![]() | ![]() |
Formats:
|
||||||||||||||||||||||||
Copyright © 2009, American Society for Microbiology NF-κB p50 Plays Distinct Roles in the Establishment and Control of Murine Gammaherpesvirus 68 Latency Emory Vaccine Center,1 Department of Microbiology and Immunology, Emory University School of Medicine Atlanta, Georgia 303222 *Corresponding author. Mailing address: Department of Microbiology and Immunology, Emory University School of Medicine, 1462 Clifton Road, Suite 429, Atlanta, GA 30322. Phone: (404) 727-7665. Fax: (404) 712-9736. E-mail: sspeck/at/emory.edu †Present address: Stony Brook University, Life Sciences Bldg., Room 130, Stony Brook, NY 11794. Received January 16, 2009; Accepted February 24, 2009. Abstract NF-κB signaling is critical to the survival and transformation of cells infected by the human gammaherpesviruses Epstein-Barr virus and Kaposi's sarcoma-associated herpesvirus. Here we have examined how elimination of the NF-κB transcription factor p50 from mice affects the life cycle of murine gammaherpesvirus 68 (MHV68). Notably, mice lacking p50 in every cell type were unable to establish a sufficiently robust immune response to control MHV68 infection, leading to high levels of latently infected B cells detected in the spleen and persistent virus replication in the lungs. The latter correlated with very low levels of virus-specific immunoglobulin G (IgG) in the infected p50−/− mice at day 48 postinfection. Because the confounding impact of the loss of p50 on the host response to MHV68 infection prevented a direct analysis of the role of this NF-κB family member on MHV68 latency in B cells, we generated and infected mixed p50+/+/p50−/− bone marrow chimeric mice. We show that the chimeric mice were able to control acute virus replication and exhibited normal levels of virus-specific IgG at 3 months postinfection, indicating the induction of a normal host immune response to MHV68 infection. However, in p50+/+/p50−/− chimeric mice the p50−/− B cells exhibited a significant defect compared to p50+/+ B cells in supporting MHV68 latency. In addition to identifying a role for p50 in the establishment of latency, we determined that the absence of p50 in a subset of the hematopoietic compartment led to persistent virus replication in the lungs of the chimeric mice, providing evidence that p50 is required for controlling virus reactivation. Taken together, these data demonstrate that p50 is required for immune control by the host and has distinct tissue-dependent roles in the regulation of murine gammaherpesvirus latency during chronic infection. Murine gammaherpesvirus 68 (MHV68) is a natural pathogen of rodents and shares many biologic properties with the human pathogens Epstein-Barr virus (EBV) and Kaposi's sarcoma-associated herpesvirus (KSHV). As a gammaherpesvirus, MHV68 is lymphotropic and is associated with pathologies and neoplasia that increase upon loss of host immune control (21, 56, 75). Chronic infection with MHV68 initiates with an acute productive phase of infection and dissemination to secondary lymphoid tissues, leading to the establishment of a quiescent latent virus program in B cells and ultimately memory B cells, with intermittent reactivation events that are controlled by the immune system (27, 56, 87). The genetic tractability of MHV68 and the murine host permit a molecular dissection of key factors and signaling pathways required for chronic infection by the virus, in addition to those processes utilized for immune control by the host (29). NF-κB signaling is one host pathway that is utilized by gammaherpesviruses to promote latency and cell survival (8, 18, 40, 65). Gammaherpesviruses encode numerous gene products that hijack NF-κB signaling by distinct mechanisms to regulate virus and host gene expression, which in turn promote virus latency and the survival, proliferation, and transformation of infected cells (18, 40, 65). Latent membrane protein 1 of EBV is thought to mimic the function of a constitutively active CD40 receptor, activating NF-κB signaling pathways to promote both survival and proliferation of newly infected B cells (35, 62, 77). The KSHV viral-flice inhibitory protein (vFLIP) induces NF-κB-mediated upregulation of antiapoptotic genes and interleukin-6 (IL-6), driving cell survival and proliferation of lymphoma cells (1, 14, 39). The viral G protein-coupled receptor (vGPCR) of KSHV constitutively activates NF-κB to upregulate angiogenic and proinflammatory factors (3, 51, 69, 80). KSHV vFLIP and vGPCR expression in endothelial cells induces the hallmark spindle-cell morphology of KS tumors (37, 41, 52). Although not constitutively active, the MHV68 vGPCR activates NF-κB, AKT, and p44/p42 mitogen-activated protein kinase in response to the chemokines GROα, IL-8, KC, and MIP-2 (81). The MHV68 vGPCR is required for KC-mediated inhibition of MHV68 lytic replication in culture and influences virus reactivation from latency (47, 53, 81). Notably, pharmacologic inhibitors of NF-κB activation induce apoptosis of KSHV-positive (KSHV+) and EBV+ lymphomas in culture and delay tumor progression of EBV+ and KSHV+ lymphomas in mice, suggesting that the NF-κB pathway may be a good therapeutic target for the elimination of gammaherpesvirus-associated lymphomas (43, 44, 92). However, the roles of NF-κB signaling and the impact of NF-κB inhibition during chronic gammaherpesvirus infection in a natural host setting have not been clearly defined. MHV68 is detected in proliferating, germinal center B cells at the peak of splenic expansion and is found in isotype class-switched memory B cells at late times postinfection (27, 50, 55, 87). We previously reported the generation of a recombinant MHV68 (MHV68-IκBαM) that expresses a mutant form of IκBα (IκBαM) that potently blocks activation of NF-κB mediated through the canonical activation pathway (46). Notably, we observed that IκBαM expression did not affect acute replication in the lungs upon intranasal infection. However, in vivo inhibition of NF-κB activation substantially reduced the establishment of latency in B cells (46). This is consistent with analyses of other upstream signaling molecules that feed into the canonical and alternative NF-κB activation pathways; B cells that lack the Toll-like receptor-responsive MyD88 and the B-cell costimulatory membrane protein CD40 are also defective reservoirs for latency in vivo (33, 45, 88). Taking the findings together, NF-κB signaling appears to be a key host determinant in the establishment and maintenance of MHV68 latency, yet the roles of individual NF-κB subunits and their impact on viral and cellular gene expression in the context of virus infection have not been determined. The NF-κB family of transcription factors is comprised of five subunits, NF-κB1 (p105/p50), NF-κB2 (p105/p52), p65/RelA, cRel, and RelB, that form dimers and bind recognition sequences in the promoter regions of genes critical to many aspects of development, inflammation, cell growth, and survival (58). B cells, the primary reservoir for gammaherpesvirus latency, utilize two pathways of NF-κB activation to drive transcriptional events that mediate maturation, response to infection, upregulation of gene products essential for proliferation, protection from apoptosis, and isotype class switching during germinal center reactions (5, 25, 38). In the canonical pathway, engagement of the B-cell receptor, as well as Toll-like receptor ligands and proinflammatory cytokines (e.g., tumor necrosis factor alpha [TNF-α] and IL-1β), leads to the activation of the IKK kinase complex IKK1/IKK2/NEMO, degradation of IκBα, and nuclear translocation of NF-κB dimers (most commonly p50-p65). The alternative pathway of NF-κB activation in B cells initiates with surface receptor engagement of BAFF or CD40 to activate NIK and IKK1-mediated proteolysis of p100 to p52 and subsequent nuclear translocation of p52-containing dimers (6, 16, 17, 42). NF-κB1 encodes the inactive precursor molecule p105, which is constitutively processed to p50 by the proteasome (54). NF-κB p50 lacks a transactivation domain, and thus its function as an activator or repressor of transcription depends largely on heterodimerization with other NF-κB subunits and interactions with cofactors (59, 91). NF-κB1 p50−/− mice generate typical numbers of lymphocytes and form germinal centers, but they have functional defects in the B-cell compartment (60, 70). B cells lacking p50 proliferate normally in response to surface immunoglobulin cross-linking and membrane-bound CD40L, but they fail to respond to the mitogens lipopolysaccharide and soluble CD40L (72). NF-κB1 p50−/− mice have a substantial reduction in the generation of isotype class-switched immunoglobulin responses to T-dependent antigens (60, 70, 72). The infection of NF-κB p50−/− mice with pathogens can result in heightened or decreased pathology, investigations of which have led to the identification of organ- and cell type-specific roles for NF-κB in the protection from apoptosis and the generation of innate and adaptive host immune responses (5, 58, 59, 70). Here we report a further examination of the role of NF-κB signaling during chronic gammaherpesvirus infection, initially through the identification of NF-κB subunits that are activated during productive versus latent MHV68 infection. These analyses led to examining the role of p50 in vivo, which determined that this NF-κB family member plays distinct roles in the host response, as well as in regulating the establishment and maintenance of gammaherpesvirus latency. MATERIALS AND METHODS Viruses and tissue culture. γHV68/MHV68 WUMS (ATCC VR1465) was the wild-type (WT) virus. Virus passage and titer determination were performed as previously described (84). In addition, a recombinant MHV68, MHV68-eYFP, which contains a cytomegalovirus (CMV)-driven enhanced yellow fluorescent protein (eYFP) expression construct flanked by a chromatin insulator element isolated from the major histocompatibility complex class II locus (49) that was cloned into the PmlI site of the 27-29B intergenic region of MHV68 to generate MHV68-eYFP, was used in some studies (C. Collins, J. M. Boss, and S. H. Speck, unpublished results). YFP expression could be detected in splenocytes of infected mice between 14 and 18 days postinfection (dpi) at frequencies similar to those determined by limiting-dilution nested PCR (Collins et al., unpublished results). NIH 3T12 cells and mouse embryonic fibroblast (MEF) cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10 U of penicillin per ml, 10 μg of streptomycin per ml, 10% fetal calf serum (FCS), and 2 mM l-glutamate (cMEM). S11 MHV68+ lymphoma cells were maintained in RPMI supplemented with 100 U of penicillin per