• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
Nature. Author manuscript; available in PMC Jul 15, 2009.
Published in final edited form as:
PMCID: PMC2679702
NIHMSID: NIHMS72865

Altered circadian rhythms regulate growth vigor in hybrids and allopolyploids

Abstract

Segregating hybrids and stable allopolyploids display morphological vigor1,2,3, and Arabidopsis allotetraploids are larger than the parents Arabidopsis thaliana and A. arenosa1,4. The mechanisms are unknown. Circadian clocks mediate metabolic pathways and increase fitness in animals and plants5,6,7,8. Here we report that epigenetic modifications of the circadian clock genes CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) and LATE ELONGATED HYPOCOTYL (LHY)9,10 and their reciprocal regulators TIMING OF CAB EXPRESSION 1 (TOC1) and GIGANTEA (GI)10,11,12 mediate expression changes in downstream genes and pathways. During the day, epigenetic repression of CCA1 and LHY induced expression of TOC1, GI and downstream genes that contain CCA1 binding site (CBS)13 in chlorophyll and starch metabolic pathways in allotetraploids and F1 hybrids, which produced more chlorophyll and starch than the parents in the same environment. Mutations in cca1 and cca1 lhy and daily repression of cca1 in TOC1:cca1-RNAi transgenic plants increased expression of downstream genes and chlorophyll and starch content, whereas constitutively expressing CCA1 or ectopically expressing TOC1:CCA1 had the opposite effects. The causal effects of CCA1 on output traits suggest that hybrids and allopolyploids gain advantages from the control of circadian-mediated physiological and metabolic pathways, leading to growth vigor and increased biomass.

Keywords: circadian clock, polyploidy, hybrid vigor, epigenetics, gene expression, biomass

Polyploidy (whole genome duplication) is an evolutionary innovation in many plants and some animals. Many important crops such as wheat, cotton, and canola are of allopolyploidy that contains two or more divergent genomes14,15, and some plants and animals exist as interspecific hybrids16. The common occurrence of polyploids suggests an evolutionary advantage of having additional genetic materials for growth and adaptation. Moreover, heterozygosity and novel genomic interactions in allopolyploids induce phenotypic variation and growth vigor15.

In stable allotetraploids that were resynthesized by interspecific hybridization between A. thaliana and A. arenosa (Supplementary Fig. 1)4, over 1,400 genes (>5% and up to 9,800 genes or ~38%) were nonadditively expressed1. Nonadditive expression indicates that the expression level of a gene in an allotetraploid is not equal to the sum of two parental loci (1 + 1 ≠ 2), leading to activation (>2), repression (<2), dominance, or overdominance15. Many genes in energy and metabolism including photosynthesis and starch pathways are upregulated1, coinciding with growth vigor in the allotetraploids. This morphological vigor is commonly observed17, and phenotypic variation among allotetraploids are related to genetic and epigenetic mechanisms15.

Among 128 genes upregulated in the allotetraploids, 86 (~67%) each contains at least one CBS (AAAAATCT) or evening element (EE, AAAATATCT)13 within the ~1,500-kbp upstream region (Supplementary Table 1), which is significantly higher than all genes containing putative EE and CBS (~15%, χ2 = 157 and P ≤ 2.2e−16). These EE- and CBS-containing genes are likely the targets of CCA1 and LHY9,18,19.

CCA1 and LHY are MYB-domain transcription factors and have partially redundant but incompletely overlapping functions9,10. They negatively regulate TOC1 and GI expression, whereas TOC1 and GI positively regulate CCA1 and LHY expression10,11,12. This circular feedback regulation affects central oscillation as well as input and output pathways that maintain the rhythms, amplitude and/or phase of circadian clock in Arabidopsis20. Disrupting oscillator control alters the expression of ~10% Arabidopsis genes13, while maintaining circadian clock regulation increases CO2 fixation, growth, and fitness5,8.

We found that CCA1 and LHY were repressed, and TOC1 and GI were upregulated at noon in the allotetraploids1. As in the parents, both CCA1 and LHY displayed diurnal expression patterns in the allotetraploids (Fig. 1a and Supplementary Fig. 2a and Table 2). Their expression peaked at dawn (ZT0), decreased 6 hours after dawn (ZT6), and continued declining until dusk (ZT15). Interestingly, CCA1 and LHY were expressed 2−4-fold lower in the allotetraploids than the mid-parent value (MPV) at ZT6−12 and higher than the MPV at dusk (ZT15). TOC1 and GI expression was inversely correlated with CCA1 and LHY expression (Fig. 1b and Supplementary Fig. 2b), suggesting feedback regulation in the allotetraploids as in the diploids10,11,12. However, TOC1 and GI expression fluctuated in the allotetraploids, indicating that other factors may be involved20. The expression changes of these genes from noon to dusk in the allotetraploids may alter the amplitude but not the phase of circadian clock, as they quickly gained the expression levels similar to MPV after dusk (ZT18−24).

