PBS for 20 min at room temperature and permeabilized with 0.2% Triton in PBS for 10 min at room temperature. Blocking, probing and visualization were done as described previously (Ravichandran et al., 2007). Because of the differentiation of JCV-non-susceptible progenitors into JCV-susceptible PDAs, we examined the role of NF-1 protein levels in these cell types. Differentiation of progenitor cells into PDA was accompanied by a gradual increase in the level of NF-1X. Notably, levels of NF-1A and NF-1B decreased (Fig. 1a
The abundance of NF-1A and NF-1B in progenitor cells as well as other JCV-non-susceptible cells (i.e. HeLa cells, progenitor-derived neurons) raised the possibility of a negative regulatory role of NF-1A and NF-1B in these cell types. An earlier study showed that, following the addition of TGF-β1, JCV multiplication increased (Ravichandran et al., 2007). As an extension of this observation, we also observed a decrease in NF-1A and NF-1B levels under these conditions in progenitor ceils (Fig. 1b To examine the negative role of NF-1A in JCV multiplication, another JCV-non-susceptible cell type, HeLa, was studied. Addition of TGF-β1 to HeLa in the presence of JCV showed increased JCV multiplication, as observed by increased VP-1 protein in immunofluorescence experiments (Fig. 2a
The molecular regulation of JCV expression limits the range of cell types that can serve as sites of JCV latency, reactivation and virion multiplication (Messam et al, 2003). The range of cells that support JCV expression is controlled, at least in part, by nucleotide sequences present in the viral promoter/enhancer (Amemiya et al, 1992). While the JCV promoter contains binding sites for many nuclear transcription factors, the NF-1-binding site has shown to be critical for JCV multiplication (Amemiya et al., 1992). Many JCV-susceptible cells showed higher levels of NF-1X protein expression, which implies the positive activation of JCV genes by NF-1X. Our observation of higher levels of expression of NF-1A protein in JCV-non-susceptible cells prompted us to manipulate NF-1A protein levels and to observe that a reduction in the level of NF-1A protein led to an increase in JCV multiplication. Even though the four NF-1 genes are expressed in broadly overlapping patterns in different cell types, there are apparently unique mechanisms for expression of individual members of the NF-1 family. Since all NF-1 proteins bind to the same DNA binding region but differ in their promoter-specific activation and repression of transcription, the association of NF-1 proteins with the JCV DNA may be proportionate to the availability of an individual member of the NF-1 family. Our study shows that NF-1A and NF-1B proteins are abundant in JCV-non-susceptible progenitor cells. During the differentiation into JCV-susceptible PDA, the levels of NF-1A and NF-1B protein decreased significantly. Also, our anchored-JCV-promoter assay using the progenitor and PDA nuclear extract showed association of NF-1A, NF-1B or NF-1X in proportion to the level of protein (not shown). Hence, we assumed that binding of NF-1A or NF-1B from the (JCV-non-susceptible) progenitor cells at the JCV promoter might act as a transcriptional repressor of JCV-encoded gene expression. This is confirmed by our results, which also indicate that a reduction of the level of NF-1A protein in progenitor cells leads to susceptibility to JCV multiplication. Further, to extend an earlier report that TGF-β1 increased JCV multiplication in progenitor cells, we observed a decrease in NF-1A levels after TGF-β1 treatment. There was, however, no increase in the level of NF-1X protein. Since