ml, 100 mg of streptomycin per ml, 10% FCS, and 50 μM beta-mercaptoethanol. Cells were cultured at 37°C in a 5% CO2 environment. MEF cells were prepared as previously described (61) from NF-κB1 p50−/− mice and the control mice on both 129 × C57BL/6 and C57BL/6 backgrounds (strain information is described below). Mice, infections, and organ harvests. NF-κB1−/− mice on two genetic backgrounds were acquired from The Jackson Laboratory (Bar Harbor, ME): NF-κB1−/− mice on a 129 × B6 genetic background (B6;129P-Nfkb1tm1Bal/J, catalog no. 00284) and control B6129PF2/J mice (catalog no. 100903); and NF-κB1−/− mice on a BL6 background (B6.Cg-Nfkb1tm1Bal/J, catalog no. 006097) and control C57BL/6J mice (catalog no. 000664). Mice were housed in the Whitehead Vivarium of Emory University in accordance with federal and university guidelines. The p50−/− mice and the control mice were bred and housed under identical conditions in static, microisolator cages with autoclaved water and food. The bone marrow (BM) chimeras were also maintained in sterile conditions throughout the experiments. All protocols for animal studies were approved by the Institutional Animal Care and Use Committee of Emory University. Mice were placed under isofluorane anesthesia prior to intranasal inoculation with 100 PFU or 1,000 PFU of virus in 20 μl of cMEM. For the global p50−/− experiments, mice were used at between 2 and 4 months of age. For the BM chimera experiments, mice were generally 4 months of age at the time of infection. Mice were sacrificed by use of isofluorane or carbon dioxide. Spleens were harvested into cMEM, homogenized, and filtered through a 100-μm-pore-size nylon cell strainer (Becton Dickinson, Franklin Lakes, NJ). Erythrocytes were removed with red blood cell lysis buffer (Sigma, St. Louis, MO). Except where indicated, pooled splenocytes from three to five mice were used in all experiments. Whole lungs or specific lobes of lung tissue were harvested and immediately frozen in cMEM at −80°C. Blood was acquired by a retro-orbital bleed, and the serum was isolated and stored at −80°C. Generation of NF-κB1 mixed BM chimeric mice. B6.SJL-PtprcaPepb/BoyJ WT (Ly5.1) mice (catalog no. 002014; The Jackson Laboratory) were lethally irradiated (950 rads) with two doses of 475 rads at a 20-h interval and reconstituted with BM from both p50+/+ (Ly5.1+) and p50−/− (Ly5.2+, B6.Cg-Nfkb1tm1Bal/J) mice. BM cells were flushed from femurs, depleted of red blood cells, and mixed. Recipient mice (Ly5.1) were anesthetized with 2,2,2-tribromoethanol, and a total of 1.4 × 107 to 2 × 107 cells in 100 μl phosphate-buffered saline (PBS) were injected intraocularly. Mice were rested for 8 weeks to allow for reconstitution, which was confirmed by flow cytometry analysis of peripheral blood lymphocytes, before MHV68 infection. Chimeric mice received neomycin and polymyxin B (Sigma-Aldrich) in acidified drinking water until reconstitution was confirmed. Plaque assays. Plaque assays were performed as previously described (15), with minor modifications. NIH 3T12 cells were plated in six-well pates 1 day prior to infection at 2 × 105 cells per well. Organs were subjected to four rounds of mechanical disruption of 1 min each using 1.0-mm zirconia/silica beads (Biospec Products, Bartsville, OK) in a Mini-Beadbeater-8 (Biospec Products). Serial 10-fold dilutions of organ homogenate were plated on NIH 3T12 monolayers in a 200-μl volume. Infections were performed for 1 h at 37°C with rocking every 15 min. Immediately after infection, plates were overlaid with 1 to 2% methylcellulose in cMEM. After 6 to 8 days, the methylcellulose was aspirated and washed with PBS, the monolayer was fixed with methanol and stained with 0.1% crystal violet in 20% methanol, and plaques were scored. The limit of detection for this assay is 50 PFU per organ. Nuclear extract preparation and electrophoretic mobility shift analysis. S11 cells were harvested, washed once in PBS, and resuspended in sucrose buffer (320 mM sucrose, 10 mM Tris HCl [pH 8.0], 3 mM CaCl2, 2 mM magnesium acetate, 0.1 mM EDTA, 0.5% Nonidet P-40 [NP-40], 1 mM dithiothreitol [DTT], 0.5 mM phenylmethylsulfonyl fluoride [PMSF]). Nuclei were spun down, washed, and resuspended in a low-salt buffer (20 mM HEPES [pH 7.9], 1.5 mM MgCl2, 20 mM KCl, 0.2 mM EDTA, 25% glycerol, 0.5 mM DTT, 0.5 mM PMSF) prior to the gradual addition of an equal volume of high-salt buffer (20 mM HEPES [pH 7.9], 1.5 mM MgCl2, 800 mM KCl, 0.2 mM EDTA, 25% glycerol, 1% NP-40, 0.5 mM DTT, 0.5 mM PMSF, protease inhibitor cocktail [Roche, Mannheim, Germany]) followed by vigorous shaking at 4°C. The supernatant collected after centrifugation at 14,000 × g for 15 min at 4°C was the nuclear extract. Adherent cells were harvested, washed once in PBS, and resuspended in hypotonic lysis buffer (10 mM HEPES [pH 7.9], 10 mM KCl, 1.5 mM MgCl2, 0.1 mM EDTA, 1 mM DTT, 0.5 mM PMSF, protease inhibitor cocktail [Roche]) for 15 min prior to the addition of 1/20 volume of 10% NP-40. Nuclei were spun down, washed in hypotonic lysis buffer, and then resuspended in high-salt buffer (25% glycerol, 20 mM HEPES [pH 7.9], 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT, 0.5 mM PMSF, protease inhibitor cocktail [Roche]) with vigorous shaking at 4°C. The supernatant collected after centrifugation at 10,000 × g for 10 min at 4°C was the nuclear extract. Nuclear extracts were assayed for NF-κB activation by electrophoretic mobility shift assay (EMSA). A 2.5- to 7.5-μg amount of nuclear extract was incubated with a 32P-labeled oligonucleotide containing the NF-κB consensus site, AGTTGAGGGGACTTTCCCAGGC, in a binding reaction mixture containing 2 mM HEPES (pH 7.9), 1 mM EDTA, 5 mM DTT, 0.05% Triton X-100, 5% glycerol, and 2 μg poly(dI-dC) (Roche) for 30 min at room temperature. Competition experiments were performed with 20- and 100-fold molar excesses of unlabeled oligonucleotides containing the WT or mutated NF-κB consensus site (AGTTGAGGCGACTTTCCCAGGC). Supershift experiments were performed by overnight incubation of nuclear extracts with 0.2 to 4.0 μg of antibodies against NF-κB subunits (Santa Cruz Biotechnology, Santa Cruz, CA) at 4°C. Nucleoprotein complexes were subjected to electrophoresis in 5% native polyacrylamide gels at 180 V, dried under vacuum, and analyzed by phosphorimager analysis (Typhoon 9410; Amersham Biosciences, Piscataway, NJ). Magnetic cell separation. Murine B cells were isolated by depletion of non-B cells using a B-cell isolation kit (Miltenyi Biotec, Cologne, Germany) per the manufacturer's recommendations. Briefly, cells were resuspended at 2 × 108 cells/ml in 1× PBS containing 0.5% FCS, followed by staining with Fc block (0.125 μg/106 cells) on ice for 15 min. Cells were labeled with biotin-antibody cocktail (biotin-conjugated antibodies against CD43, CD4, and Ter-119) at 10 μl per 1 × 107 cells for 15 min on ice, followed by staining with antibiotin microbeads at 20 μl per 1 × 107 cells for 15 min on ice. Cells were washed twice with PBS containing 0.5% FCS and subjected to magnetic separation using the autoMACS (Miltenyi Biotec, Cologne, Germany). Following separation, stained cell populations were analyzed by flow cytometry as described below. Flow cytometry. Cells resuspended in PBS supplemented with 2% FCS were stained for fluorescence-activated cell sorting (FACS) using a combination of the following antibodies: R-phycoerythrin (PE)-conjugated antibodies to CD19, CD95, CD44, and immunoglobulin D (IgD); fluorescein isothiocyanate (FITC)-conjugated antibodies to GL7, Vβ4, Ly5.1/CD45.1, IgG1, IgG2a/2b, and IgG3; allophycocyanin (APC)-conjugated antibodies to CD19, CD62L, Ly5.2/CD45.2, and Ly5.1; PE-Cy7-conjugated antibodies to CD95 and CD69; Pacific Blue-conjugated antibody to CD8; and peridinin chlorophyll protein-Cy5.5-conjugated antibody to Ly5.2/CD45.2. Rat anti-mouse CD16/CD32 (Fc block) was used to block Fc receptors prior to staining. All reagents were obtained from BD Biosciences (San Jose, CA) and EBioscience (San Diego, CA). For FACS, cells were resuspended at 2 × 107cells per ml and incubated for 30 min on ice in PBS containing 1% FCS and Fc block. Cells were stained with PE- and FITC-conjugated antibodies at 5 μl per 1 × 107 cells by incubation for 30 min on ice in the dark. Cells were washed twice with PBS containing 1% FCS and resuspended at 1 × 108 cells/ml. Stained cell populations were acquired using a FACSvantage instrument (BD Biosciences). Sorted and unsorted cell populations were resuspended in cMEM supplemented with 10% dimethyl sulfoxide and stored at −80°C for limiting-dilution PCR analyses or in cMEM at 4°C for limiting-dilution ex vivo reactivation analyses as described below. For flow cytometry analysis, cells were resuspended at 1 × 106 cells per ml in PBS containing 2% FCS for 20 min on ice in the dark and stained with a 1:100 to 1:300 dilution of the conjugated antibody. Data was collected on an LSRII instrument (BD Biosciences) and analyzed using FlowJo software (Treestar, Ashland, Oregon). Limiting-dilution nested-PCR detection of MHV68 genome-positive cells. Limiting-dilution analysis to determine the frequency of cells harboring the viral genome was performed using a single-copy-sensitive nested PCR assay amplifying a region of ORF50, as previously described (85). Briefly, frozen samples were thawed, counted, resuspended in isotonic buffer, and plated in serial threefold dilutions in a background of 104 uninfected NIH 3T12 cells in 96-well plates (Eppendorf Scientific, Westbury, NY). Plates were covered with PCR foil (Eppendorf), and cells were lysed with proteinase K for 6 h at 56°C. Ten microliters of round 1 PCR mix was added to each well by foil puncture. Following first-round PCR, 10 μl of round 2 PCR mix was added to each well by foil puncture, and samples were subjected to round 2 PCR. All cell lysis and PCR were performed on a PrimusHT thermal cycler (MWG Biotech, High Point, NC). Products were resolved by ethidium bromide staining on 2% agarose gels. Twelve PCRs were performed for each sample dilution, and a total of six dilutions were performed per sample. Every PCR plate contained control reactions (uninfected cells and 10 copies, 1 copy, and 0.1 copy of plasmid DNA in a background of 104 cells). All of the assays demonstrated approximately single-copy sensitivity with no false positives. Limiting-dilution ex vivo reactivation analyses. Limiting-dilution analysis to determine the frequency of cells containing virus capable of reactivating from latency was performed as previously described (85, 86). Briefly, bulk splenocytes or sorted cell populations were resuspended in cMEM and plated in serial twofold dilutions (starting with 105 cells) onto MEF monolayers in 96-well tissue