Figure 1
Locus-specific and chromatin regulation of circadian clock genes in the allotetraploids. a. qRT-PCR analysis of CCA1 expression (n = 3, ACT2 as a control) in a 24-hour period (light/dark cycles) starting from dawn (ZT0, 6 am) (arrows indicate up- and ...

To determine how CCA1 and LHY expression was repressed, we examined expression patterns of A. thaliana and A. arenosa loci in the allotetraploids using RT-PCR and cleaved amplified polymorphic sequence (CAPS) analyses1 that are discriminative of locus-specific expression patterns (Supplementary Table 3). While A. thaliana and A. arenosa loci were equally expressed in respective parents, in two allotetraploids A. thaliana CCA1 (AtCCA1) expression was down-regulated ~3-fold, and A. arenosa CCA1 (AaCCA1) expression was slightly reduced (Fig. 1c). Similarly, AtLHY expression was dramatically reduced (~3.3-fold), whereas AaLHY expression was decreased ~2-fold in the allotetraploids. Conversely, AtTOC1 and AtGI loci were upregulated in the allotetraploids. The data suggest that A. thaliana genes are more sensitive to expression changes in the allotetraploids probably through cis- and trans-acting effects and chromatin modifications as observed in other loci17.

We examined chromatin changes in the upstream regions (~250-bp) of CCA1, LHY, TOC1, and GI (Supplementary Table 4) using antibodies against histone H3-Lys9 acetylation (H3K9Ac) and H3-Lys4 dimethylation (H3K4Me2), two marks for gene activation21. H3K9Ac and H3K4Me2 levels in the CCA1 and LHY promoters were 2−3-fold lower in the allotetraploids than that in A. thaliana and A. arenosa (Fig. 1d), consistent with CCA1 and LHY repression. Likewise, TOC1 and GI upregulation correlated with increased levels of H3K9Ac and H3K4Me2. Changes in H3K9Me2, a heterochromatic mark21, were undetectable (data not shown). These data suggest that diurnal expression changes of LHY, CCA1, TOC1, and GI are associated with euchromatic histone marks. Alternatively, autonomous pathways and other factors such as ELF4 may mediate TOC1 and GI expression20,22.

To test downstream effects of CCA1 and LHY repression, we examined expression of two subsets of EE/CBS-containing genes (Fig. 2a). One subset consists of the genes encoding protochlorophyllide (pchlide) oxidoreductases a and b, PORA and PORB, that mediate the only light-requiring step in chlorophyll biosynthesis in higher plants23. PORA and PORB are strongly expressed in seedlings and young leaves, and upregulation of PORA and PORB increases chlorophyll a and b content24. Both PORA and PORB were upregulated in the allotetraploids (Fig. 2d). The total chlorophyll content in both allotetraploids was ~60% higher than in A. thaliana and ~15% higher than in A. arenosa (Fig. 2b). Chlorophyll a increased more than chlorophyll b, and the allotetraploids accumulated ~70% more chlorophyll a than A. thaliana.

Figure 2
Increase in chlorophyll content and upregulation of the genes involved in chlorophyll and starch biosynthesis in allotetraploids. a. Locations of CCA1 binding site (CBS) or evening element (EE) in the downstream genes (Supplementary Table 1). Lower-case ...

The other subset of EE/CBS-containing genes encodes enzymes in starch metabolism and sugar transport25,26, many of which show strong diurnal rhythmic expression patterns13,27. Starch metabolism involves the genes encoding AMY3, BAM1, 2 and 3, DPE1 and 2, GTR, GWD1 and 3, ISA1, 2 and 3, LDA, MEX1, and PHS1 and 225,26 (Fig. 2c and Supplementary Table 5). Many contained EE/CBS (Fig. 2a) and were upregulated 1.5−4-fold in the allotetraploids (Fig. 2e), when CCA1 and LHY were down-regulated (Fig. 1, a and c). MTR and BAM3, 4 lacking EE/CBS showed little expression changes, suggesting that their expression is independent of clock regulation or undergoes post-transcriptional regulation26.

