• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
Oncogene. Author manuscript; available in PMC Oct 2, 2009.
Published in final edited form as:
PMCID: PMC2664853
NIHMSID: NIHMS89309

The Role of the Birt-Hogg-Dubé Protein in mTOR Activation and Renal Tumorigenesis

Abstract

Birt-Hogg-Dubé (BHD) syndrome is a tumor suppressor gene disorder characterized by skin tumors, cystic lung disease, and renal cell carcinoma. Very little is known about the molecular pathogenesis of BHD. Clinical similarities between BHD and tuberous sclerosis complex (TSC) suggest that the BHD and TSC proteins may function within a common pathway. The TSC proteins inhibit the activity of the mammalian target of Rapamycin complex 1 (TORC1), and in Schizosaccharomyces pombe, Bhd and Tsc1/Tsc2 have opposing roles in the regulation of amino acid homeostasis. We report here that in mammalian cells, downregulation of BHD reduces the phosphorylation of ribosomal protein S6, an indicator of TORC1 activity. To determine whether folliculin, the product of the BHD gene, regulates mTOR activity in vivo, we generated a mouse with targeted inactivation of the Bhd gene. The mice developed spontaneous oncocytic cysts and tumors composed of cells that resemble the renal cell carcinomas in BHD patients. The cysts and tumors had low levels of phospho-S6. Taken together, these data indicate that folliculin regulates the activity of TORC1, and suggest a new paradigm in which both inappropriately high and inappropriately low levels of TORC1 activity can be associated with renal tumorigenesis.

Keywords: BHD, mTOR, folliculin, renal carcinoma, oncocytoma

Introduction

Birt-Hogg-Dubé (BHD) syndrome is an autosomal dominant disorder characterized by hamartomas of skin follicles, spontaneous pneumothorax, and renal cell carcinoma (RCC) (Birt et al., 1977; Toro et al., 1999; Zbar et al., 2002). Unlike most other genetic disorders associated with renal tumors, BHD patients develop multiple histologic tumor types, including oncocytomas (which are considered benign) and chromophobe, clear cell and papillary carcinomas (Pavlovich et al., 2005; Pavlovich et al., 2002). The BHD gene was cloned in 2002 (Nickerson et al., 2002). Nearly all reported human germline BHD mutations are predicted to result in premature protein truncation (Khoo et al., 2002; Nickerson et al., 2002; Painter et al., 2005; Schmidt et al., 2005; Vocke et al., 2005). Inactivating mutations of the remaining allele have been identified in renal carcinomas from BHD patients, indicating that BHD is a tumor suppressor gene (Vocke et al., 2005).

BHD encodes a 64-kDa protein, folliculin (FLCN), which has no significant homology to other human proteins. The function of folliculin is not completely understood. Two folliculin interacting proteins have been reported, FLCN-interacting protein 1 (FNIP1) and its homolog FLCN-interacting protein 2 (FNIP2/FNIPL) (Baba et al., 2006; Hasumi et al., 2008; Takagi et al., 2008). Both FNIP1 and FNIP2 interact with AMP-activated protein kinase (AMPK), suggesting that folliculin, FNIP1 and FNIP2 may be involved in energy or nutrient sensing through the AMPK and mTOR signaling pathways (Baba et al., 2006; Hasumi et al., 2008; Takagi et al., 2008).

The clinical hallmarks of BHD, including facial hamartomas (folliculomas), lung cysts, pneumothorax, and renal tumors, are similar to certain manifestations of tuberous sclerosis complex (TSC). TSC is a tumor suppressor gene syndrome caused by mutations in the TSC1 or TSC2 gene (European Chromosome 16 Tuberous Sclerosis Consortium, 1993; O'Callaghan et al., 1998; van Slegtenhorst et al., 1997). TSC patients can develop facial hamartomas (angiofibromas), renal angiomyolipomas, and less frequently oncocytomas and renal carcinomas, including clear cell and chromophobe subtypes (Barbour and Casali, 1978; Crino et al., 2006; Henske et al., 1995; Henske et al., 1996). Women with TSC can develop lymphangioleiomyomatosis (LAM), which is associated with cystic lung disease and pneumothorax (Carsillo et al., 2000; Smolarek et al., 1998; Urban et al., 1999).

The clinical similarities between TSC and BHD suggest that folliculin and the TSC proteins may function within a common cellular pathway. The TSC1 and TSC2 proteins, hamartin and tuberin respectively, heterodimerize and inhibit the mammalian target of Rapamycin (mTOR) via the small GTPase Rheb, which is the target of tuberin's highly conserved GTPase activating domain (Castro et al., 2003; Garami et al., 2003; Inoki et al., 2003; Saucedo et al., 2003; Stocker et al., 2003; Tee et al., 2003b; Zhang et al., 2003). Expression profiling of S. pombe yeast containing deletions of either the Tsc genes or Bhd revealed that multiple amino acid permeases and transporters that are downregulated in Δtsc1 and Δtsc2 are upregulated in Δbhd, and that Δbhd S. pombe have elevated intracellular levels of specific amino acids that are low in Δtsc1 and Δtsc2 (van Slegtenhorst et al., 2007). These data indicate that in yeast Bhd and Tsc1/2 function in common pathways, but surprisingly with opposing roles.

We report here that downregulation of BHD in mammalian cells leads to mTOR inhibition. Moreover, mice carrying a Bhd mutation develop oncocytic renal tumors resembling those found in BHD patients, and the tumors have low levels of phosphorylation of ribosomal protein S6, an indicator of low mTOR activity. These data suggest that both inappropriate mTOR inhibition in BHD and inappropriate mTOR activation in TSC are associated with renal tumorigenesis.