culture plates. Twelve dilutions were plated per sample, and 24 wells were plated per dilution. Wells were scored for cytopathic effect (CPE) at 21 to 28 days postplating. To detect preformed infectious virus, parallel samples of mechanically disrupted cells were plated onto MEF monolayers. This process kills >99% of live cells, which allows preformed infectious virus to be discerned from virus reactivating from latently infected cells. Unless indicated otherwise, significant levels of preformed virus were not detected in these assays. Limiting-dilution analysis of persistent viral replication in the lungs. Preformed infectious virus in the lungs was measured by a modified form of the limiting-dilution ex vivo reactivation assay described above. Briefly, the lower left lobe of the lung from each animal was subjected to four rounds of mechanical disruption of 1 min each using 1.0-mm zirconia/silica beads followed by an additional four rounds of disruption using 0.5-mm zirconia/silica beads (BioSpec Products, Bartlesville, OK). Disruption of cells was verified by trypan blue exclusion (Sigma). The homogenate was brought up to 3.4 ml with cMEM and plated in twofold serial dilutions onto MEFs in 96-well tissue culture plates. Twelve dilutions of 16 replicate wells were plated. CPE was monitored microscopically at 14 to 21 days postplating. Antibody ELISAs. For MHV68-specific IgG assay, plates were first coated with a 1% final concentration of paraformaldehyde-fixed viral antigen for sample wells, with standard wells coated with a 2-μg/ml concentration of donkey anti-mouse IgG (Jackson ImmunoResearch) in coating buffer (0.1 M Na2CO3, 0.2% NaN3, pH 9.6), and incubated either at 37°C for 2 h or at 4°C overnight, and then plates were blocked with 3% bovine serum albumin in PBS and incubated for 2 h at 37°C. After washing of the plates with enzyme-linked immunosorbent assay (ELISA) wash buffer (200 ml 10× PBS, 1 ml Tween 20, H2O added to 2000 ml), serum samples or mouse IgG at a concentration of 1 μg/ml (Jackson ImmunoResearch) was added to each well at a threefold dilution in ELISA diluent (BD Bioscience) and then incubated for 3 h at 37°C. Plates were then washed, and horseradish peroxidase-conjugated donkey anti-mouse IgG (Jackson ImmunoResearch) was added at a 1:5,000 dilution and incubated for 2 h at 37°C. Plates were washed, and 100 μl of 1:1 developer was added (BD Bioscience). The reaction was stopped after 10 min with 50 μl stop solution (BD Bioscience), and plates were read on a microplate reader (Synergy HT; BioTek). The concentration of antibody in serum samples was determined by using a standard curve generated by threefold serial dilutions of standard in the same assay. Statistical analyses. All data were analyzed by using GraphPad Prism software (GraphPad Software, San Diego, CA). Titer data were statistically analyzed with the Mann-Whitney nonparametric, unpaired two-tailed t test. Based on the Poisson distribution, the frequencies of reactivation and viral genome-positive cells were obtained from the nonlinear regression fit of the data where the regression line intersected 63.2%. The frequencies of reactivation and genome-positive cells were statistically analyzed by unpaired two-tailed t test of the log 63.2% effective concentration. RESULTS Characterization of NF-κB activation during infection. The S11 cell line harbors MHV68 in a predominantly latent state (78) and was observed to have constitutive NF-κB activation as assessed using an NF-κB luciferase reporter assay (data not shown). To identify the NF-κB subunits that are activated in this latently infected B-cell line, EMSAs were performed with nuclear extracts prepared from S11 cells cultured under normal growth conditions. Two distinct mobility shifts were evident upon incubation with a labeled oligonucleotide containing a consensus NF-κB recognition sequence (Fig. (Fig.1A).1A
We previously observed that MHV68 activates NF-κB during virus replication in permissive murine fibroblasts (46). To further examine the activation profile upon de novo infection of permissive cells, nuclear extracts were prepared from primary MEFs during a 24-h time course following infection at a high multiplicity of infection (MOI) of 5 PFU per cell and analyzed for NF-κB binding by EMSA. Low levels of NF-κB activation were evident by 6 h postinfection, but robust activation was not observed until 12 to 24 h postinfection in MEF cultures (Fig. (Fig.1B).1B Altered kinetics of establishment of MHV68 latency in the absence of NF-κB p50. Based on the identification of p50 as a component of NF-κB activation during MHV68 latency, we further characterized the role of p50 during MHV68 infection of mice. We first examined the ability of p50−/− mice to control and clear acute MHV68 replication. Upon intranasal inoculation, the acute phase of MHV68 infection is characterized by lytic replication in the lung that is cleared from normal immunocompetent mice within 2 weeks. However, following intranasal infection of p50−/− mice with 100 PFU of WT MHV68, ca. 10- and 100-fold-higher levels of virus replication in the lungs were observed compared to that in control mice at 9 and 12 dpi, respectively (Fig. (Fig.2A).2A
To determine whether the complete absence of NF-κB p50 affects the kinetics of MHV68 replication, multistep growth curves in primary WT and p50−/− MEFs were performed. Following a low-MOI (0.001) infection, the kinetics of MHV68 replication in p50−/− MEFs were very similar to that observed in control MEFs (Fig. (Fig.2B).2B We extended our analyses of MHV68 infection in p50−/− mice by examining latency in the spleen. At 18 dpi, the peak period of splenic latency in normal mice infected with 100 PFU of MHV68, there was a substantial, 12-fold defect in the establishment of latency in p50−/− mice compared to control mice (1/5,066 versus 1/425), despite increased levels of acute virus replication in the lungs of p50−/− mice at 9 and 12 dpi (Fig. (Fig.2C).2C To assess whether there might be a delay in dissemination and/or expansion of splenic latency in p50−/− mice, we examined a later time point. In striking contrast to the results obtained at 16 to 18 dpi, at 28 to 29 dpi we observed a complete reversal of the phenotype. In p50−/− mice, the levels of latency were increased 26-fold (1/225) over that observed in the control C57BL/6 (1/1,847) (Fig. (Fig.2E).2E MHV68 gains access to germinal center B cells in p50−/− mice. The dramatic alteration in the kinetics of splenic latency in p50−/− mice raised the possibility that MHV68 infection in these mice might be skewed toward different B-cell subsets than observed in p50-sufficient B cells, in which the majority of infected cells at the peak of latency exhibit a germinal center phenotype (27, 50, 55, 87). To characterize B-cell infection, we infected p50−/− and control mice with a recombinant MHV68 (MHV68-eYFP) that expresses YFP at detectable levels in splenocytes at periods of peak splenic latency (Fig. (Fig.3).3
To assess the distribution of MHV68 in specific p50-deficient B-cell populations, we analyzed the expression at 18 and 31 dpi of B-cell surface markers indicative of activated (CD69+) and germinal center (GL7+ CD95+) (Fig. (Fig.3).3 Increased splenic latency at late times postinfection correlates with both a decreased humoral immune response against MHV68 and increased persistent virus replication in the lungs of p50−/− mice. In normal immunocompetent mice the peak of MHV68 latency at 16 to 18 dpi is followed by a significant decline in the frequency of splenocytes harboring virus, due to either egress of the latently infected cells from the spleen and/or clearance of these cells. The latter likely reflects a combination of normal turnover of specific B-cell populations, virus-induced cell death, and immune-mediated clearance of MHV68-infected B cells. Thus, we assessed whether the expansion of latency observed at 28 to 29 dpi in p50−/− was transient or persisted in these animals. Notably, at 48 to 49 dpi (Fig. (Fig.4A),4A
How are the high levels of MHV68 latency maintained in the p50−/− mice? We hypothesized that this might be the consequence of virus reactivation fueling persistent virus replication, likely at a distal site, since there was no evidence of ongoing virus replication in the spleens of p50−/− mice at late times postinfection. The lungs are one site that has previously been shown to support persistent virus replication in some settings (11, 73, 88). To assess the presence of low-level virus replication in the lungs of p50−/− and control mice at late times postinfection, lungs of infected mice were disrupted and plated in a limiting-dilution assay on permissive MEF monolayers. This approach substantially increases the sensitivity for detecting preformed infectious virus compared to a standard plaque assay (79), enabling the detection of low levels of virus replication at 18 dpi (Fig. (Fig.4C)4C The high levels of splenic latency, coupled with the detection of increased persistent virus replication in the lungs at late times after infection of p50−/− mice, suggest that these animals mount a suboptimal immune response to chronic MHV68 infection. It is known that B cells in NF-κB−/− mice fail to proliferate in response to some mitogens, have reduced levels of serum immunoglobulin and isotype class-switched B cells, and fail to generate high-affinity antibodies in response to T-dependent antigens (38, 60, 70). Thus, we assessed antibody responses in the p50−/− mice. As previously observed for responses to T-dependent antigens, there was a log reduction in total IgG in naïve and infected p50−/− mice compared to control mice (Fig. (Fig.4D).4D The number and size of germinal centers in p50−/− mice are smaller than those in control mice upon immunization with nitrophenol-conjugated keyhole limpet hemocyanin (60). This led us to further examine the response of p50−/− B cells to MHV68 infection. Initially, we characterized B- and T-cell populations in control and p50−/− mice and did not detect any gross alterations over the course of MHV68 infection in the frequencies of B cells, CD4+ T, cells or CD8+ T cells, with the exception that the relative percentage of CD4+ T cells was elevated in p50−/− compared to control mice at 105 dpi (Table 1). We then extended these analyses to further examine B-cell responses. Germinal center participation in infected p50−/− mice and control mice was assessed by flow cytometry, with staining for the surface markers GL7 and CD95. Germinal center expansion of CD19+ B cells was observed at 28 dpi in p50−/− mice (Table 2). However, at all time points examined, the infected p50−/− mice had significantly fewer germinal center B cells than MHV68-infected control mice.