As a result, allotetraploids accumulated more starch than the parents in both mature and immature leaves using iodine-staining (Fig. 3a) and quantitative assays (Fig. 3b). In the mature leaves, allotetraploids accumulated starch 2-fold higher than A. thaliana and 70% higher than A. arenosa. In the immature leaves, allotetraploids contained 4-fold higher starch than A. thaliana and 50−100% higher sugar content than the parents (Fig. 3c), mainly due to increases in glucose and fructose content, suggesting high rates of starch and sugar accumulation in young leaves. The sucrose content in allotetraploids was similar to A. arenosa but higher than in A. thaliana in immature leaves and similar among all lines tested in mature leaves (data not shown), indicating rapid transport and metabolism of sucrose especially in the mature leaves. Together, chlorophyll, starch, and sugar amounts were consistently high in the allotetraploids.

Figure 3
CCA1 function and increased amounts of chlorophyll, starch and sugar in allotetraploids and F1 hybrids. a. Starch staining in A. thaliana (At4), A. arenosa (Aa), and allotetraploid (Allo733) at ZT0, ZT6, and ZT15. b. Increased starch content in allotetraploids ...

We further tested if circadian clock regulation is altered in F1 hybrids as in the interspecific hybrids and alloptetraploids. At ZT6 (noon), CCA1 and LHY were repressed ~2-fold, whereas TOC1 was upregulated ~2-fold in the F1 hybrids relative to the parents (C24 and Columbia) (Supplementary Fig. 3). At ZT15, CCA1 and LHY were upregulated, whereas TOC1 was repressed in the hybrids. The F1 hybrids displayed morphological vigor (Fig. 3d) and contained ~12% more total chlorophylls and ~10% more starch than the higher parent (Fig. 3e).

To determine how CCA1 regulates downstream genes and output traits, we examined CCA1 function in the allotetraploids and their parents. CCA1 protein levels in these lines were high at dawn (ZT0) and low at noon (ZT6) (Fig. 3f), corresponding to the CCA1 transcript levels (Fig. 1a). CCA1 levels were constantly high in A. thaliana constitutive CCA1-overexpression (CCA1-OX) lines18. Electrophoretic mobility shift assay (EMSA) indicated specific binding of recombinant CCA1 to EE-containing fragments of the target genes TOC1, PORB, PORA, DPE1, and GWD3 (Fig. 3g, Supplementary Fig. 4 and Table 6). Using antibodies against CCA1 in chromatin immunoprecipitation (ChIP) assays17, we further demonstrated that endogenous CCA1 in the TOC1 promoter was ~2.5-fold lower at ZT6 (noon) than at ZT0 (dawn) (Fig. 3h), which is inversely correlated with TOC1 expression levels that were higher at noon than at dawn (Fig. 1b).

These data collectively suggest that CCA1 directly affects TOC1 and downstream genes in clock regulation, photosynthesis, and starch metabolism. Clock dependent upregulation of output genes13,27 may lead to growth vigor. Indeed, overexpressing PORA and PORB increases chlorophyll content, seedling viability, and growth vigor in A. thaliana24, while mutants of starch metabolic genes display reduced starch content and growth vigor (ref.26).

If CCA1 repression promotes growth, CCA1 overexpression would reduce growth vigor in diploids. Indeed, TOC1:CCA1 transgenic plants expressing CCA1 under the clock-regulated TOC1 promoter (Supplemental Fig. 5) displayed 3-fold induction of CCA1 expression at noon (Fig. 4a) and 1.5−30-fold repression of the downstream genes PORA, PORB, AMY, DPE1, and GWD (Supplementary Fig. 6a), resulting in ~14% and ~17% reduction of chlorophyll and starch contents, respectively (Fig. 4a). CCA1-OX had ~20% reduction of chlorophyll content in seedlings (Supplementary Fig. 5c) and may affect various regulators in clock and other pathways related to growth vigor. For example, gi mutants in A. thaliana increase starch content and flower late28, but GI induction in the allotetraploids correlates with starch accumulation. CCA1-OX lines also flowered late18 and may increase chlorophyll and starch content in late stages.

Figure 4
A role of CCA1 in growth vigor in allotetraploids and hybrids. a. Relative expression levels (R.E.L.) of CCA1 (ZT6, left) and reduced chlorophyll (ZT9, middle) and starch (ZT15, right) accumulation in TOC1:CCA1 lines (n = 3) (Supplementary Fig. 4). Col(B): ...