Results

BHD mRNA is highly expressed in testis, ovary, brain, and lung, and in glioblastoma-derived cell lines

To define the expression pattern of BHD in human tissues, we used quantitative real-time RT-PCR (qRT-PCR) to compare BHD mRNA levels in 20 different normal human tissues, using RNA specimens pooled from at least 3 donors (Ambion). The highest levels of BHD transcript were found in testis, ovary, brain and lung (Figure 1a). The level in the kidney was approximately 45% of that in the testis, and the liver (which had the lowest level of BHD transcript) was approximately 25% of the testis. Our qRT-PCR results of the tissue-specific expression of BHD mRNA vary somewhat from a recently published study by Hasumi et al. that found the highest levels of expression in the pituitary gland, cervix and pancreas. These differences are possibly due to different sources of tissue mRNA (Hasumi et al., 2008). We next tested 19 human cancer cell lines derived from ovary, brain and lung, in order to identify those with high levels of endogenous BHD expression for further experiments. The two cell lines with the highest levels of BHD expression were both glioblastoma derived: SF-268 and U251 (Figure 1b), with levels 4-6 fold higher than a kidney-derived cell line, CAKI-1.

Figure 1
Endogenous BHD mRNA levels in tissues and cell lines. (a) Quantitative real-time RT-PCR was used to identify tissues with high levels of BHD mRNA. A panel of normal human tissue RNA (Ambion) was utilized, with each sample being a pool from at least three ...

BHD downregulation inhibits the phosphorylation of ribosomal protein S6

As noted earlier, in S. pombe the BHD homolog functions in a pathway that opposes the evolutionarily conserved Tsc1/Tsc2/Rheb/Tor2 pathway. To determine whether folliculin functions in a pathway opposing that of TSC in mammalian cells, U251 cells were treated with TSC2, BHD, or control siRNA, and levels of phospho-ribosomal protein S6 (Ser235/236) were used to monitor the levels of mTOR activity. Downregulation of TSC2 enhanced phospho-S6 levels relative to control siRNA, as expected based on the TSC/Rheb/TORC1 signaling pathway, while downregulation of BHD decreased phospho-S6 levels in serum starvation conditions (Figure 2a). To confirm this in a different cell type, we downregulated BHD in HEK293 cells. Downregulation of BHD again resulted in a decrease in phospho-S6 (Figure 2b). These data suggest that in mammalian cells, folliculin and the TSC proteins have opposing roles in TORC1 regulation, similarly to S. pombe. Finally, to determine whether folliculin regulates mTOR activation in a human kidney epithelial cell line, BHD was downregulated in HK-2 cells. As in U251 and HEK293 cells, folliculin downregulation reduced phospho-S6 levels in serum starvation conditions (Figure 2c). Folliculin downregulation also decreased phospho-S6 in HEK293 and U251 cells grown in full serum. Interestingly, levels of endogenous folliculin appeared to decrease after 15 minutes of serum stimulation in HK-2 cells (Figure 2c compare lanes 3 and 5). To determine if this was cell type specific, we stimulated U251 cells with serum and again observed lower endogenous folliculin levels after serum stimulation (Figure 2d compare lanes 4 and 6).

Figure 2
BHD downregulation causes a reduction in phospho-S6 levels. (a) U251 cells were treated with TSC2 siRNA, BHD siRNA or control siRNA in 10% FBS for 24 hours, then serum starved for 24 hours (serum -) or grown in 10% FBS for 24 hours (serum +). Blot was ...

Development of mice with targeted disruption of Bhd

These results in cell culture systems suggested that cells with folliculin downregulation have decreased levels of TORC1 activity. To determine whether this is also true in vivo, we generated mice with targeted inactivation of Bhd using an embryonic stem (ES) cell line from Baygenomics. This ES cell line was created using a gene trap vector technique and contains a βgeo (β-galactosidase/neomycin) cassette integrated between exon 8 and 9 in the Bhd gene, resulting in a truncated folliculin protein (Figure 3a). Disruption of Bhd mRNA by the gene trap vector in the ES cells was confirmed by RT-PCR using an upstream primer in Bhd exon 7 and a downstream primer in the βgal sequence of the gene trap. The Bhd mutant RT-PCR band (366 base pairs) can be distinguished from wild type Bhd using a downstream primer in exon 9, which results in a 250 base pair RT-PCR product (Figure 3b and c). When Bhd heterozygotes are mated, litters consist of a ratio of ~33% wild type and ~67% of Bhd heterozygous pups. No Bhd homozygous mutant pups were identified. To confirm reduced levels of Bhd mRNA in the heterozygous mice compared to wild type mice, RNA was isolated from the kidneys of age matched Bhd+/- and Bhd+/+ mice and Bhd levels were measured using real-time RT-PCR targeting the junction of exons 9 and 10. As expected, Bhd+/- mice had about 50% as much Bhd mRNA as wild type mice (0.52 +/- 0.13 relative mRNA levels in the Bhd+/- mice compared to 0.99 +/- 0.20 in the Bhd+/+ mice).

Figure 3
Gene trap disruption of the Bhd gene in mouse embryonic stem (ES) cells. (a) ES cell line RRX115 was produced by Baygenomics. The βgeo cassette (green box) is inserted into intron 8 of the Bhd gene and causes a truncated folliculin-βgalactosidase/neomycin ...

The Bhd heterozygous mice had no obvious physical or behavioral abnormalities relative to their wild type littermates. Seven Bhd+/- mice were sacrificed between 3 and 6 months of age. No macroscopic abnormalities were observed in any organ. Microscopic examination of the kidneys revealed cysts and solid tumors. Four of these mice (57%) had a single renal cyst, with an average diameter of 0.4 mm (range 0.1 to 0.6 mm), and one, which was 5 months old, had a 0.3 mm solid tumor (Table 1). Both the solid tumor (Figure 4b) and the cysts (Figure 4c) were composed of oncocytic cells with foamy-appearing cytoplasm, peri-nuclear clearing, and uniform-appearing nuclei, resembling oncocytoma cells.