Given the defect in B-cell participation in germinal center reactions, coupled with a severe defect in the humoral response against MHV68 in p50−/− mice, global T-cell responses were investigated. While the percentages of CD4+ and CD8+ T cells did not differ significantly between p50−/− mice and control mice at between 18 and 45 dpi (data not shown), dramatic differences were observed in the percentages of effector T cells as characterized by the downregulation of CD62L and the upregulation of CD44 (Table 2). The population of effector CD4+ T cells in p50−/− mice did not increase until 28 dpi and remained lower than the population of effector CD4+ T cells in control mice, which doubled to 32.2% by 18 dpi (Table 2). p50−/− mice responded to MHV68 infection with a peak of 20% effector CD8+ T cells at 28 dpi, which fell to nearly naïve levels by 105 dpi (Table 2). This is in sharp contrast to the effector CD8+ T-cell response in control mice, where approximately 30% of CD8+ T cells were CD62Llo/CD44hi from 18 dpi through the duration of the infection (largely owing to the robust and sustained expansion of Vβ4+ CD8+ T cells, as discussed below). A hallmark of MHV68 infection is the expansion of Vβ4+ CD8+ T cells in response to the MHV68 superantigen-like secreted M1 protein (23). Here we observed that upon WT MHV68 infection of control C57BL/6 mice, ca. 20% of CD8+ T cells were Vβ4+ by 28 dpi, increasing to 30% of CD8+ T cells by 105 dpi (Table 2). A slight expansion of the Vβ4+ CD8+ T cells was evident at 28 dpi in the p50−/− mice (11%), but, as observed with the effector CD8+ T-cell population, this T-cell subset failed to further expand as infection progressed in the p50−/− mice (Table 2). Our previous studies have provided evidence that Vβ4+ CD8+ T cells are an important source of gamma interferon (IFN-γ) during MHV68 infection, which serves to suppress virus reactivation from some latently infected reservoirs (7, 23). Thus, the absence of a robust Vβ4+ CD8+ T-cell response may also contribute to the observed persistent virus replication in the lungs of MHV68-infected p50−/− mice. Taken together, these data indicate that p50 plays an important role in T-cell responses to MHV68 infection, and thus, in addition to a significant defect in the humoral immune response to MHV68, compromised T-cell responses likely also contribute to the phenotype of MHV68 in NF-κB p50−/− mice. Evaluation of immune control in MHV68-infected mixed BM chimeric mice. The infection of p50−/− mice revealed substantial defects in host immune control, which undoubtedly significantly affect control of chronic MHV68 infection. Such alterations in virus-host interactions prevent a clear determination of a role for p50 in the infected cell versus a requirement for p50 in the hematopoietic or nonhematopoietic, stromal cell compartments of the host in response to the virus. Therefore, mixed p50+/+/p50−/− BM chimeric mice were generated to restore normal host responses and enable investigation of the intrinsic requirements for p50 in MHV68 B cells in the context of a p50-competent host background. Normal C57BL/6 mice congenic for Ly5.1 were lethally irradiated to deplete their BM and then reconstituted with an 8:2 ratio (based on cell number) of BM isolated from normal C57BL/6 Ly5.1+ mice and p50−/− C57BL/6 mice congenic for Ly5.2. This input ratio was used to ensure that the reconstituted mice had a normal, p50-sufficient immune system. Eight weeks after reconstitution, the ratio of Ly5.1+ (p50+/+) to Ly5.2 (p50−/−) splenocytes was 7:3, demonstrating no intrinsic defect in p50−/− B-cell maturation in the presence of p50+/+ B cells. The p50+/+/p50−/− BM chimeras were examined for their ability to control MHV68 infection compared to their parental counterparts. At 12 dpi, MHV68 replication in the lungs of the BM chimeras was restored to levels seen in the control p50+/+ mice, unlike the higher levels observed in p50−/− mice (Fig. (Fig.5A).5A
Identification of a role for p50 in latently MHV68-infected B cells. To determine whether there is a direct role for p50 in chronic MHV68 infection, aside from its role in the host immune response to MHV68, splenocytes from MHV68-infected p50+/+/p50−/− mixed BM chimeric mice were separated by flow cytometry into p50+/+ B cells and p50−/− B cells based on the expression of Ly5.1 or Ly5.2, respectively. As shown in Fig. Fig.6A,6A
In contrast to the enhanced latency observed in p50−/− mice at 28 to 29 dpi, the frequency of viral genome-positive Ly5.2 (p50−/−) B cells was 11-fold lower than the frequency of viral genome-positive Ly5.1 (p50+/+) B cells in the context of the mixed BM chimeric mouse at 26 to 29 dpi (Fig. (Fig.6D).6D Given the failure to support the efficient establishment of latency in the absence of p50, p50+/+ (Ly5.1+) B cells and p50−/− (Ly5.2+) B cells isolated from mixed BM chimeric mice were analyzed for phenotypic alterations in response to MHV68 in two independently generated sets of BM chimeric mice at 18 and 19 dpi (Fig. (Fig.7).7
Role for p50-mediated control of virus replication in the lungs. The MHV68-infected mixed BM p50+/+/p50−/− chimeric mice were nearly indistinguishable from control C57BL/6 mice in levels of acute virus replication, frequency of latently MHV68-infected B cells, and antibody production. One additional phenotype uncovered in the p50−/− mice was the substantially elevated levels of preformed infectious virus in the lungs of infected mice at late times postinfection. Loss of control of persistent virus replication in the lungs has been previously reported upon MHV68 infection of immune-deficient mice (11, 32, 48, 88) and is consistent with the immune dysfunction uncovered in the infected p50−/− mice. However, NF-κB has also been implicated in controlling virus reactivation from latently infected B cells (8). Thus, to assess whether persistent virus replication is controlled in the mixed BM chimeric mice, virus replication in the lungs at late times postinfection was examined. Unexpectedly, appreciable levels of persistent virus replication were detected in the lungs of MHV68-infected mixed BM chimeras, albeit at reduced levels compared to p50−/− mice (Fig. (Fig.8).8
DISCUSSION The analyses reported here have uncovered several novel findings regarding the role of NF-κB signaling during MHV68 infection. First, the NF-κB activation profile differs in productive and latent MHV68 infections, with the activation of the NF-κB subunit p50 common to both. Second, a striking increase in WT MHV68 replication was observed in the lungs of p50−/− mice but not in p50−/− MEFs in culture, suggesting a role for p50 in host control during acute infection. Third, the kinetics of latency establishment in the splenocytes of p50−/− mice were grossly distorted such that the expansion of latency in the spleens of p50−/− mice occurred 10 days later than in control mice and was maintained at high levels as late as 3 months postinfection, leading to the identification of persistent MHV68 replication in the lungs of p50−/− at late times postinfection and identification of defects in the host adaptive immune response. Fourth, the generation and infection of p50+/+/p50−/− mixed BM chimeric mice restored virus control and humoral immunity such that the intrinsic role of p50 in latently infected B cells could be examined. Defects in typical B-cell responses such as activation and germinal center participation demonstrated a B-cell intrinsic requirement for p50 in response to infection. Of particular significance, the p50−/− B cells failed to effectively compete with their p50+/+ counterparts as reservoirs for MHV68 latency. Finally, we demonstrated persistent virus replication in the lungs of the p50+/+/p50−/− BM chimeras, indicating a role for NF-κB p50 in maintaining MHV68 latency. Taken together, these data identify NF-κB p50 as an important regulatory factor that plays a role in the host immune response to MHV68 infection, as well as having a direct impact on MHV68 latency in B cells. The NF-κB activation profile varies in lytic and latent infections. As in lymphoma cell lines latently infected with KSHV or EBV (8, 39), we observed that NF-κB was constitutively activated in the MHV68+ S11 B lymphoma cell line (Fig. (Fig.1A).1A An EMSA analysis revealed activation of NF-κB late in the MHV68 replication cycle following high-MOI productive infection in both primary (Fig. (Fig.1B)1B The absence of NF-κB activation early during the productive infection of fibroblasts by MHV68 is consistent with data indicating that NF-κB inhibits MHV68 replication. Overexpression of the NF-κB subunit p65 inhibits the viral lytic transactivator RTA and blocks MHV68 replication in cell culture (8). In addition, inhibition of NF-κB leads to reactivation of KSHV and EBV from B cells in culture (8, 9). Infection of endothelial cells in culture with KSHV, which appears to biased toward establishment of a latent infection, results in a rapid and sustained period of NF-κB activation that is associated with an upregulation of NF-κB-dependent proinflammatory and prosurvival genes (36, 51, 63). Furthermore, inhibition of NF-κB activation in KSHV-infected endothelial cells can lead to an increase in lytic gene expression (36). The role of NF-κB activation during the late phase of MHV68 infection in permissive cells has not been defined. The CMV-driven IκBαM construct is expressed within 4 h of NIH 3T3 infection with the MHV68-IκBαM recombinant virus (L. T. Krug, J. C. Forrest, and S. H. Speck, data not shown) and blocks NF-κB activation during virus infection in permissive cells, but it does not affect replication in fibroblasts (46) or in transformed endothelial and epithelial cell lines (data not shown). Furthermore, comparison of MHV68 replication in WT and p50−/− MEFs demonstrated that p50 is dispensable for virus replication following infection at a low MOI (Fig. (Fig.2B).2B MHV68 pathogenesis in the absence of NF-κB p50. MHV68 replicated to higher levels in the lungs of p50−/− mice, yet there was no indication of a delay in clearance. Alterations in the kinetics or levels of virus were not recapitulated upon a low-multiplicity infection of p50−/− MEFs in culture, suggesting a requirement for p50 by the host. Heighted levels of acute-phase replication have been reported for IFN-α/βR−/−, IFN-γR−/−, and STAT1−/− mice (4, 22, 83). However, the delayed kinetics of establishing splenic latency in p50−/− mice observed here differs from the rampant dissemination of MHV68 in the absence of type I IFN signaling (4, 22). Intranasal inoculation of MHV68 results in the infiltration of immune cells and production of cytokines and chemokines in the lungs of mice, many of which are typically regulated by NF-κB (66, 68). The critical role for NF-κB-dependent innate immune responses is also apparent upon the infection of NF-κB p50−/− mice with bacterial pathogens. Streptococcus pneumoniae infection leads to rapid death and sepsis in p50−/− mice (70). The failure to clear the enteric pathogen Citrobacter rodentium from the guts of p50−/− mice correlated with a decrease in inflammatory cell infiltration into colonic tissue, not a lack of anti-C. rodentium antibodies (20). Extracellular Listeria monocytogenes was cleared normally in the peritoneums of p50−/− mice, but the defect in clearance of intracellular Listeria