To test whether CCA1 repression has positive effects on growth vigor in diploids as in the hybrids and allotetraploids (Fig. 2b and Fig. 3, a-e), we examined starch content in cca1 single and cca1 lhy double mutants9,22,29. CCA1 expression was not completely abolished in these mutants (Fig. 4b) probably because of the T-DNA insertion near the ATG codon29. The five downstream genes examined were upregulated 1.5−12.5-fold in the mutants (Supplementary Fig. 6b), and the starch content was doubled in the cca1 mutant (Fig. 4b). The starch content was lower in the double mutant than in cca1, indicating a metabolic penalty of severely lacking clock regulation5. Furthermore, to reduce CCA1 expression during the day, we expressed cca1-RNAi driven by the TOC1 promoter (Supplementary Fig. 6c). In the TOC1:cca1-RNAi transgenic plants, CCA1 mRNA and protein levels were down-regulated 2−10 fold (Fig. 4c, left) and 1.4−3 fold (right), respectively. Consequently, four downstream genes examined were upregulated in the TOC1:cca1-RNAi lines (Supplementary Fig. 6e), and the starch content increased ~28% (Fig. 4d). Taken together, the data suggest a mechanistic role of CCA1 repression in promoting downstream pathways, increasing chlorophyll and starch accumulation and growth vigor.

We propose a model that explains growth vigor and increased biomass in allotetraploids and hybrids (Fig. 4e). Correct circadian regulation enhances fitness and metabolism5,6,8. In the allotetraploids the expression of clock regulators is altered through autonomous regulation20 and chromatin modifications (Fig. 1d)15, including rhythmic changes in H3 acetylation in the TOC1 promoter30. During the day, A. thaliana CCA1 (and LHY) is epigenetically repressed, leading to upregulation of EE- and CBS-containing downstream genes in photosynthesis and carbohydrate metabolism. As a result, the entire network is reset at a high amplitude during the day, increasing chlorophyll synthesis and starch metabolism. At night CCA1 is derepressed and resumes normal oscillation. Although little is known about why the A. thaliana genes are repressed during the day15, the repression is likely associated with cis- and trans-acting effects on homoeologous loci in the allotetraploids, as observed in flowering-time genes17. Interestingly, modulation of circadian clock regulators in allopolyploids and hybrids is reminiscent of switching gene expression during dawn- and evening-phased rhythmic alternation13,20 that is required for properly maintaining homoeostasis in clock-mediated metabolic pathways in diploids9,19. Hybrids and allopolyploids simply exploit epigenetic modulation of parental alleles and homoeologous loci of the internal clock regulators and use this convenient mechanism to alter the amplitude of gene expression and metabolic flux and gain advantages from clock-mediated photosynthesis and carbohydrate metabolism. Epigenetic regulation of a few regulatory genes induces cascade changes in downstream genes and physiological pathways and ultimately growth and development, which provides a general mechanism for growth vigor and increased biomass2,3,15 that are commonly observed in the hybrids and allopolyploids produced within and between species.

METHODS SUMMARY

Allotetraploids were resynthesized as previously described1,4, and hybrids were made by crossing C24 with Columbia. Unless noted otherwise, 8−15 plants (grown under 22°C and 16-hour light/day) from each of 2−3 biological replications were pooled for the analysis of DNA, RNA, protein, chlorophyll, starch, and sugar. TOC1:CCA1 and TOC1:cca1-RNAi transgenic plants were produced using pEarlygate303 (CD694) and pCAMBIA (CD3−447) derivatives, respectively. cca1−11 (CS9378) and ccal-11 lhy-21 (CS9380) mutants9,22,29 were obtained from ABRC. Protein blot, EMSA, and ChIP assays were performed as previously described17,18.

Full Methods and any associated references are available in the online version of the paper at www.nature.com/nature.

METHODS

Plant Growth

Plant materials included A. thaliana autotetraploid (At4, ABRC accession#CS3900), A. arenosa (Aa, CS3901), and two independently resynthesized allotetraploid lineages (Allo733 and Allo738) (CS3895−96) (F7 to F8). All plant materials were generated as previously described1,4. Plants for 24-hour rhythm analysis were grown for 4 weeks in 16/8-hr (light/dark) cycles and harvested at indicated zeitgeber time (ZT0 = dawn)20. For each genotype, mature leaves from five plants were harvested every 3 hrs for a period of 48 hrs and frozen in liquid nitrogen. The data from the first 24-hr period were shown because the second-period data were the same. Leaves were collected prior to bolting (6−8 rosette leaves in A. thaliana, 10−12 leaves in A. arenosa, and 12−15 leaves in allotetraploids) to minimize developmental variation among genotypes31,32. Unless noted otherwise, analyses for gene expression, chlorophyll, starch, and sugars were performed at ZT6 (noon), 6, 9, and 15.