Figure 4
Bhd heterozygotes develop spontaneous oncocytic cysts and tumors. (a) A typical kidney with small visible cysts (arrows) from a 14-month-old Bhd+/- mouse is shown next to a kidney from an age matched wild type mouse. (b) An oncocytic tumor and (c) an ...
Table 1
Renal cysts and tumors in Bhd+/- and Bhd+/+ mice

Twenty-four Bhd+/- mice were sacrificed between 9 and 17 months of age. No macroscopic abnormalities were observed in any organ except the kidneys, which had small but visible cysts (Figure 4a). Microscopically, both cysts and tumors were observed in the kidneys. Eleven Bhd+/- mice (45%) had cysts (range 1-11 cysts/mouse) Table 1), with an average diameter of 0.8 mm (range 0.1 to 2.1 mm). The cysts had oncocytic cells similar to those in the younger mice. One 13-month-old mouse had multiple oncocytic cysts and two solid renal tumors (0.5 mm and 1.5 mm), both in the same kidney, the larger of which was associated with a cyst (Figure 4d). Both tumors in this mouse were composed of nests of cells with foamy cytoplasm and peri-nuclear clearing, similar to the oncocytoma-like cells observed in the 5-month-old mouse, but with more pleomorphism and nuclear irregularity, resembling a chromophobe renal carcinoma (Figure 4e). A small oncocytic tumor (0.4 mm) associated with an oncocytic cyst with papillary projections was also observed in a 16-month-old Bhd+/- mouse, along with 3 other oncocytic cysts. As a control, kidneys from five Bhd+/+ mice age 3-6 months and ten Bhd+/+ mice age 9-17 months were analyzed. No tumors were identified. One mouse, age 17 months, had a single 0.3mm cyst that lacked the oncocytic features noted in the Bhd+/- cysts (Table 1).

The lung, skin, heart, liver, and spleen of eleven 9-17 month old Bhd+/- mice were examined microscopically. Five of eleven mice (age 13-17 months) showed diffuse lymphoproliferative disease in several organs. Three of these mice had abundant small cell lymphoma infiltrates in lungs, thymus and lymph nodes, whereas two mice had moderate to intense lymphoid hyperplasia in lymph nodes, lungs and kidneys. These latter cases were interpreted as consistent with early lymphoma. One mouse (17 months) exhibited splenomegaly and microscopically showed mild lymphoid hyperplasia also in lymph nodes. One mouse (16 months) had an 8 mm primary lung adenocarcinoma, and another mouse (10 months) had a 0.3 mm lung adenoma. All of these lesions are frequently seen in aging mice and may represent background incidence for this strain (Babbitt et al., 2000; Harvey et al., 1993; Mohr, 1996; Stutman, 1975). For example, Babbitt et al. found a 34.7% incidence of lymphoma in control C57BL/6 at the time of sacrifice at 30 months of age.

ENU enhances renal cyst formation in Bhd+/- mice

Exposure of Tsc1+/- and Tsc2+/-mice and rats to the mutagen ENU (N-ethyl-N-nitrosourea) has been shown to accelerate renal tumor and cyst development (Hino et al., 1993; Kobayashi et al., 1999; Kobayashi et al., 2001). To determine if exposure to ENU (N-ethyl-N-nitrosourea) accelerates tumor formation in this Bhd model, pregnant Bhd+/- mice were intraperitoneally injected with 50 mg/kg body weight ENU at embryonic day E14. Progeny mice were sacrificed at 3-5 months of age. A roughly Mendelian ratio of Bhd genotypes was observed, with ~33% wild type pups, ~67% heterozygous pups, and no homozygous Bhd null pups. Two of the ENU-treated wild-type mice developed a single renal cyst, and neither had an oncocytic appearance (Figure 5a). Sixteen of 17 (94%) of the ENU-treated Bhd+/- mice developed between 1 and 14 cysts (average 5.5 cysts per mouse) ranging from 0.1 to 1.9 mm in diameter (Table 2). The cysts in the ENU-treated Bhd+/- mice were lined by oncocytic cells with uniform, round nuclei (Figure 5b-e).

Figure 5
ENU accelerates development of oncocytic cysts and tumors in BHD heterozygotes. Pregnant Bhd+/- mice were injected with ENU at day E14. Both wild type and Bhd+/- littermates were sacrificed between 3 and 5 months of age. (a) An example of a non-oncocytic ...
Table 2
Renal cysts and tumors in ENU-treated mice

Two of the ENU-treated Bhd+/- mice developed solid renal tumors. One mouse had two small oncocytic tumors (0.2 mm and 0.4 mm in diameter) at age 3 months, one of which was associated with a small oncocytic cyst (Figure 5f). This mouse had eight other oncocytic cysts elsewhere in the kidneys. The other mouse, which was 3.5-months-old, had a 0.5 mm tumor (Figure 5g) that resembled the spontaneous chromophobe-like tumors in the 13-month-old untreated mouse (Figure 4d and e). The 3.5-month-old ENU-treated mouse also had five oncocytic cysts (Figure 5h and i). Interestingly, a 14-month old female that was injected with ENU during pregnancy at 8 months of age had one enlarged kidney (18 × 13 × 12 mm) containing a 0.4 mm oncocytic tumor and four oncocytic cysts (range 0.1 to 12 mm), and a second normal sized kidney (12 × 5 × 4 mm) with 4 oncocytic cysts and a 0.1 mm oncocytic tumor. No ENU-treated wild type littermates developed solid renal tumors.

Bhd+/- tumors have low phospho-S6 levels

To determine whether the mTOR pathway is dysregulated in renal cysts and tumors in Bhd+/- mice, paraffin-embedded tissue specimens from 3 separate mice with cysts and tumors were stained with anti-phospho-S6 ribosomal protein (Ser 235/236). The oncocytic cells lining the cysts were uniformly negative for phospho-S6 (Figure 6a-c). Some normal tubules showed moderate positivity, providing an internal control for the antibody (Robb et al., 2007). The spontaneous tumor from the untreated 13-month-old Bhd+/- mouse was completely negative for phospho-S6 staining (Figure 6d and e). Adjacent normal tubules with moderate positivity again provided an internal positive control (Figure 6d). Phospho-S6 staining in the tumor from the 3.5-month-old ENU-treated Bhd+/- mouse was almost entirely negative (Figure 6f), although occasional cells showed 1+ positivity. Phospho-S6 staining of wild type mice treated with ENU showed similar positive staining of a fraction of normal tubules (Figure 6g-i).