monocytogenes was attributed to a defect in cytokine-induced activation of p50−/− macrophages (70). The activation or inhibition of NF-κB activity can lead to an increase or decrease, respectively, in models of acute lung inflammation and associated injury (13, 24, 57). For instance, mice receiving adenovirus-delivered NF-κB p65/RelA had greater clearance of Pseudomonas aeruginosa, while mice administered Ad-IκBDN, a dominant inhibitor of NF-κB, exhibited decreased clearance (34). Inhibition of NF-κB was associated with a decrease in TNF-α, the proinflammatory chemokine MIP-2, and neutrophil infiltration (64). Further examination of the inflammatory response in p50−/− mice might identify inflammatory events that mediate immune control of acute MHV68 replication in the lungs. The altered kinetics of establishment of MHV68 latency in the p50−/− mice led us to investigate whether the absence of p50 alters the latency reservoir(s) for MHV68. Since B cells are the predominant latency reservoir for MHV68 in the spleen, we assessed the distributions of MHV68 in specific p50-deficient B-cell populations at 18 and 31 dpi, examining expression of surface markers indicative of activated (CD69+) and germinal center (GL7+ CD95+) B cells (Fig. (Fig.3).3 In the p50−/− mice there was a high frequency of splenic latency that is likely due to reseeding B-cell infection via ongoing persistent virus replication in these animals. Notably, the level of virus replication in the lungs was below the limit of detection using a traditional plaque assay, instead requiring a limiting-dilution overlay of MEFs and monitoring for the appearance of CPE. There was intermittent virus replication observed in control mice during early stages of chronic infection. This indicated that there is a low level of sporadic reactivation in the lungs that is held in check by the host immune response in normal mice. However, this reactivation/persistent replication was not controlled in the p50−/− mice, leading to persistence in the lungs. The increased persistence of MHV68 in the p50−/− mice suggests that there is a dysfunction of the immune system that is influencing B-cell biology and the virus life cycle. Immune defects of the NF-κB1 p50−/− mice prevent control of MHV68. The phenotypes observed in p50−/− mice infected with MHV68 (heightened levels of acute replication in the lungs and delayed seeding of splenic latency, followed by increased viral load in the spleen and ongoing persistent virus replication in the lungs at late times postinfection) bear a striking similarity to the phenotypes observed in mice lacking CD4+ T cells (11). CD4+ T cells are critical for the generation of splenomegaly, nonspecific B-cell activation and increased nonspecific antibody production, the establishment of B-cell latency, the expansion of Vβ4 CD8+ T cells, and the generation of an effective CD8+ T-cell response (21). The absence of the costimulatory molecules CD40, CD40L, and CD80/CD86 (but, unexpectedly, not CD28), which are critical for the interactions of B cells and CD4+ T cells before and during germinal center reactions, also results in virus recrudescence (21, 31, 48, 66). Evaluation of several markers of immune function in p50−/− mice uncovered immune defects in both B- and T-lymphocyte compartments. NF-κB p50 knockout mice generate normal B-cell numbers and follicles but have defects in generating high-affinity T-dependent antibodies (30, 70). NF-κB p50 is critical for the germ line CHγ3 transcription in response to stimulation and likely mediates chromatin remodeling at the Sγ3 and Sγ1 region through direct binding (72, 82). Administration of the T-dependent nitrophenol-conjugated keyhole limpet hemocyanin immunogen to p50−/− mice leads to smaller and decreased numbers of germinal centers (59, 60). Thus, the failure to generate an anti-MHV68 antibody response in p50−/− mice is not altogether unexpected given the role of p50 in isotype class switching. The combined lack of antiviral antibody and failure to control latency in the lungs of the p50−/− mice seemingly underscores the importance of antibodies in the control of chronic MHV68 infection (32, 76). However, the loss of humoral immunity is compounded by defects in T-cell function in the p50−/− mice. The absence of p50 in mice infected with Leishmania major leads to a failure to generate an antigen-specific CD4+ T-cell response and decreased production of IFN-γ, which was attributed to a lack of CD4+ T-cell proliferation (2). The maintenance of a high level of activated, effector CD8+ T cells is a hallmark of MHV68 infection that is dependent on CD4+ T cells (11). In our investigation of CD4+ T-cell responses, there was a defect in the generation of effector CD4+ T cells in the p50−/− mice at 18 and 28 dpi (Table 2). In turn, there was a profound deficiency in effector CD8+ T cells (Table 2). The added failure to expand the M1-dependent Vβ4+ CD8+ T-cell population in the p50−/− mice would also be expected to reduce the production of antiviral cytokines such as IFN-γ and TNF-α, which likely hold reactivation in check (7, 23, 71). Taken together, our results indicate that while there were no gross defects in the numbers of B, CD4+, or CD8+ T cells (Table 1), the impairment of the effector functions of these cells in the absence of NF-κB1 p50 led to a failure of humoral and cell-mediated immunity. This lack of adaptive immune function and the concomitant loss of virus control parallel the increase in gammaherpesvirus pathologies associated with immune dysfunction in AIDS and transplant patients. Further characterization of differences in the inflammatory response in the lungs, coupled with analyses of abnormal immune cell functions in lymphoid tissues, in p50−/− versus control mice may provide insights into MHV68 dissemination and establishment of latency. B-cell intrinsic role for NF-κB p50 to support MHV68 latency. NF-κB-mediated immune dysfunction in the global p50 knockout mice led to many disruptions in the typical life cycle of MHV68 in the host. Characterizing the role for p50 in MHV68-infected B cells could be realized only in the context of a p50-sufficient host. Therefore, mixed p50+/+/p50−/− BM chimeras were generated in a WT host such that p50−/− B cells were the minority population, thereby minimizing the impact on the overall immune response of the animal. As expected, the infection and generation of p50+/+/p50−/− BM chimeras resulted in a restoration of virus control during acute replication and the production of antiviral antibodies. During both early and late phases of chronic infection, an examination of the frequency of viral genome-positive cells revealed a ca. 10-fold-lower frequency of latency in the p50−/− cells at all time points. This demonstrated a defect in the ability of the p50−/− B compartment to compete with p50+/+ B cells as a latency reservoir for MHV68. The finding of a role for p50 in the establishment of MHV68 latency substantiates and extends our previous identification of the NF-κB signaling pathway as a critical element of latency establishment using the IκBαM-transgenic virus approach (46). MHV68 latency is intimately tied to B-cell differentiation. MHV68 is found predominantly in the spleen in proliferating B cells undergoing a germinal center reaction, ultimately establishing a latent program in isotype class-switched memory B cells (27, 50, 55, 87). In the mixed BM chimeric mice, p50−/− B cells exhibited intrinsic defects in activation and germinal center participation. B cells lacking p50 have a higher turnover rate in vivo and have decreased survival in culture (38, 60). Thus, NF-κB signaling might be critical for responding to activation cues, such as CD40 or engagement by surface Ig/B-cell receptor, that mediate proliferative expansion and survival during a germinal center reaction, consistent with the requirement for CD40 to maintain MHV68 latency (45). The cues and signals that lead to p50 activation, and the transcriptional and functional consequences of that activation in the infected B cell, have not been defined. Interestingly, p50−/− B cells in mixed BM chimeras have similar defects in B-cell responses that correspond to a defect in MHV68 latency, as was also observed in MyD88−/− and CD40−/− cell populations in mixed BM chimeric mice (33, 45). This identifies two upstream pathways leading to NF-κB activation that have critical roles in MHV68 latency. Interestingly, the inefficient establishment of latency in p50−/− B cells of the BM chimeras at the onset of splenic latency differs from the latency phenotype of CD40−/− B cells in CD40+/+/CD40−/− mixed BM chimeric mice. CD40−/− B cells were found to support latency at an early time point but diminished in frequency over time (45). This suggests that NF-κB p50 plays a critical role that precedes CD40-driven NF-κB activation and germinal center functions. Furthermore, while we uncovered a substantial defect in latency in B cells lacking p50, there remains a population of MHV68-infected p50−/− B cells at late times postinfection. The failure to completely abrogate latency in the absence of single virus or host factors suggests that there are numerous pathways and/or multiple reservoirs in the host. A p50−/− cell that is able to support latency might be complemented by other NF-κB subunits activated via the canonical and/or alternative pathways. Alternatively, the p50−/− cell population might result from the direct infection of a fully differentiated, quiescent cell, or it might merely represent a snapshot of ongoing de novo infections stemming from reactivation or persistence in a distal latency reservoir. Future studies will more closely examine phenotypic differences of infected p50−/− cells versus their infected p50+/+ counterparts with the aim of discerning differences in the viral latency program and the status of the infected cell. An additional novel finding in the p50+/+/p50−/− mixed BM chimeras was the presence of persistent MHV68 replication in the lungs at late times postinfection, albeit at levels slightly lower than those observed in p50−/− mice. Infectious virus was found intermittently in immunocompetent control mice but was consistently undetectable in the lungs of these mice at ≥3 months of infection. Notably, we did not observe an increase in ex vivo reactivation of p50−/− B cells isolated from the spleen; however, we also did not detect any persistent virus replication in the spleens of these animals, indicating that the anatomical site plays a major role in this phenomenon (e.g., the microenvironment of the lungs is likely quite distinct from that of the spleen). As such, lung tissue might lack factors such as CD40/CD40L interactions that mediate repression from reactivation, thus creating an environment more conducive to gammaherpesvirus reactivation (67). In addition, the transcriptional consequence of p50 activation in a latently infected B cell likely varies with the stimuli encountered. Interestingly, vFLIP inhibits viral gene expression and RTA transactivation during reactivation from 293 cells indirectly through NF-κB-mediated repression of AP1 (89, 90). Also, the KSHV vGPCR inhibits lytic viral gene expression from lymphoma cells, providing additional support for a role for NF-κB in promoting the maintenance of latency (10). The p50−/− hematopoietically derived cell reservoir that is the source for reactivation and/or persistent virus replication is most likely B lymphocytes, but other latent reservoirs such as macrophages and dendritic cells may be involved (28). For instance, infected MyD88−/− mice exhibit hyperreactivation from the peritoneal exudate cells, which consist primarily of macrophages (33). Understanding how gammaherpesviruses utilize and manipulate host responses continues to provide fundamental insights into pathways that are involved in disease progression and has the potential to identify novel targets for antiviral therapies. NF-κB signaling is critical to the survival and transformation of cells infected by the human gammaherpesviruses EBV and KSHV. Here, we have identified NF-κB p50 as a critical component of the NF-κB signaling pathway that controls the establishment and maintenance of MHV68 latency in a tissue-dependent manner. The analyses provide an impetus for further studies to identify virus and host genes regulated by NF-κB p50 in different tissues during chronic MHV68 infection. Acknowledgments We thank Robert Karaffa for expertise and assistance with flow cytometry and members of the Speck laboratory for helpful discussions and critical reading of the manuscript. We thank Clinton R. Paden and Soojung Park for technical assistance. This research was supported by NIH grant R01 CA95318 to S.H.S. S.H.S. was also supported by NIH grants R01 CA43143, CA52004, CA58524, and AI58057. L.T.K. was supported by NIH Ruth L. Kirschstein National Research Service Award F32 AI066818. Footnotes Published ahead of print on 4 March 2009.REFERENCES 1. An, J., Y. Sun, R. Sun, and M. B. Rettig. 