CCA1 transgenic plants

The constitutive CCA1-overexpression line (CCA1-OX) was kindly provided by Elaine Tobin at University of California, Los Angels. We amplified a TOC1 (At5g61380.1) promoter fragment using A. thaliana Columbia genomic DNA and the primer pair 5’-GGGAATTCCGTGTCTTACGGTGGATGAAGTTGA-3’ (EcoRI) and 5’-GGGGATCCGTTTTGTCAATCAATGGTCAAATTATGAGACGCG-3’ (BamHI) and a full-length CCA1 cDNA fragment using the primer pair: 5’-GCGGCCGGATCCATGGAGACAAATTCGTCTGG AG-3’ (BamHI) and 5’-GGCCGCTCTAGATCATGTGGAAGCTTGAGTTTC-3’ (XbaI). The TOC1 promoter fragment was fused to CCA1 cDNA and cloned into pBlueScript. The inserts were validated by sequencing and subcloned into pEarlyGate303 (CD694) using the primer pair 5’-GGGGACAAGTTTGTACAAAA AAGCAGGCTTACGTGTCTTACGGTGGATGAAGTTGA -3’ and 5-GGGGACCACTTTGTACAAGAAAGCTGGGTCTGTGGAAGCTTGAGTTTCCAACCG-3’. The construct (ProTOC1:CCA1) was transformed into A. thaliana (Columbia) plants33 (Supplementary Fig. 4b). One-week old T1 seedlings (two true leaves) were sprayed with basta solution (~100 mg/L), and the positive plants were genotyped (Supplementary Fig. 4). T2 transgenic plants (TOC1:CCA1) were subjected to chlorophyll, starch, and gene expression analysis.

To make the TOC1:cca1-RNAi construct, we amplified a TOC1 promoter fragment (ProTOC1) using the primer pair: F-EcoRI-ProTOC1 5'-GGGAATTCCGTGTCTTACGGTGGATGAAGTTGA-3' and R-ProTOC1-NcoI 5'-GCGGCCCCATGGGTTTTGTCAATCAATGGTCAAATTATGAGACGCG-3' and replaced 35S promoter with ProTOC1 in pFGC5941 (CD3−447) (Supplementary Fig. 5c). A 250-bp CCA1 fragment was amplified using the primer pair: F-RNAi CCA1 XbaI AscI 5’-GCGGCCTCTAGAGGCGCGCCTCTGGAAAACGGTAATGAGCAAGGA-3’ and R-RNAi CCA1 BamHI SwaI 5’-GGCCGCCCTAGGTAAATTTACACCACTAGAATCGGGAGGCCAAA-3’. We subcloned the BamHI-XbaI fragment and then the AscI-SwaI fragment into the same vector, generating two CCA1 fragments in opposite orientations (pTOC1:cca1-RNAi) (Supplementary Fig. 5c). Four TOC1:cca1-RNAi T1 transgenic plants were used to analyze gene expression and starch content.

We obtained mutant seeds of cca1−11 (CS9378) and cca1−11 lhy-21 (CS9380)22,29 from ABRC. Gene expression, chlorophyll and starch assays were performed when the mutant plants were about 3−4 weeks old and had 6−8 true leaves under 16/8 hours of day/night before bolting9.

Note that CCA1-OX and TOC1:CCA1 lines flowered late (Supplementary Fig. 4)18, whereas cca1 and cca1/lhy mutants flowered early9,29. A few TOC1:cca1-RNAi lines flowered early, whereas some flowered late (Supplementary Fig. 5d), which may be related to various secondary and systematic effects on the downstream genes related to flowering time. All assays in mutant and transgenic plants were performed before bolting.

DNA and RNA Analysis

Genomic DNA was extracted using a modified protocol32. Total RNA was extracted using RNeasy plantmini kits (Qiagen, Valencia, CA). The first-strand cDNA synthesis was performed using reverse transcriptase (RT) Superscript II (Invitrogen, Carlsbad, CA). An aliquot (1/100) of cDNA was used for quantitative RT-PCR (qRT-PCR) analysis using the primer pairs for LHY, CCA1, TOC1, and GI (Supplementary Table 2) in an ABI7500 machine (Applied Biosystems, Foster City, CA) as previously described34, except that ACT2 was used as a control to estimate the relative expression levels (R.E.L.) in three biological replications.