Figure 6
Oncocytic cysts and tumors from Bhd+/- mice have no or weak phospho-S6 levels. (a) Oncocytic cyst lining epithelial cells (white arrow) from a 13-month-old untreated Bhd+/- mouse were negative for anti-phospho-S6 ribosomal protein (Ser 235/236) staining. ...

Discussion

We report here that downregulation of folliculin leads to lower levels of phospho-ribosomal protein S6 both in cell culture and in mice with heterozygous inactivation of Bhd. This is both an expected and a surprising result. We had previously found that in S. pombe, the Bhd and Tsc homologs function in opposing pathways. Since downregulation of the TSC proteins leads to Tor activation in S. pombe as well as in mammalian cells, our finding that downregulation of BHD leads to mTOR inhibition was consistent with the S. pombe results. However, the fact that BHD downregulation leads to TORC1 inhibition in vitro and in mice carrying targeted inactivation of Bhd is surprising for multiple reasons. First, since TSC and BHD patients develop hamartomatous skin tumors, lung cysts, and renal tumors, one might expect the TSC proteins and folliculin to have similar effects on mTOR activity. Second, Baba et al. found that BHD patient-derived UOK257 cells lacking folliculin had higher levels of mTOR activation than UOK257 cells re-expressing folliculin (Baba et al., 2006). Third, two groups have reported that mice with targeted inactivation of Bhd in the kidney (via a cadherin 16 [KSP]-Cre transgene) develop massively cystic kidneys with increased phosphorylation of ribosomal protein S6 (Baba et al., 2008; Chen et al., 2008), and that renal carcinomas from BHD patients have weak to moderate staining of phospho-mTOR (Baba et al., 2008).

However, alongside these data suggesting that loss of BHD results in mTOR activation, there are other indications that the relationship between folliculin and mTOR is complex. For example, Baba et al. found that cells lacking BHD had lower levels of mTOR activation than cells re-expressing BHD in a specific cellular condition (deprivation of amino acids), and Takagi et al. recently reported that in HeLa cells, siRNA downregulation of BHD causes a reduction in phospho-S6 Kinase (Thr389), although the serum conditions for these experiments were not specified (Takagi et al., 2008).

The reasons for these different effects of folliculin on mTOR are not yet clear. One possibility is that the earliest impact of BHD loss results in mTOR inhibition, consistent with the S. pombe data, and that subsequent events associated with tumor progression activate mTOR. Consistent with this notion, Baba et al. found that multiple kinase cascades, including Raf/MEK/Erk, p90Rsk, and Akt, were hyperactive in the cystic kidneys of mice with KSP-Cre driven inactivation of Bhd (Baba et al., 2008). ERK, Rsk1, and Akt all directly phosphorylate and inactivate tuberin, thereby leading to mTOR activation (Ballif et al., 2005; Cai et al., 2006; Ma et al., 2005; Manning et al., 2002; Rolfe et al., 2005; Roux et al., 2004; Tee et al., 2003a). Therefore, it is possible that in vivo, mTOR activation occurs not as a primary consequence of BHD mutations, but due to activation of kinases upstream of the TSC/Rheb/mTOR pathway. This could explain the low levels of phospho-S6 in the cysts and tumors in our mouse model, all of which were relatively small and likely represent early lesions.

It is also possible that the observed differences in mTOR activation reflect differences between loss of BHD expression in siRNA-treated cells and mutational inactivation of BHD in UOK257 cells, which have an insertion at nucleotide 1733, leading to a frameshift mutation (Yang et al., 2008). Interestingly, nearly all identified BHD mutations are predicted to truncate prematurely the folliculin protein (Khoo et al., 2002; Leter et al., 2008; Nickerson et al., 2002; Schmidt et al., 2005; Vocke et al., 2005). Most identified germline mutations are either frameshift or nonsense mutations, and roughly 44% occur in a “hot spot” for BHD frameshift mutations in a poly-C tract within exon 11 (Schmidt et al., 2005). It is possible that truncation of folliculin removes a carboxy-terminal region involved in mTOR inhibition or leads to a dominant negative effect, while loss of the entire protein removes an amino-terminal region required for mTOR activation. Finally, it is possible that folliculin regulates mTOR in a cell type or context specific manner that is not fully recapitulated by either the cell culture experiments or the targeted inactivation in vivo. However, we note that we found that BHD knockdown resulted in a reduction of phospho-S6 (Ser235/236) in three cell types: U251, HEK293, and HK-2.

The mice reported here are the first Bhd mouse model that develops solid renal tumors. Previous animal models of BHD include the German shepherd dog, which develops hereditary multifocal renal cystadenocarcinoma and nodular dermatofibrosis (Lingaas et al., 2003), the Nihon rat, which develops renal cell adenomas and carcinomas, both cystic and solid in nature (Hino et al., 2001; Kouchi et al., 2006; Okimoto et al., 2004a; Okimoto et al., 2004b), and the previously discussed mice with Cre-driven inactivation of Bhd in the kidney, that die of renal failure by 3 weeks of age, some of which develop cystic renal cell carcinomas (Baba et al., 2008; Chen et al., 2008). The solid tumors in our Bhd+/- mice were composed of oncocytic cells with variable nuclear pleomorphism, reminiscent of the spectrum of tumors found in BHD patients, which include chromophobe renal tumors and oncocytic hybrid tumors (Murakami et al., 2007; Pavlovich et al., 2005; Pavlovich et al., 2002). In addition to providing a model of BHD renal carcinogenesis, this is also, to our knowledge, the first mouse model of oncocytic and chromophobe renal tumors. While BHD mutations are not frequent in sporadic chromophobe renal carcinomas (Nagy et al., 2004), Warren et al. observed weak to absent BHD mRNA levels in renal oncocytomas, chromophobe renal cancer, and oncocytic hybrid tumors which is in contrast to the high BHD mRNA levels observed in other cancers including breast, ovarian and prostate (Warren et al., 2004). Intriguingly, we have observed weak or absent phospho-S6 levels in sporadic oncocytomas and chromophobe renal cell carcinomas, in contrast to high levels of phospho-S6 in the majority of sporadic clear cell renal carcinomas (Robb et al., 2007).