2003. Kaposi's sarcoma-associated herpesvirus encoded vFLIP induces cellular IL-6 expression: the role of the NF-kappaB and JNK/AP1 pathways. Oncogene 223371-3385. [PubMed] 2. Artis, D., K. Speirs, K. Joyce, M. Goldschmidt, J. Caamaño, C. A. Hunter, and P. Scott. 2003. NF-kappa B1 is required for optimal CD4+ Th1 cell development and resistance to Leishmania major. J. Immunol. 1701995-2003. [PubMed] 3. Arvanitakis, L., E. Geras-Raaka, A. Varma, M. C. Gershengorn, and E. Cesarman. 1997. Human herpesvirus KSHV encodes a constitutively active G-protein-coupled receptor linked to cell proliferation. Nature 385347-350. [PubMed] 4. Barton, E. S., M. L. Lutzke, R. Rochford, and H. W. T. Virgin. 2005. Alpha/beta interferons regulate murine gammaherpesvirus latent gene expression and reactivation from latency. J. Virol. 7914149-14160. [PubMed] 5. Beinke, S., and S. C. Ley. 2004. Functions of NF-kappaB1 and NF-kappaB2 in immune cell biology. Biochem. J. 382393-409. [PubMed] 6. Bossen, C., and P. Schneider. 2006. BAFF, APRIL and their receptors: structure, function and signaling. Semin. Immunol. 18263-275. [PubMed] 7. Braaten, D. C., J. S. McClellan, I. Messaoudi, S. A. Tibbetts, K. B. McClellan, J. Nikolich-Zugich, and H. W. Virgin. 2006. Effective control of chronic gamma-herpesvirus infection by unconventional MHC class Ia-independent CD8 T cells. PLoS Pathog. 2e37. [PubMed] 8. Brown, H. J., M. J. Song, H. Deng, T. T. Wu, G. Cheng, and R. Sun. 2003. NF-κB inhibits gammaherpesvirus lytic replication. J. Virol. 778532-8540. [PubMed] 9. Cahir-McFarland, E. D., D. M. Davidson, S. L. Schauer, J. Duong, and E. Kieff. 2000. NF-kappa B inhibition causes spontaneous apoptosis in Epstein-Barr virus-transformed lymphoblastoid cells. Proc. Natl. Acad. Sci. USA 976055-6660. [PubMed] 10. Cannon, M., E. Cesarman, and C. Boshoff. 2006. KSHV G protein-coupled receptor inhibits lytic gene transcription in primary-effusion lymphoma cells via p21-mediated inhibition of Cdk2. Blood 107277-284. [PubMed] 11. Cardin, R. D., J. W. Brooks, S. R. Sarawar, and P. C. Doherty. 1996. Progressive loss of CD8+ T cell-mediated control of a gamma-herpesvirus in the absence of CD4+ T cells. J. Exp. Med. 184863-871. [PubMed] 12. Chang, H., Y. Gwack, D. Kingston, J. Souvlis, X. Liang, R. E. Means, E. Cesarman, L. Hutt-Fletcher, and J. U. Jung. 2005. Activation of CD21 and CD23 gene expression by Kaposi's sarcoma-associated herpesvirus RTA. J. Virol. 794651-4663. [PubMed] 13. Cheng, D. S., W. Han, S. M. Chen, T. P. Sherrill, M. Chont, G. Y. Park, J. R. Sheller, V. V. Polosukhin, J. W. Christman, F. E. Yull, and T. S. Blackwell. 2007. Airway epithelium controls lung inflammation and injury through the NF-kappa B pathway. J. Immunol. 1786504-6513. [PubMed] 14. Chugh, P., H. Matta, S. Schamus, S. Zachariah, A. Kumar, J. A. Richardson, A. L. Smith, and P. M. Chaudhary. 2005. Constitutive NF-kappaB activation, normal Fas-induced apoptosis, and increased incidence of lymphoma in human herpes virus 8 K13 transgenic mice. Proc. Natl. Acad. Sci. USA 10212885-12890. [PubMed] 15. Clambey, E. T., H. W. T. Virgin, and S. H. Speck. 2002. Characterization of a spontaneous 9.5-kilobase-deletion mutant of murine gammaherpesvirus 68 reveals tissue-specific genetic requirements for latency. J. Virol. 766532-6544. [PubMed] 16. Claudio, E., K. Brown, S. Park, H. Wang, and U. Siebenlist. 2002. BAFF-induced NEMO-independent processing of NF-kappa B2 in maturing B cells. Nat. Immunol. 3958-965. [PubMed] 17. Coope, H. J., P. G. Atkinson, B. Huhse, M. Belich, J. Janzen, M. J. Holman, G. G. Klaus, L. H. Johnston, and S. C. Ley. 2002. CD40 regulates the processing of NF-kappaB2 p100 to p52. EMBO J. 215375-5385. [PubMed] 18. Damania, B. 2004. Modulation of cell signaling pathways by Kaposi's sarcoma-associated herpesvirus (KSHVHHV-8). Cell Biochem. Biophys. 40305-322. [PubMed] 19. de Lima, B. D., J. S. May, S. Marques, J. P. Simas, and P. G. Stevenson. 2005. Murine gammaherpesvirus 68 bcl-2 homologue contributes to latency establishment in vivo. J. Gen. Virol. 8631-40. [PubMed] 20. Dennis, A., T. Kudo, L. Kruidenier, F. Girard, V. F. Crepin, T. T. Macdonald, G. Frankel, and S. Wiles. 2008. The p50 subunit of NF-κB is critical for in vivo clearance of the noninvasive enteric pathogen Citrobacter rodentium. Infect. Immun. 764978-4988. [PubMed] 21. Doherty, P. C., J. P. Christensen, G. T. Belz, P. G. Stevenson, and M. Y. Sangster. 2001. Dissecting the host response to a gamma-herpesvirus. Philos. Trans. R. Soc. London B 356581-593. [PubMed] 22. Dutia, B. M., D. J. Allen, H. Dyson, and A. A. Nash. 1999. Type I interferons and IRF-1 play a critical role in the control of a gammaherpesvirus infection. Virology 261173-179. [PubMed] 23. Evans, A. G., J. M. Moser, L. T. Krug, V. Pozharskaya, A. L. Mora, and S. H. Speck. 2008. A gammaherpesvirus-secreted activator of Vbeta4+ CD8+ T cells regulates chronic infection and immunopathology. J. Exp. Med. 205669-684. [PubMed] 24. Everhart, M. B., W. Han, T. P. Sherrill, M. Arutiunov, V. V. Polosukhin, J. R. Burke, R. T. Sadikot, J. W. Christman, F. E. Yull, and T. S. Blackwell. 2006. Duration and intensity of NF-kappaB activity determine the severity of endotoxin-induced acute lung injury. J. Immunol. 1764995-5005. [PubMed] 25. Feng, B., S. Cheng, W. S. Pear, and H. C. Liou. 2004. NF-kB inhibitor blocks B cell development at two checkpoints. Med. Immunol. 31. [PubMed] 26. Ferguson, A. R., and R. B. Corley. 2005. Accumulation of marginal zone B cells and accelerated loss of follicular dendritic cells in NF-kappaB p50-deficient mice. BMC Immunol. 68. [PubMed] 27. Flano, E., I. J. Kim, D. L. Woodland, and M. A. Blackman. 2002. Gamma-herpesvirus latency is preferentially maintained in splenic germinal center and memory B cells. J. Exp. Med. 1961363-1372. [PubMed] 28. Flano, E., I. J. Kim, J. Moore, D. L. Woodland, and M. A. Blackman. 2003. Differential gamma-herpesvirus distribution in distinct anatomical locations and cell subsets during persistent infection in mice. J. Immunol. 1703828-3834. [PubMed] 29. Forrest, J. C., L. T. Krug, and S. H. Speck. 2008. Murine gammaherpesvirus 68 infection of mice: a small animal model for characterizing basic aspects of gamma-herpesvirus pathogenesis, p. 735-775. In B. Damania and J. Pipas (ed.), DNA tumor viruses. Springer, New York, NY. 30. Franzoso, G., L. Carlson, L. Poljak, E. W. Shores, S. Epstein, A. Leonardi, A. Grinberg, T. Tran, T. Scharton-Kersten, M. Anver, P. Love, K. Brown, and U. Siebenlist. 1998. Mice deficient in nuclear factor (NF)-kappa B/p52 present with defects in humoral responses, germinal center reactions, and splenic microarchitecture. J. Exp. Med. 187147-159. [PubMed] 31. Fuse, S., J. J. Obar, S. Bellfy, E. K. Leung, W. Zhang, and E. J. Usherwood. 2006. CD80 and CD86 control antiviral CD8+ T-cell function and immune surveillance of murine gammaherpesvirus 68. J. Virol. 809159-9170. [PubMed] 32. Gangappa, S., S. B. Kapadia, S. H. Speck, and H. W. T. Virgin. 2002. Antibody to a lytic cycle viral protein decreases gammaherpesvirus latency in B-cell-deficient mice. J. Virol. 7611460-11468. [PubMed] 33. Gargano, L. M., J. M. Moser, and S. H. Speck. 2008. Role for MyD88 signaling in murine gammaherpesvirus 68 latency. J. Virol. 823853-3863. [PubMed] 34. Giannoni, F., A. Shea, C. Inglis, L. N. Lee, and S. R. Sarawar. 2008. CD40 engagement on dendritic cells, but not on B or T cells, is required for long-term control of murine gammaherpesvirus 68. J. Virol. 8211016-11022. [PubMed] 35. Grimm, T., S. Schneider, E. Naschberger, J. Huber, E. Guenzi, A. Kieser, P. Reitmeir, T. F. Schulz, C. A. Morris, and M. Stürzl. 2005. EBV latent membrane protein-1 protects B cells from apoptosis by inhibition of BAX. Blood 1053263-3269. [PubMed] 36. Grossmann, C., and D. Ganem. 2008. Effects of NFkappaB activation on KSHV latency and lytic reactivation are complex and context-dependent. Virology 37594-102. [PubMed] 37. Grossmann, C., S. Podgrabinska, M. Skobe, and D. Ganem. 2006. Activation of NF-κB by the latent vFLIP gene of Kaposi's sarcoma-associated herpesvirus is required for the spindle shape of virus-infected endothelial cells and contributes to their proinflammatory phenotype. J. Virol. 807179-7185. [PubMed] 38. Grumont, R. J., I. J. Rourke, L. A. O'Reilly, A. Strasser, K. Miyake, W. Sha, and S. Gerondakis. 1998. B lymphocytes differentially use the Rel and nuclear factor kappaB1 (NF-kappaB1) transcription factors to regulate cell cycle progression and apoptosis in quiescent and mitogen-activated cells. J. Exp. Med. 187663-674. [PubMed] 39. Guasparri, I., S. A. Keller, and E. Cesarman. 2004. KSHV vFLIP is essential for the survival of infected lymphoma cells. J. Exp. Med. 199993-1003. [PubMed] 40. Hiscott, J., H. Kwon, and P. Génin. 2001. Hostile takeovers: viral appropriation of the NF-kappaB pathway. J. Clin. Investig. 107143-151. [PubMed] 41. Jensen, K. K., D. J. Manfra, M. G. Grisotto, A. P. Martin, G. Vassileva, K. Kelley, T. W. Schwartz, and S. A. Lira. 2005. The human herpes virus 8-encoded chemokine receptor is required for angioproliferation in a murine model of Kaposi's sarcoma. J. Immunol. 1743686-3694. [PubMed] 42. Kalled, S. L. 2006. Impact of the BAFF/BR3 axis on B cell survival, germinal center maintenance and antibody production. Semin. Immunol. 18290-296. [PubMed] 43. Keller, S. A., D. Hernandez-Hopkins, J. Vider, V. Ponomarev, E. Hyjek, E. J. Schattner, and E. Cesarman. 2006. NF-kappaB is essential for the progression of KSHV- and EBV-infected lymphomas in vivo. Blood 1073295-3302. [PubMed] 44. Keller, S. A., E. J. Schattner, and E. Cesarman. 