To distinguish locus-specific expression patterns, the RT-PCR products were amplified using the primer pairs (Supplementary Table 3) and subjected to cleaved amplified polymorphism sequence (CAPS) analysis32.

Semi-quantitative RT-PCR was used to determine the expression levels of the genes in chlorophyll a and b biosynthesis and starch metabolism (Supplementary Table 5).

Chlorophyll, starch and sugar contents

Chlorophyll was extracted in dark with 5 ml of acetone (80%) at 4°C from 300 mg 4-week-old seedlings. The chlorophyll content was calculated using spectrophotometric measurements at light wavelengths of 603, 645 and 663 nm and 80% acetone as a control35 and shown as milligram of chlorophyll per gram of fresh leaves.

Ca(mgg)=12.7×OD663-2.69×OD645(Chlorophylla)
Cb(mgg)=22.9×OD645-4.86×OD663(Chlorophyllb)
Ca+b(mgg)=8.02×OD663+20.20×OD645(Chlorophylla+b)

Starch content was measured from leaves of five plants (about 600 mg fresh weight). The leaves were boiled in 25 mL 80% (v/v) ethanol. The decolored leaves were stained in an iodine solution or ground with a mortar and pestle in 80% ethanol36,37. Total starch in each sample was quantified using 30 μL of the insoluble carbohydrate fraction using a kit from Boehringer Mannheim (R-Biopharm, Darmstadt, Germany).

To quantify soluble sugars, 600 mg fresh leaves were extracted with 80% ethanol according to a published protocol38. The sugar concentration was determined enzymatically using Maltose/Sucrose/D-Glucose and D-Glucose/D-Fructose kits, respectively (Boehringer Mannheim, R-Biopharm) and shown as milligram of sugar per gram of fresh leaves.

Promoter motif analysis

DNA sequences from ~1,500-bp upstream of the transcription start sites of the upregulated genes identified in the allotetraploids1 were extracted and searched for evening element (EE, AAAATATCT) or CCA1 binding site (CBS, AAAAATCT)10,18,39. The same method was used to analyze motifs in all genes in Arabidopsis genome40. The list of 128 upregulated genes and motif locations is provided in Supplementary Table 1.

Chromatin immunoprecipitation (ChIP)

The ChIP assays were performed using a modified protocol41,42. We used 1/10 of chromatin solution as input DNA to determine DNA fragment sizes (0.3−1.0-kbp). The remaining chromatin solution was diluted 10-fold and divided into two aliquots; one was incubated with 10 μl of antibodies (anti-dimethyl-H3-Lys4, anti-dimethyl-H3-Lys9, anti-acetyl-H3-Lys9, all from Upstate Biotechnology, NY; or anti-CCA1), and the other incubated with protein beads. The immunoprecipitated DNA was amplified by semi-quantitative PCR using the primers designed from the conserved sequences of the CCA1, LHY, TOC1, and GI upstream of the ATG codon from both A. thaliana and A. arenosa loci (Supplementary Table 4). Two independent experiments were performed and analyzed.

Electrophoretic mobility shift assay (EMSA)

A CCA1 full-length cDNA was amplified from A. thaliana cDNA using a primer pair ATTB1_CCA1_F_XHO: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTCCCTCGAGATGGAGACAAATTCGTCT-3’ and CCA1-R-Avr2-AttB2: 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCCCCTAGGTCATGTGGAAGCTTGAGTTTC-3’. The cDNA was cloned into pDONR221 and validated by sequencing. The resulting insert was transferred by recombination into pET300/NT-DEST expression vector (Invitrogen Corp., Carlsbad, CA) and expressed in Escherichia coli Rosetta-gami B competent cells (Novagen, Madison, WI). Recombinant CCA1 protein was purified and subjected to EMSA39 in 6% native polyacrylamide gels using rCCA1 (10 fmoles) and32P-labeled double-stranded oligonucleotides (10 fmoles, Supplementary Table 6). The cold probe (Cp) concentrations were 0 (−), 50 (5×), 100 (10×), 200 (20×), and 500 (50×) fmoles, respectively.

Western blot analysis

Protein crude extracts were prepared from fresh leaves as previously described18. The immunoblots were probed with anti-CCA1, and antibody binding was detected by ECL (Amersham, Piscataway, NJ).