In conclusion, we report here that loss of folliculin leads to mTOR pathway inhibition both in vitro and in vivo, consistent with data from S. pombe in which the Bhd and Tsc pathways have opposing roles in amino acid homeostasis. We speculate that the most “ancient” evolutionarily conserved function of folliculin is related to mTOR activation. In more complex organisms folliculin may have additional context specific regulatory functions, highlighting the potential complexity of mTOR regulation in cells carrying BHD mutations. Understanding the role of folliculin in mTOR regulation may elucidate not only the pathogenesis of BHD syndrome, but also the pathogenesis of sporadic chromophobe and oncocytic-hybrid renal carcinomas and the normal homeostatic regulation of mTOR activity. Finally, these studies may contribute to the development of targeted therapeutic strategies for BHD patients, which are urgently needed.

Materials and Methods

Cell culture and reagents

Human glioblastoma cells (U251) and human embryonic kidney (HEK) 293 cells were maintained in DMEM plus 10% FBS. Immortalized human kidney proximal tubule epithelial (HK-2) cells (American Type Culture Collection) were maintained in DMEM plus 10% FBS and ITS liquid media supplement (Sigma).

Real-time quantitative reverse transcription-PCR analysis (qRT-PCR)

5′-Nuclease assays using TaqMan chemistry or SYBR®Green assays were run on a 7900 HT sequence detection system (Applied Biosystems) using universal PCR master mix or Power SYBR® Green (Applied Biosystems). FirstChoice® Human Total RNA Survey Panel (Ambion) was used for qRT-PCR comparison of BHD mRNA levels in 20 human tissues. Each pool is comprised of RNA from at least three tissue donors. For comparison of BHD mRNA levels in human cancer cell lines, mRNA was isolated using Trizol (Invitrogen). The sequences of the primers and probe for human BHD were: Forward: 5′ CAAGGCGCTCAAGGTGTTT 3′; Reverse: 5′ AATGGCGTGAAGGCTGTGT 3′; Probe: 6FAM-AGTTTGGATGCCCACAGCGTGCT-BHQ1.

For comparison of Bhd mRNA levels in Bhd+/+ and Bhd+/- mice, RNA was prepared from each kidney of two mice of each genotype (RNeasy kit, Qiagen). Real-time RT-PCR was performed using primers amplifying over the junction of exons 9 and 10 (Forward: 5′ TGGTCCATTCAGCGTTTGAA 3′, Reverse: 5′ AGGGATAGGCACGGGAGG 3′). For each sample, two reverse transcription reactions were performed with 100ng and 20 ng of input RNA. Cycle threshold (ct) values were converted to quantities (in arbitrary units) using standard curve (5 points, 5-fold dilutions) established with a calibrator sample. Quantitative real-time reverse transcription polymerase chain reaction (RT-PCR) results were normalized to TATA-binding protein mRNA levels. For each sample, the two values of relative quantity (from 2 PCR assays) were averaged.

Small interfering RNA (siRNA) transfections

To knockdown TSC2 and BHD mRNA levels, cells were treated with 100 nmol TSC2, BHD or control siRNA (Dharmacon) for 24 or 48 hours and either serum starved, grown in 10% FBS, or serum starved overnight followed by 15 minutes of 20% FBS to stimulate the mTOR pathway.

Western blotting

Cells were lysed in RIPA buffer (50 mM Tris, pH 8, 150 mM NaCl, 2 mM PMSF, 0.1% SDS, 1% Triton-X, and 1% deoxycholic acid), and 20 μg of total protein was loaded on 4-20% SDS–PAGE gels (Bio-Rad Laboratories). Proteins were transferred onto Immobilon membranes (Millipore) for Western blotting with the following antibodies: anti-phospho-S6 (Ser235/236) (Cell Signaling Technology), anti-tuberin (TSC2 [Abcam]), anti-FLCN (a rabbit polyclonal antibody generated against a 20 amino acid peptide comprising the C-terminus of folliculin: Ac-CYKSHLMSTVRSPTASESRN-OH), anti-FLCN (a mouse monoclonal antibody against folliculin (Baba et al., 2006), the generous gift of Dr. Laura Schmidt, National Cancer Institute, Bethesda MD), anti-β-actin (Cell Signaling Technology). Western blots were developed using horseradish peroxidase-conjugated secondary antibodies and ECL chemiluminescence (Amersham Biosciences).

Development of mice with targeted disruption of Bhd

The embryonic stem (ES) cell line RRX115 from Baygenomics containing a gene trap βgeo (β-galactosidase/neomycin) cassette that has integrated between exon 8 and 9 in the Bhd gene was used. The βgeo cassette contains a splice acceptor site upstream of the βgeo sequences. During mRNA processing, this splice acceptor site is recognized and results in fusion of the βgeo cassette with exon 8 of Bhd, creating a fusion protein and truncation of the folliculin protein. Disruption of Bhd mRNA by the gene trap vector was confirmed in the ES cells by RT-PCR using an upstream primer in Bhd exon 7 (5′ CCAGATGGAGAAGCTTGCTG 3′), and a downstream primer in the βgal sequence of the gene trap (5′ CGATTAAGTTGGGTAACGCC 3′). The Bhd mutant RT-PCR band (366 base pairs) can be distinguished from wild type Bhd using a downstream primer in exon 9 (5′ CATGCCAAGCCAACATACGG 3′), which results in a 250 base pair RT-PCR product. The ES cells were injected into blastocysts from C57BL/6 mice and implanted into pseudopregnant female C57BL/6 mice. Chimeric pups were backcrossed with C57BL/6 mice. Mice were genotyped using the following primers designed to recognize either wild type or gene trapped BHD DNA: wild type and mutant forward primer in intron 8: 5′ GTGTGGAGGTACATACATGTGTGCC 3′; wild type reverse primer in intron 8: 5′ AGTACCACCCCCCGTCAGTAATTCC 3′ (533 bp PCR product); mutant reverse primer in βgeo: 5′ CCTGGCCTCCAGACAAGTAGATCC 3′ (460 bp PCR product). All mice were subsequently crossed into a C57BL/6 background.