2000. Inhibition of NF-kappaB induces apoptosis of KSHV-infected primary effusion lymphoma cells. Blood 962537-2542. [PubMed] 45. Kim, I. J., E. Flano, D. L. Woodland, F. E. Lund, T. D. Randall, and M. A. Blackman. 2003. Maintenance of long term gamma-herpesvirus B cell latency is dependent on CD40-mediated development of memory B cells. J. Immunol. 171886-892. [PubMed] 46. Krug, L. T., J. M. Moser, S. M. Dickerson, and S. H. Speck. 2007. Inhibition of NF-kappaB activation in vivo impairs establishment of gammaherpesvirus latency. PLoS Pathog. 3e11. [PubMed] 47. Lee, B. J., U. H. Koszinowski, S. R. Sarawar, and H. Adler. 2003. A gammaherpesvirus G protein-coupled receptor homologue is required for increased viral replication in response to chemokines and efficient reactivation from latency. J. Immunol. 170243-251. [PubMed] 48. Lyon, A. B., and S. R. Sarawar. 2006. Differential requirement for CD28 and CD80/86 pathways of costimulation in the long-term control of murine gammaherpesvirus-68. Virology 35650-56. [PubMed] 49. Majumder, P., J. A. Gomez, and J. M. Boss. 2006. The human major histocompatibility complex class II HLA-DRB1 and HLA-DQA1 genes are separated by a CTCF-binding enhancer-blocking element. J. Biol. Chem. 28118435-18443. [PubMed] 50. Marques, S., S. Efstathiou, K. G. Smith, M. Haury, and J. P. Simas. 2003. Selective gene expression of latent murine gammaherpesvirus 68 in B lymphocytes. J. Virol. 777308-7318. [PubMed] 51. Martin, D., R. Galisteo, Y. Ji, S. Montaner, and J. S. Gutkind. 2008. An NF-kappaB gene expression signature contributes to Kaposi's sarcoma virus vGPCR-induced direct and paracrine neoplasia. Oncogene 271844-1852. [PubMed] 52. Montaner, S., A. Sodhi, A. Molinolo, T. H. Bugge, E. T. Sawai, Y. He, Y. Li, P. E. Ray, and J. S. Gutkind. 2003. Endothelial infection with KSHV genes in vivo reveals that vGPCR initiates Kaposi's sarcomagenesis and can promote the tumorigenic potential of viral latent genes. Cancer Cell 323-36. [PubMed] 53. Moorman, N. J., H. W. T. Virgin, and S. H. Speck. 2003. Disruption of the gene encoding the gammaHV68 v-GPCR leads to decreased efficiency of reactivation from latency. Virology 307179-190. [PubMed] 54. Moorthy, A. K., O. V. Savinova, J. Q. Ho, V. Y. Wang, D. Vu, and G. Ghosh. 2006. The 20S proteasome processes NF-kappaB1 p105 into p50 in a translation-independent manner. EMBO J. 251945-1956. [PubMed] 55. Moser, J. M., J. W. Upton, R. D. Allen III, C. B. Wilson, and S. H. Speck. 2005. Role of B-cell proliferation in the establishment of gammaherpesvirus latency. J. Virol. 799480-9491. [PubMed] 56. Nash, A. A., B. M. Dutia, J. P. Stewart, and A. J. Davison. 2001. Natural history of murine gamma-herpesvirus infection. Philos. Trans. R. Soc. London B 356569-579. [PubMed] 57. Pantano, C., J. L. Ather, J. F. Alcorn, M. E. Poynter, A. L. Brown, A. S. Guala, S. L. Beuschel, G. B. Allen III, L. A. Whittaker, M. Bevelander, and others. 2008. Nuclear factor kappa B activation in airway epithelium induces inflammation and hyperresponsiveness. Am. J. Respir. Crit. Care Med. 177959-969. [PubMed] 58. Pasparakis, M., T. Luedde, and M. Schmidt-Supprian. 2006. Dissection of the NF-kappaB signalling cascade in transgenic and knockout mice. Cell Death Differ. 13861-872. [PubMed] 59. Pereira, S. G., and F. Oakley. 2008. Nuclear factor-kappaB1: regulation and function. Int. J. Biochem. Cell Biol. 401425-1430. [PubMed] 60. Pohl, T., R. Gugasyan, R. J. Grumont, A. Strasser, D. Metcalf, D. Tarlinton, W. Sha, D. Baltimore, and S. Gerondakis. 2002. The combined absence of NF-kappa B1 and c-Rel reveals that overlapping roles for these transcription factors in the B cell lineage are restricted to the activation and function of mature cells. Proc. Natl. Acad. Sci. USA 994514-4519. [PubMed] 61. Pollock, J. L., and H. W. T. Virgin. 1995. Latency, without persistence, of murine cytomegalovirus in the spleen and kidney. J. Virol. 691762-1768. [PubMed] 62. Rastelli, J., C. Hömig-Hölzel, J. Seagal, W. Müller, A. C. Hermann, K. Rajewsky, and U. Zimber-Strobl. 2008. LMP1 signaling can replace CD40 signaling in B cells in vivo and has unique features of inducing class-switch recombination to IgG1. Blood 1111448-1455. [PubMed] 63. Sadagopan, S., N. Sharma-Walia, M. V. Veettil, H. Raghu, R. Sivakumar, V. Bottero, and B. Chandran. 2007. Kaposi's sarcoma-associated herpesvirus induces sustained NF-κB activation during de novo infection of primary human dermal microvascular endothelial cells that is essential for viral gene expression. J. Virol. 813949-3968. [PubMed] 64. Sadikot, R. T., H. Zeng, M. Joo, M. B. Everhart, T. P. Sherrill, B. Li, D. S. Cheng, F. E. Yull, J. W. Christman, and T. S. Blackwell. 2006. Targeted immunomodulation of the NF-kappaB pathway in airway epithelium impacts host defense against Pseudomonas aeruginosa. J. Immunol. 1764923-4930. [PubMed] 65. Santoro, M. G., A. Rossi, and C. Amici. 2003. NF-kappaB and virus infection: who controls whom. EMBO J. 222552-2560. [PubMed] 66. Sarawar, S. R., B. J. Lee, and F. Giannoni. 2004. Cytokines and costimulatory molecules in the immune response to murine gammaherpesvirus-68. Viral Immunol. 173-11. [PubMed] 67. Sarawar, S. R., B. J. Lee, S. K. Reiter, and S. P. Schoenberger. 2001. Stimulation via CD40 can substitute for CD4 T cell function in preventing reactivation of a latent herpesvirus. Proc. Natl. Acad. Sci. USA 986325-6329. [PubMed] 68. Sarawar, S. R., R. D. Cardin, J. W. Brooks, M. Mehrpooya, R. A. Tripp, and P. C. Doherty. 1996. Cytokine production in the immune response to murine gammaherpesvirus 68. J. Virol. 703264-3268. [PubMed] 69. Schwarz, M., and P. M. Murphy. 2001. Kaposi's sarcoma-associated herpesvirus G protein-coupled receptor constitutively activates NF-kappa B and induces proinflammatory cytokine and chemokine production via a C-terminal signaling determinant. J. Immunol. 167505-513. [PubMed] 70. Sha, W. C., H. C. Liou, E. I. Tuomanen, and D. Baltimore. 1995. Targeted disruption of the p50 subunit of NF-kappa B leads to multifocal defects in immune responses. Cell 80321-330. [PubMed] 71. Simas, J. P., S. Marques, A. Bridgeman, S. Efstathiou, and H. Adler. 2004. The M2 gene product of murine gammaherpesvirus 68 is required for efficient colonization of splenic follicles but is not necessary for expansion of latently infected germinal centre B cells. J. Gen. Virol. 852789-2797. [PubMed] 72. Snapper, C. M., P. Zelazowski, F. R. Rosas, M. R. Kehry, M. Tian, D. Baltimore, and W. C. Sha. 1996. B cells from p50/NF-kappa B knockout mice have selective defects in proliferation, differentiation, germ-line CH transcription, and Ig class switching. J. Immunol. 156183-191. [PubMed] 73. Stewart, J. P., E. J. Usherwood, A. Ross, H. Dyson, and T. Nash. 1998. Lung epithelial cells are a major site of murine gammaherpesvirus persistence. J. Exp. Med. 1871941-1951. [PubMed] 74. Suárez, A. L., and L. F. van Dyk. 2008. Endothelial cells support persistent gammaherpesvirus 68 infection. PLoS Pathog 4e1000152. [PubMed] 75. Tarakanova, V. L., F. Suarez, S. A. Tibbetts, M. A. Jacoby, K. E. Weck, J. L. Hess, S. H. Speck, and H. W. Virgin. 2005. Murine gammaherpesvirus 68 infection is associated with lymphoproliferative disease and lymphoma in BALB β2 microglobulin-deficient mice. J. Virol. 7914668-14679. [PubMed] 76. Tibbetts, S. A., J. S. McClellan, S. Gangappa, S. H. Speck, and H. W. T. Virgin. 2003. Effective vaccination against long-term gammaherpesvirus latency. J. Virol. 772522-2529. [PubMed] 77. Uchida, J., T. Yasui, Y. Takaoka-Shichijo, M. Muraoka, W. Kulwichit, N. Raab-Traub, and H. Kikutani. 1999. Mimicry of CD40 signals by Epstein-Barr virus LMP1 in B lymphocyte responses. Science 286300-303. [PubMed] 78. Usherwood, E. J., J. P. Stewart, and A. A. Nash. 1996. Characterization of tumor cell lines derived from murine gammaherpesvirus-68-infected mice. J. Virol. 706516-6518. [PubMed] 79. van Dyk, L. F., H. W. T. Virgin, and S. H. Speck. 2003. Maintenance of gammaherpesvirus latency requires viral cyclin in the absence of B lymphocytes. J. Virol. 775118-5126. [PubMed] 80. Vart, R. J., L. L. Nikitenko, D. Lagos, M. W. Trotter, M. Cannon, D. Bourboulia, F. Gratrix, Y. Takeuchi, and C. Boshoff. 2007. Kaposi's sarcoma-associated herpesvirus-encoded interleukin-6 and G-protein-coupled receptor regulate angiopoietin-2 expression in lymphatic endothelial cells. Cancer Res. 674042-4051. [PubMed] 81. Verzijl, D., C. P. Fitzsimons, M. van Dijk, J. P. Stewart, H. Timmerman, M. J. Smit, and R. Leurs. 2004. Differential activation of murine herpesvirus 68-and Kaposi's sarcoma-associated herpesvirus-encoded ORF74 G protein-coupled receptors by human and murine chemokines. J. Virol. 783343-3351. [PubMed] 82. Wang, L., R. Wuerffel, and A. L. Kenter. 2006. NF-kappa B binds to the immunoglobulin S gamma 3 region in vivo during class switch recombination. Eur. J. Immunol. 363315-3323. [PubMed] 83. Weck, K. E., A. J. Dal Canto, J. D. Gould, A. K. O'Guin, K. A. Roth, J. E. Saffitz, S. H. Speck, and H. W. Virgin. 1997. Murine gamma-herpesvirus 68 causes severe large-vessel arteritis in mice lacking interferon-gamma responsiveness: a new model for virus-induced vascular disease. Nat. Med. 31346-1353. [PubMed] 84. Weck, K. E., M. L. Barkon, L. I. Yoo, S. H. Speck, and H. I. Virgin. 1996. Mature B cells are required for acute splenic infection, but not for establishment of latency, by murine gammaherpesvirus 68. J. Virol. 706775-6780. [PubMed] 85. Weck, K. E., S. S. Kim, H. I. Virgin, and S. H. Speck. 1999. B cells regulate murine gammaherpesvirus 68 latency. J. Virol. 734651-4661. [PubMed] 86. Weck, K. E., S. S. Kim, H. I. Virgin, and S. H. Speck. 1999. Macrophages are the major reservoir of latent murine gammaherpesvirus 68 in peritoneal cells. J. Virol. 733273-3283. [PubMed] 87. Willer, D. O., and S. H. Speck. 2003. Long-term latent murine gammaherpesvirus 68 infection is preferentially found within the surface immunoglobulin D-negative subset of splenic B cells in vivo. J. Virol. 778310-8321. [PubMed] 88. Willer, D. O., and S. H. Speck. 2005. Establishment and maintenance of long-term murine gammaherpesvirus 68 latency in B cells in the absence of CD40. J. Virol. 792891-2899. [PubMed] 89. Ye, F. C., F. C. Zhou, J. P. Xie, T. Kang, W. Greene, K. Kuhne, X. F. Lei, Q. H. Li, and S. J. Gao. 2008. Kaposi's sarcoma-associated herpesvirus latent gene vFLIP inhibits viral lytic replication through NF-κB-mediated suppression of the AP-1 pathway: a novel mechanism of virus control of latency. J. Virol. 824235-4249. [PubMed] 90. Zhao, J., V. Punj, H. Matta, L. Mazzacurati, S. Schamus, Y. Yang, T. Yang, Y. Hong, and P. M. Chaudhary. 2007. K13 blocks KSHV lytic replication and deregulates vIL6 and hIL6 expression: a model of lytic replication induced clonal selection in viral oncogenesis. PLoS One 2e1067. [PubMed] 91. Zhong, H., M. J. May, E. Jimi, and S. Ghosh. 2002. The phosphorylation status of nuclear NF-kappa B determines its association with CBP/p300 or HDAC-1. Mol. Cell 9625-636. [PubMed] 92. Zou, P., J. Kawada, L. Pesnicak, and J. I. Cohen. 2007. Bortezomib induces apoptosis of Epstein-Barr virus (EBV)-transformed B cells and prolongs survival of mice inoculated with EBV-transformed B cells. J. Virol. 8110029-10036. [PubMed] |
PubMed related articles
Your browsing activity is empty. Activity recording is turned off. |
|||||||||||||||||||||||
Philos Trans R Soc Lond B Biol Sci. 2001 Apr 29; 356(1408):581-93.