the reduction of the level of NF-1A protein by siRNA led to an increase in NF-1B protein as well as JCV susceptibility, a proactive role of NF-1B was considered. However, a reduction of the level of NF-1B protein by siRNA was also associated with an increase in NF-1A and a subsequent decrease in JCV susceptibility. To overcome this reciprocal effect, we transfected progenitor cells with NF-IB-encoding plasmids, and found that overexpression of NF-1B protein did not lead to JCV multiplication (not shown). The reduction of levels of NF-1A protein during the differentiation of progenitor into PDA that leads to JCV susceptibility suggests that progenitor cells, with higher levels of NF-1A, experience a negative regulatory effect of NF-1A on JCV gene transcription. The promoters of several genes have been shown to be positively or negatively regulated by NF-1 protein; in particular, NF-1A-mediated transcriptional suppression of many genes has been reported (Wong et al, 2007). Furthermore, HeLa cells, which do not show JCV susceptibility, also express higher levels of NF-1 A protein. Significantly, the addition of TGF-β1 resulted in JCV activity in HeLa cells, which do not normally support JCV activity. This increase in JCV activity was also associated with a decrease in NF-1A protein. Further, these results raise the possibility that, even though specific cellular receptors are important for JCV internalization, regulatory factors that act at the nuclear level are central to JCV multiplication. The observation that JCV-non-permissive cells, which express high levels of NF-1A, could also be infected with JCV by reducing the level of NF-1A protein supports the negative regulatory role of NF-1A on JCV multiplication. Our results show the important cell-specific regulatory mechanisms of NF-1A proteins in the control of JCV multiplication. Acknowledgments This research was supported by the Intramural Research Program of the National Institute of Neurological Disorders and Stroke, National Institutes of Health. References
|
PubMed related articles
Your browsing activity is empty. Activity recording is turned off. |
|||||||||
Brain. 1958 Mar; 81(1):93-111.
[Brain. 1958]Prog Clin Biol Res. 1983; 105():99-106.
[Prog Clin Biol Res. 1983]J Clin Microbiol. 2000 Jan; 38(1):105-9.
[J Clin Microbiol. 2000]Semin Neurol. 1999; 19(2):193-200.
[Semin Neurol. 1999]N Engl J Med. 2006 Mar 2; 354(9):924-33.
[N Engl J Med. 2006]Virology. 1995 Nov 10; 213(2):283-91.
[Virology. 1995]J Neurovirol. 2005 Feb; 11(1):51-7.
[J Neurovirol. 2005]J Gen Virol. 1999 Apr; 80 ( Pt 4)():1017-23.
[J Gen Virol. 1999]J Virol. 2006 Nov; 80(21):10506-13.
[J Virol. 2006]J Virol. 1995 Sep; 69(9):5843-8.
[J Virol. 1995]Gene. 2000 May 16; 249(1-2):31-45.
[Gene. 2000]Nucleic Acids Res. 1991 Dec 11; 19(23):6641.
[Nucleic Acids Res. 1991]FEBS Lett. 1994 Jul 4; 348(1):46-50.
[FEBS Lett. 1994]J Neurovirol. 1996 Apr; 2(2):87-100.
[J Neurovirol. 1996]J Biol Chem. 2000 Sep 29; 275(39):30668-76.
[J Biol Chem. 2000]Cell. 1987 Jan 16; 48(1):79-89.
[Cell. 1987]EMBO J. 1986 Aug; 5(8):1967-71.
[EMBO J. 1986]Cell. 2005 Dec 2; 123(5):819-31.
[Cell. 2005]J Biol Chem. 2001 Jun 15; 276(24):21656-63.
[J Biol Chem. 2001]Ann Neurol. 2003 May; 53(5):636-46.
[Ann Neurol. 2003]J Neurovirol. 2000 May; 6 Suppl 1():S90-4.
[J Neurovirol. 2000]J Virol. 2007 Jun; 81(12):6412-8.
[J Virol. 2007]J Virol. 2007 Jun; 81(12):6412-8.
[J Virol. 2007]J Virol. 2007 Jun; 81(12):6412-8.
[J Virol. 2007]Cell. 2005 Dec 2; 123(5):819-31.
[Cell. 2005]Ann Neurol. 2003 May; 53(5):636-46.
[Ann Neurol. 2003]J Biol Chem. 1992 Jul 15; 267(20):14204-11.
[J Biol Chem. 1992]Genome Biol. 2007; 8(5):R72.
[Genome Biol. 2007]