For ENU experiments, Bhd heterozygous mice were crossed in timed matings and day E14 pregnant mice were injected with 50 mg/kg ENU (N-ethyl-N-nitrosourea) (Sigma) intraperitoneally. After birth, pups were genotyped and analyzed between 3 and 5 months of age.

All animal work was performed in accordance to protocols approved by the Institutional Animal Care and Use Committee of Fox Chase Cancer Center.

Immunohistochemistry

Paraffin sections were deparaffinized, rehydrated, boiled in 10 mM Sodium Citric Buffer (pH 6.0, Sigma), and blocked with 3% hydrogen peroxide in methanol. The sections were incubated with rabbit polyclonal antibody against phospho-S6 (Ser235/236) [Cell Signaling Technology] overnight at 4°C, developed using the Histostain-Plus kit (Invitrogen) and lightly counterstained with hematoxylin (Biomeda). For mouse tissues, EnVision+ System-HRP labeled polymer (DakoCytomation) was used in place of the rabbit secondary antibody and Histostain-Plus kit HRP-Streptavidin was used to reduce background staining of the kidney. Negative control included substitution of phosphate buffered saline for the primary antibody. Cysts and tumors were scored for phospho-S6 staining using a scale of negative (-), weakly positive (+), moderately positive (2+), or strongly positive (3+) (Robb et al., 2007).

Statistical analysis

A single H & E stained cross section through the largest dorsoventral section of each kidney was scored for renal cysts and tumors. A two-tailed Fisher's exact test was used for statistical analysis to compare the number of mice with one or more cysts between wild type and Bhd+/- mice treated with ENU, and to compare the number of mice with one or more cysts between untreated and ENU-treated Bhd+/- mice. A likelihood ratio test was used to compare the means of two Poisson distributions to determine the statistical significance of the numbers of cysts/mouse between the ENU-treated Bhd+/- mice and the untreated Bhd+/- mice of similar age (<6 months) and to compare the numbers of cysts/mouse between the ENU-treated Bhd+/- and ENU-treated wild type mice. Significance was achieved at p≤0.05.

Acknowledgments

We thank Victoria Robb for critical reading of this manuscript. We thank Dr. Laura Schmidt for the FLCN mAb, Dr. Samuel Litwin for statistical analysis, and the Fox Chase Cancer Center Lab Animal Facility for technical assistance with the development and maintenance of the Bhd mutant mice. This work was supported by NIH RO1 (DK51052). Dr. Hartman was supported by NIH F32 (DK076443-01).