[Philos Trans R Soc Lond B Biol Sci. 2001]Philos Trans R Soc Lond B Biol Sci. 2001 Apr 29; 356(1408):569-79.
[Philos Trans R Soc Lond B Biol Sci. 2001]J Virol. 2005 Dec; 79(23):14668-79.
[J Virol. 2005]J Exp Med. 2002 Nov 18; 196(10):1363-72.
[J Exp Med. 2002]J Virol. 2003 Aug; 77(15):8310-21.
[J Virol. 2003]Cell Biochem Biophys. 2004; 40(3):305-22.
[Cell Biochem Biophys. 2004]J Clin Invest. 2001 Jan; 107(2):143-51.
[J Clin Invest. 2001]EMBO J. 2003 Jun 2; 22(11):2552-60.
[EMBO J. 2003]Blood. 2005 Apr 15; 105(8):3263-9.
[Blood. 2005]Blood. 2008 Feb 1; 111(3):1448-55.
[Blood. 2008]J Exp Med. 2002 Nov 18; 196(10):1363-72.
[J Exp Med. 2002]J Virol. 2003 Jul; 77(13):7308-18.
[J Virol. 2003]J Virol. 2005 Aug; 79(15):9480-91.
[J Virol. 2005]J Virol. 2003 Aug; 77(15):8310-21.
[J Virol. 2003]PLoS Pathog. 2007 Jan; 3(1):e11.
[PLoS Pathog. 2007]Cell Death Differ. 2006 May; 13(5):861-72.
[Cell Death Differ. 2006]Biochem J. 2004 Sep 1; 382(Pt 2):393-409.
[Biochem J. 2004]Med Immunol. 2004 Mar 29; 3(1):1.
[Med Immunol. 2004]J Exp Med. 1998 Mar 2; 187(5):663-74.
[J Exp Med. 1998]Semin Immunol. 2006 Oct; 18(5):263-75.
[Semin Immunol. 2006]EMBO J. 2006 May 3; 25(9):1945-56.
[EMBO J. 2006]Int J Biochem Cell Biol. 2008; 40(8):1425-30.
[Int J Biochem Cell Biol. 2008]Mol Cell. 2002 Mar; 9(3):625-36.
[Mol Cell. 2002]Proc Natl Acad Sci U S A. 2002 Apr 2; 99(7):4514-9.
[Proc Natl Acad Sci U S A. 2002]Cell. 1995 Jan 27; 80(2):321-30.
[Cell. 1995]J Virol. 1996 Oct; 70(10):6775-80.
[J Virol. 1996]J Biol Chem. 2006 Jul 7; 281(27):18435-43.
[J Biol Chem. 2006]J Virol. 1995 Mar; 69(3):1762-8.
[J Virol. 1995]J Virol. 2002 Jul; 76(13):6532-44.
[J Virol. 2002]J Virol. 1999 Jun; 73(6):4651-61.
[J Virol. 1999]J Virol. 1999 Jun; 73(6):4651-61.
[J Virol. 1999]J Virol. 1999 Apr; 73(4):3273-83.
[J Virol. 1999]J Virol. 1996 Sep; 70(9):6516-8.
[J Virol. 1996]PLoS Pathog. 2007 Jan; 3(1):e11.
[PLoS Pathog. 2007]PLoS Pathog. 2007 Jan; 3(1):e11.
[PLoS Pathog. 2007]J Exp Med. 2002 Nov 18; 196(10):1363-72.
[J Exp Med. 2002]J Virol. 2003 Jul; 77(13):7308-18.
[J Virol. 2003]J Virol. 2005 Aug; 79(15):9480-91.
[J Virol. 2005]J Virol. 2003 Aug; 77(15):8310-21.
[J Virol. 2003]J Exp Med. 2002 Nov 18; 196(10):1363-72.
[J Exp Med. 2002]J Virol. 2003 Jul; 77(13):7308-18.
[J Virol. 2003]J Virol. 2005 Aug; 79(15):9480-91.
[J Virol. 2005]J Virol. 2003 Aug; 77(15):8310-21.
[J Virol. 2003]J Exp Med. 1996 Sep 1; 184(3):863-71.
[J Exp Med. 1996]J Exp Med. 1998 Jun 15; 187(12):1941-51.
[J Exp Med. 1998]J Virol. 2005 Mar; 79(5):2891-9.
[J Virol. 2005]J Virol. 2003 May; 77(9):5118-26.
[J Virol. 2003]J Exp Med. 1998 Mar 2; 187(5):663-74.
[J Exp Med. 1998]Proc Natl Acad Sci U S A. 2002 Apr 2; 99(7):4514-9.
[Proc Natl Acad Sci U S A. 2002]Cell. 1995 Jan 27; 80(2):321-30.
[Cell. 1995]J Virol. 2002 Nov; 76(22):11460-8.
[J Virol. 2002]Virology. 2006 Dec 5-20; 356(1-2):50-6.
[Virology. 2006]Proc Natl Acad Sci U S A. 2002 Apr 2; 99(7):4514-9.
[Proc Natl Acad Sci U S A. 2002]J Exp Med. 2008 Mar 17; 205(3):669-84.
[J Exp Med. 2008]PLoS Pathog. 2006 May; 2(5):e37.
[PLoS Pathog. 2006]J Exp Med. 2002 Nov 18; 196(10):1363-72.
[J Exp Med. 2002]Philos Trans R Soc Lond B Biol Sci. 2001 Apr 29; 356(1408):569-79.
[Philos Trans R Soc Lond B Biol Sci. 2001]J Virol. 2003 Aug; 77(15):8310-21.
[J Virol. 2003]J Gen Virol. 2005 Jan; 86(Pt 1):31-40.
[J Gen Virol. 2005]PLoS Pathog. 2007 Jan; 3(1):e11.
[PLoS Pathog. 2007]J Exp Med. 1996 Sep 1; 184(3):863-71.
[J Exp Med. 1996]J Virol. 2002 Nov; 76(22):11460-8.
[J Virol. 2002]Virology. 2006 Dec 5-20; 356(1-2):50-6.
[Virology. 2006]J Virol. 2005 Mar; 79(5):2891-9.
[J Virol. 2005]J Virol. 2003 Aug; 77(15):8532-40.
[J Virol. 2003]J Virol. 2003 Aug; 77(15):8532-40.
[J Virol. 2003]J Exp Med. 2004 Apr 5; 199(7):993-1003.
[J Exp Med. 2004]PLoS Pathog. 2007 Jan; 3(1):e11.
[PLoS Pathog. 2007]J Virol. 2003 Aug; 77(15):8532-40.
[J Virol. 2003]Proc Natl Acad Sci U S A. 2000 May 23; 97(11):6055-60.
[Proc Natl Acad Sci U S A. 2000]Virology. 2008 May 25; 375(1):94-102.
[Virology. 2008]Oncogene. 2008 Mar 20; 27(13):1844-52.
[Oncogene. 2008]J Virol. 2007 Apr; 81(8):3949-68.
[J Virol. 2007]PLoS Pathog. 2007 Jan; 3(1):e11.
[PLoS Pathog. 2007]J Virol. 1996 Sep; 70(9):6516-8.
[J Virol. 1996]J Virol. 1999 Jun; 73(6):4651-61.
[J Virol. 1999]J Virol. 2006 Jul; 80(14):7179-85.
[J Virol. 2006]Oncogene. 2008 Mar 20; 27(13):1844-52.
[Oncogene. 2008]J Virol. 2005 Nov; 79(22):14149-60.
[J Virol. 2005]Virology. 1999 Sep 1; 261(2):173-9.
[Virology. 1999]Nat Med. 1997 Dec; 3(12):1346-53.
[Nat Med. 1997]Viral Immunol. 2004; 17(1):3-11.
[Viral Immunol. 2004]J Virol. 1996 May; 70(5):3264-8.
[J Virol. 1996]Cell. 1995 Jan 27; 80(2):321-30.
[Cell. 1995]Infect Immun. 2008 Nov; 76(11):4978-88.
[Infect Immun. 2008]J Immunol. 2007 May 15; 178(10):6504-13.
[J Immunol. 2007]J Virol. 2005 Apr; 79(8):4651-63.
[J Virol. 2005]BMC Immunol. 2005 Apr 18; 6(1):8.
[BMC Immunol. 2005]J Exp Med. 1996 Sep 1; 184(3):863-71.
[J Exp Med. 1996]Philos Trans R Soc Lond B Biol Sci. 2001 Apr 29; 356(1408):581-93.
[Philos Trans R Soc Lond B Biol Sci. 2001]J Virol. 2006 Sep; 80(18):9159-70.
[J Virol. 2006]Virology. 2006 Dec 5-20; 356(1-2):50-6.
[Virology. 2006]Viral Immunol. 2004; 17(1):3-11.
[Viral Immunol. 2004]J Exp Med. 1998 Jan 19; 187(2):147-59.
[J Exp Med. 1998]Cell. 1995 Jan 27; 80(2):321-30.
[Cell. 1995]J Immunol. 1996 Jan 1; 156(1):183-91.
[J Immunol. 1996]Eur J Immunol. 2006 Dec; 36(12):3315-23.
[Eur J Immunol. 2006]Int J Biochem Cell Biol. 2008; 40(8):1425-30.
[Int J Biochem Cell Biol. 2008]J Immunol. 2003 Feb 15; 170(4):1995-2003.
[J Immunol. 2003]J Exp Med. 1996 Sep 1; 184(3):863-71.
[J Exp Med. 1996]PLoS Pathog. 2006 May; 2(5):e37.
[PLoS Pathog. 2006]J Exp Med. 2008 Mar 17; 205(3):669-84.
[J Exp Med. 2008]J Gen Virol. 2004 Oct; 85(Pt 10):2789-97.
[J Gen Virol. 2004]PLoS Pathog. 2007 Jan; 3(1):e11.
[PLoS Pathog. 2007]J Exp Med. 2002 Nov 18; 196(10):1363-72.
[J Exp Med. 2002]J Virol. 2003 Jul; 77(13):7308-18.
[J Virol. 2003]J Virol. 2005 Aug; 79(15):9480-91.
[J Virol. 2005]J Virol. 2003 Aug; 77(15):8310-21.
[J Virol. 2003]J Exp Med. 1998 Mar 2; 187(5):663-74.
[J Exp Med. 1998]J Virol. 2008 Apr; 82(8):3853-63.
[J Virol. 2008]J Immunol. 2003 Jul 15; 171(2):886-92.
[J Immunol. 2003]Proc Natl Acad Sci U S A. 2001 May 22; 98(11):6325-9.
[Proc Natl Acad Sci U S A. 2001]J Virol. 2008 May; 82(9):4235-49.
[J Virol. 2008]PLoS One. 2007 Oct 24; 2(10):e1067.
[PLoS One. 2007]Blood. 2006 Jan 1; 107(1):277-84.
[Blood. 2006]J Immunol. 2003 Apr 1; 170(7):3828-34.
[J Immunol. 2003]