Supplementary Material

Acknowledgements

We are indebted to Elaine Tobin for her generous gifts of the CCA1-overexpression line and antibodies against CCA1. We thank Helen Y. Chen for advice on recombinant CCA1 production, Danny Wang Ng for Western blot analysis, Thomas Juenger for insightful discussions on life history traits in Arabidopsis, and Daniel Chen and Enamul Huq for careful readings of the manuscript. We thank anonymous reviewers for their constructive and insightful comments on performing critical experiments to improve the manuscript. The work is supported by the grants from the National Science Foundation Plant Genome Research Program (DBI0733857 and DBI0624077) and the National Institutes of Health (GM067015) (Z.J.C.) and National Basic Research Program of China (2007CB109000) (Q.S.).

Footnotes

List of key genes: CCA1, LHY, TOC1, GI, PORA, PORB, AMY, DPE1, GWD3, ELF4

Author Information Reprints and permissions information is available at www.nature.com/reprints. The authors declare no competing financial interests. Correspondence and requests for the materials should be addressed to Z.J.C. (zjchen/at/mail.utexas.edu).

Supplementary Information is linked to the online version of the paper at www.nature.com/nature.

References

1. Wang J, et al. Genomewide nonadditive gene regulation in Arabidopsis allotetraploids. Genetics. 2006;172:507–517. [PMC free article] [PubMed]
2. Lippman ZB, Zamir D. Heterosis: revisiting the magic. Trends Genet. 2007;23:60–66. [PubMed]
3. Birchler JA, Auger DL, Riddle NC. In search of the molecular basis of heterosis. Plant Cell. 2003;15:2236–2239. [PMC free article] [PubMed]
4. Comai L, et al. Phenotypic instability and rapid gene silencing in newly formed Arabidopsis allotetraploids. Plant Cell. 2000;12:1551–1568. [PMC free article] [PubMed]
5. Dodd AN, et al. Plant circadian clocks increase photosynthesis, growth, survival, and competitive advantage. Science. 2005;309:630–633. [PubMed]
6. Wijnen H, Young MW. Interplay of circadian clocks and metabolic rhythms. Annu Rev Genet. 2006;40:409–448. [PubMed]
7. Panda S, Hogenesch JB, Kay SA. Circadian rhythms from flies to human. Nature. 2002;417:329–335. [PubMed]
8. Michael TP, et al. Enhanced fitness conferred by naturally occurring variation in the circadian clock. Science. 2003;302:1049–1053. [PubMed]
9. Mizoguchi T, et al. LHY and CCA1 are partially redundant genes required to maintain circadian rhythms in Arabidopsis. Dev Cell. 2002;2:629–641. [PubMed]
10. Alabadi D, et al. Reciprocal regulation between TOC1 and LHY/CCA1 within the Arabidopsis circadian clock. Science. 2001;293:880–883. [PubMed]
11. Strayer C, et al. Cloning of the Arabidopsis clock gene TOC1, an autoregulatory response regulator homolog. Science. 2000;289:768–771. [PubMed]
12. Park DH, et al. Control of circadian rhythms and photoperiodic flowering by the Arabidopsis GIGANTEA gene. Science. 1999;285:1579–1582. [PubMed]
13. Harmer SL, et al. Orchestrated transcription of key pathways in Arabidopsis by the circadian clock. Science. 2000;290:2110–2113. [PubMed]
14. Leitch AR, Leitch IJ. Genomic plasticity and the diversity of polyploid plants. Science. 2008;320:481–483. [PubMed]
15. Chen ZJ. Genetic and epigenetic mechanisms for gene expression and phenotypic variation in plant polyploids. Annu Rev Plant Biol. 2007;58:377–406. [PMC free article] [PubMed]
16. Rieseberg LH, Willis JH. Plant speciation. Science. 2007;317:910–914. [PMC free article] [PubMed]
17. Wang J, Tian L, Lee HS, Chen ZJ. Nonadditive Regulation of FRI and FLC Loci Mediates Flowering-Time Variation in Arabidopsis Allopolyploids. Genetics. 2006;173:965–974. [PMC free article] [PubMed]
18. Wang ZY, Tobin EM. Constitutive expression of the CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) gene disrupts circadian rhythms and suppresses its own expression. Cell. 1998;93:1207–1217. [PubMed]
19. Alabadi D, Yanovsky MJ, Mas P, Harmer SL, Kay SA. Critical role for CCA1 and LHY in maintaining circadian rhythmicity in Arabidopsis. Curr Biol. 2002;12:757–761. [PubMed]
20. McClung CR. Plant circadian rhythms. Plant Cell. 2006;18:792–803. [PMC free article] [PubMed]