References

  • Baba M, Furihata M, Hong SB, Tessarollo L, Haines DC, Southon E, et al. Kidney-targeted Birt-Hogg-Dube gene inactivation in a mouse model: Erk1/2 and Akt-mTOR activation, cell hyperproliferation, and polycystic kidneys. J Natl Cancer Inst. 2008;100:140–54. [PMC free article] [PubMed]
  • Baba M, Hong SB, Sharma N, Warren MB, Nickerson ML, Iwamatsu A, et al. Folliculin encoded by the BHD gene interacts with a binding protein, FNIP1, and AMPK, and is involved in AMPK and mTOR signaling. Proc Natl Acad Sci U S A. 2006;103:15552–7. [PMC free article] [PubMed]
  • Babbitt JT, Kharazi AI, Taylor JM, Bonds CB, Mirell SG, Frumkin E, et al. Hematopoietic neoplasia in C57BL/6 mice exposed to split-dose ionizing radiation and circularly polarized 60 Hz magnetic fields. Carcinogenesis. 2000;21:1379–89. [PubMed]
  • Ballif BA, Roux PP, Gerber SA, MacKeigan JP, Blenis J, Gygi SP. Quantitative phosphorylation profiling of the ERK/p90 ribosomal S6 kinase-signaling cassette and its targets, the tuberous sclerosis tumor suppressors. Proc Natl Acad Sci U S A. 2005;102:667–72. [PMC free article] [PubMed]
  • Barbour GL, Casali RE. Bilateral angiomyolipomas and renal cell carcinoma in polycystic kidney. Urology. 1978;12:694–8. [PubMed]
  • Birt AR, Hogg GR, Dube WJ. Hereditary multiple fibrofolliculomas with trichodiscomas and acrochordons. Arch Dermatol. 1977;113:1674–7. [PubMed]
  • Cai SL, Tee AR, Short JD, Bergeron JM, Kim J, Shen J, et al. Activity of TSC2 is inhibited by AKT-mediated phosphorylation and membrane partitioning. J Cell Biol. 2006;173:279–89. [PMC free article] [PubMed]
  • Carsillo T, Astrinidis A, Henske EP. Mutations in the tuberous sclerosis complex gene TSC2 are a cause of sporadic pulmonary lymphangioleiomyomatosis. Proc Natl Acad Sci U S A. 2000;97:6085–90. [PMC free article] [PubMed]
  • Castro AF, Rebhun JF, Clark GJ, Quilliam LA. Rheb binds tuberous sclerosis complex 2 (TSC2) and promotes S6 kinase activation in a rapamycin- and farnesylation-dependent manner. J Biol Chem. 2003;278:32493–6. [PubMed]
  • Chen J, Futami K, Petillo D, Peng J, Wang P, Knol J, et al. Deficiency of FLCN in mouse kidney led to development of polycystic kidneys and renal neoplasia. PLoS ONE. 2008;3:e3581. [PMC free article] [PubMed]
  • Crino PB, Nathanson KL, Henske EP. The tuberous sclerosis complex. N Engl J Med. 2006;355:1345–56. [PubMed]
  • European Chromosome 16 Tuberous Sclerosis Consortium. Identification and characterization of the tuberous sclerosis gene on chromosome 16. Cell. 1993;75:1305–1315. [PubMed]
  • Garami A, Zwartkruis FJ, Nobukuni T, Joaquin M, Roccio M, Stocker H, et al. Insulin activation of Rheb, a mediator of mTOR/S6K/4E-BP signaling, is inhibited by TSC1 and 2. Mol Cell. 2003;11:1457–66. [PubMed]
  • Harvey M, McArthur MJ, Montgomery CA, Jr, Bradley A, Donehower LA. Genetic background alters the spectrum of tumors that develop in p53-deficient mice. FASEB J. 1993;7:938–43. [PubMed]
  • Hasumi H, Baba M, Hong SB, Hasumi Y, Huang Y, Yao M, et al. Identification and characterization of a novel folliculin-interacting protein FNIP2. Gene. 2008;415:60–7. [PMC free article] [PubMed]
  • Henske EP, Neumann HP, Scheithauer BW, Herbst EW, Short MP, Kwiatkowski DJ. Loss of heterozygosity in the tuberous sclerosis (TSC2) region of chromosome band 16p13 occurs in sporadic as well as TSC-associated renal angiomyolipomas. Genes Chromosomes Cancer. 1995;13:295–8. [PubMed]
  • Henske EP, Scheithauer BW, Short MP, Wollmann R, Nahmias J, Hornigold N, et al. Allelic loss is frequent in tuberous sclerosis kidney lesions but rare in brain lesions. Am J Hum Genet. 1996;59:400–6. [PMC free article] [PubMed]
  • Hino O, Mitani H, Knudson AG. Genetic predisposition to transplacentally induced renal cell carcinomas in the Eker rat. Cancer Res. 1993;53:5856–8. [PubMed]
  • Hino O, Okimoto K, Kouchi M, Sakurai J. A novel renal carcinoma predisposing gene of the Nihon rat maps on chromosome 10. Jpn J Cancer Res. 2001;92:1147–9. [PubMed]
  • Inoki K, Li Y, Xu T, Guan KL. Rheb GTPase is a direct target of TSC2 GAP activity and regulates mTOR signaling. Genes Dev. 2003;17:1829–34. [PMC free article] [PubMed]
  • Khoo SK, Giraud S, Kahnoski K, Chen J, Motorna O, Nickolov R, et al. Clinical and genetic studies of Birt-Hogg-Dube syndrome. J Med Genet. 2002;39:906–12. [PMC free article] [PubMed]
  • Kobayashi T, Minowa O, Kuno J, Mitani H, Hino O, Noda T. Renal carcinogenesis, hepatic hemangiomatosis, and embryonic lethality caused by a germ-line Tsc2 mutation in mice. Cancer Res. 1999;59:1206–11. [PubMed]
  • Kobayashi T, Minowa O, Sugitani Y, Takai S, Mitani H, Kobayashi E, et al. A germ-line Tsc1 mutation causes tumor development and embryonic lethality that are similar, but not identical to, those caused by Tsc2 mutation in mice. Proc Natl Acad Sci U S A. 2001;98:8762–7. [PMC free article] [PubMed]
  • Kouchi M, Okimoto K, Matsumoto I, Tanaka K, Yasuba M, Hino O. Natural history of the Nihon (Bhd gene mutant) rat, a novel model for human Birt-Hogg-Dube syndrome. Virchows Arch. 2006;448:463–71. [PubMed]
  • Leter EM, Koopmans AK, Gille JJ, van Os TA, Vittoz GG, David EF, et al. Birt-Hogg-Dube syndrome: clinical and genetic studies of 20 families. J Invest Dermatol. 2008;128:45–9. [PubMed]
  • Lingaas F, Comstock KE, Kirkness EF, Sorensen A, Aarskaug T, Hitte C, et al. A mutation in the canine BHD gene is associated with hereditary multifocal renal cystadenocarcinoma and nodular dermatofibrosis in the German Shepherd dog. Hum Mol Genet. 2003;12:3043–53. [PubMed]
  • Ma L, Chen Z, Erdjument-Bromage H, Tempst P, Pandolfi PP. Phosphorylation and functional inactivation of TSC2 by Erk implications for tuberous sclerosis and cancer pathogenesis. Cell. 2005;121:179–93. [PubMed]