21. Jenuwein T, Allis CD. Translating the histone code. Science. 2001;293:1074–1080. [PubMed]
22. Doyle MR, et al. The ELF4 gene controls circadian rhythms and flowering time in Arabidopsis thaliana. Nature. 2002;419:74–77. [PubMed]
23. Reinbothe S, Reinbothe C, Lebedev N, Apel K. PORA and PORB, Two Light-Dependent Protochlorophyllide-Reducing Enzymes of Angiosperm Chlorophyll Biosynthesis. Plant Cell. 1996;8:763–769. [PMC free article] [PubMed]
24. Sperling U, van Cleve B, Frick G, Apel K, Armstrong GA. Overexpression of light-dependent PORA or PORB in plants depleted of endogenous POR by far-red light enhances seedling survival in white light and protects against photooxidative damage. Plant J. 1997;12:649–658. [PubMed]
25. Lloyd JR, Kossmann J, Ritte G. Leaf starch degradation comes out of the shadows. Trends Plant Sci. 2005;10:130–137. [PubMed]
26. Smith AM, Zeeman SC, Smith SM. Starch degradation. Annu Rev Plant Biol. 2005;56:73–98. [PubMed]
27. Smith SM, et al. Diurnal changes in the transcriptome encoding enzymes of starch metabolism provide evidence for both transcriptional and posttranscriptional regulation of starch metabolism in Arabidopsis leaves. Plant Physiol. 2004;136:2687–2699. [PMC free article] [PubMed]
28. Eimert K, Wang SM, Lue WI, Chen J. Monogenic Recessive Mutations Causing Both Late Floral Initiation and Excess Starch Accumulation in Arabidopsis. Plant Cell. 1995;7:1703–1712. [PMC free article] [PubMed]
29. Hall A, et al. The TIME FOR COFFEE gene maintains the amplitude and timing of Arabidopsis circadian clocks. Plant Cell. 2003;15:2719–2729. [PMC free article] [PubMed]
30. Perales M, Mas P. A functional link between rhythmic changes in chromatin structure and the Arabidopsis biological clock. Plant Cell. 2007;19:2111–2123. [PMC free article] [PubMed]
31. Madlung A, et al. Remodeling of DNA methylation and phenotypic and transcriptional changes in synthetic Arabidopsis allotetraploids. Plant Physiol. 2002;129:733–746. [PMC free article] [PubMed]
32. Wang J, et al. Stochastic and epigenetic changes of gene expression in Arabidopsis polyploids. Genetics. 2004;167:1961–1973. [PMC free article] [PubMed]
33. Clough SJ, Bent AF. Floral dip: a simlified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 1998;16:735–743. [PubMed]
34. Lee HS, et al. Sensitivity of 70-mer oligonucleotides and cDNAs for microarray analysis of gene expression in Arabidopsis and its related species. Plant Biotechnology Journal. 2004;2:45–57. [PMC free article] [PubMed]
35. Mochizuki N, Brusslan JA, Larkin R, Nagatani A, Chory J. Arabidopsis genomes uncoupled 5 (GUN5) mutant reveals the involvement of Mg-chelatase H subunit in plastid-to-nucleus signal transduction. Proc Natl Acad Sci U S A. 2001;98:2053–2058. [PMC free article] [PubMed]
36. Yu TS, et al. The Arabidopsis sex1 mutant is defective in the R1 protein, a general regulator of starch degradation in plants, and not in the chloroplast hexose transporter. Plant Cell. 2001;13:1907–1918. [PMC free article] [PubMed]
37. Smith AM, Zeeman SC. Quantification of starch in plant tissues. Nat Protoc. 2006;1:1342–1345. [PubMed]
38. Focks N, Benning C. wrinkled1: A novel, low-seed-oil mutant of Arabidopsis with a deficiency in the seed-specific regulation of carbohydrate metabolism. Plant Physiol. 1998;118:91–101. [PMC free article] [PubMed]
39. Harmer SL, Kay SA. Positive and negative factors confer phase-specific circadian regulation of transcription in Arabidopsis. Plant Cell. 2005;17:1926–1940. [PMC free article] [PubMed]
40. Arabidopsis Genome Initiative Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature. 2000;408:796–815. [PubMed]
41. Bastow R, et al. Vernalization requires epigenetic silencing of FLC by histone methylation. Nature. 2004;427:164–167. [PubMed]
42. Tian L, et al. Reversible histone acetylation and deacetylation mediate genome-wide, promoter-dependent and locus-specific changes in gene expression during plant development. Genetics. 2005;169:337–345. [PMC free article] [PubMed]

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...