  • Manning BD, Tee AR, Logsdon MN, Blenis J, Cantley LC. Identification of the tuberous sclerosis complex-2 tumor suppressor gene product tuberin as a target of the phosphoinositide 3-kinase/akt pathway. Mol Cell. 2002;10:151–62. [PubMed]
  • Mohr U, Dungworth DL, Capen CC, Carlton WW, Sundberg JP, Ward JM. Pathobiology of the Aging Mouse. Vol. 1. International Life Sciences Institute; Washington, D.C.: 1996. p. 527.
  • Murakami T, Sano F, Huang Y, Komiya A, Baba M, Osada Y, et al. Identification and characterization of Birt-Hogg-Dube associated renal carcinoma. J Pathol. 2007;211:524–31. [PubMed]
  • Nagy A, Zoubakov D, Stupar Z, Kovacs G. Lack of mutation of the folliculin gene in sporadic chromophobe renal cell carcinoma and renal oncocytoma. Int J Cancer. 2004;109:472–5. [PubMed]
  • Nickerson ML, Warren MB, Toro JR, Matrosova V, Glenn G, Turner ML, et al. Mutations in a novel gene lead to kidney tumors, lung wall defects, and benign tumors of the hair follicle in patients with the Birt-Hogg-Dube syndrome. Cancer Cell. 2002;2:157–64. [PubMed]
  • O'Callaghan FJK, Shiell AW, Osborne JP, Martyn CN. Prevalence of tuberous sclerosis estimated by capture-recapture analysis. Lancet. 1998;351:1490. [PubMed]
  • Okimoto K, Kouchi M, Matsumoto I, Sakurai J, Kobayashi T, Hino O. Natural history of the Nihon rat model of BHD. Curr Mol Med. 2004a;4:887–93. [PubMed]
  • Okimoto K, Sakurai J, Kobayashi T, Mitani H, Hirayama Y, Nickerson ML, et al. A germ-line insertion in the Birt-Hogg-Dube (BHD) gene gives rise to the Nihon rat model of inherited renal cancer. Proc Natl Acad Sci U S A. 2004b;101:2023–7. [PMC free article] [PubMed]
  • Painter JN, Tapanainen H, Somer M, Tukiainen P, Aittomaki K. A 4-bp deletion in the Birt-Hogg-Dube gene (FLCN) causes dominantly inherited spontaneous pneumothorax. Am J Hum Genet. 2005;76:522–7. [PMC free article] [PubMed]
  • Pavlovich CP, Grubb RL, 3rd, Hurley K, Glenn GM, Toro J, Schmidt LS, et al. Evaluation and management of renal tumors in the Birt-Hogg-Dube syndrome. J Urol. 2005;173:1482–6. [PubMed]
  • Pavlovich CP, Walther MM, Eyler RA, Hewitt SM, Zbar B, Linehan WM, et al. Renal tumors in the Birt-Hogg-Dube syndrome. Am J Surg Pathol. 2002;26:1542–52. [PubMed]
  • Robb VA, Karbowniczek M, Klein-Szanto AJ, Henske EP. Activation of the mTOR signaling pathway in renal clear cell carcinoma. J Urol. 2007;177:346–52. [PubMed]
  • Rolfe M, McLeod LE, Pratt PF, Proud CG. Activation of protein synthesis in cardiomyocytes by the hypertrophic agent phenylephrine requires the activation of ERK and involves phosphorylation of tuberous sclerosis complex 2 (TSC2) Biochem J. 2005;388:973–84. [PMC free article] [PubMed]
  • Roux PP, Ballif BA, Anjum R, Gygi SP, Blenis J. Tumor-promoting phorbol esters and activated Ras inactivate the tuberous sclerosis tumor suppressor complex via p90 ribosomal S6 kinase. Proc Natl Acad Sci U S A. 2004;101:13489–94. [PMC free article] [PubMed]
  • Saucedo LJ, Gao X, Chiarelli DA, Li L, Pan D, Edgar BA. Rheb promotes cell growth as a component of the insulin/TOR signalling network. Nat Cell Biol. 2003;5:566–71. [PubMed]
  • Schmidt LS, Nickerson ML, Warren MB, Glenn GM, Toro JR, Merino MJ, et al. Germline BHD-mutation spectrum and phenotype analysis of a large cohort of families with Birt-Hogg-Dube syndrome. Am J Hum Genet. 2005;76:1023–33. [PMC free article] [PubMed]
  • Smolarek TA, Wessner LL, McCormack FX, Mylet JC, Menon AG, Henske EP. Evidence that lymphangiomyomatosis is caused by TSC2 mutations: chromosome 16p13 loss of heterozygosity in angiomyolipomas and lymph nodes from women with lymphangiomyomatosis. Am J Hum Genet. 1998;62:810–5. [PMC free article] [PubMed]
  • Stocker H, Radimerski T, Schindelholz B, Wittwer F, Belawat P, Daram P, et al. Rheb is an essential regulator of S6K in controlling cell growth in Drosophila. Nat Cell Biol. 2003;5:559–65. [PubMed]
  • Stutman O. Immunodepression and malignancy. Adv Cancer Res. 1975;22:261–422. [PubMed]
  • Takagi Y, Kobayashi T, Shiono M, Wang L, Piao X, Sun G, et al. Interaction of folliculin (Birt-Hogg-Dube gene product) with a novel Fnip1-like (FnipL/Fnip2) protein. Oncogene 2008 [PubMed]
  • Tee AR, Anjum R, Blenis J. Inactivation of the tuberous sclerosis complex-1 and -2 gene products occurs by phosphoinositide 3-kinase/Akt-dependent and -independent phosphorylation of tuberin. J Biol Chem. 2003a;278:37288–96. [PubMed]
  • Tee AR, Manning BD, Roux PP, Cantley LC, Blenis J. Tuberous sclerosis complex gene products, Tuberin and Hamartin, control mTOR signaling by acting as a GTPase-activating protein complex toward Rheb. Curr Biol. 2003b;13:1259–68. [PubMed]
  • Toro JR, Glenn G, Duray P, Darling T, Weirich G, Zbar B, et al. Birt-Hogg-Dube syndrome: a novel marker of kidney neoplasia. Arch Dermatol. 1999;135:1195–202. [PubMed]
  • Urban T, Lazor R, Lacronique J, Murris M, Labrune S, Valeyre D, et al. Pulmonary lymphangioleiomyomatosis. A study of 69 patients. Groupe d'Etudes et de Recherche sur les Maladies “Orphelines” Pulmonaires (GERM“O”P) Medicine (Baltimore) 1999;78:321–37. [PubMed]
  • van Slegtenhorst M, de Hoogt R, Hermans C, Nellist M, Janssen B, Verhoef S, et al. Identification of the tuberous sclerosis gene TSC1 on chromosome 9q34. Science. 1997;277:805–808. [PubMed]
  • van Slegtenhorst M, Khabibullin D, Hartman TR, Nicolas E, Kruger WD, Henske EP. The Birt-Hogg-Dube and tuberous sclerosis complex homologs have opposing roles in amino acid homeostasis in schizosaccharomyces pombe. J Biol Chem. 2007;282:24583–90. [PubMed]
  • Vocke CD, Yang Y, Pavlovich CP, Schmidt LS, Nickerson ML, Torres-Cabala CA, et al. High frequency of somatic frameshift BHD gene mutations in Birt-Hogg-Dube-associated renal tumors. J Natl Cancer Inst. 2005;97:931–5. [PubMed]
  • Warren MB, Torres-Cabala CA, Turner ML, Merino MJ, Matrosova VY, Nickerson ML, et al. Expression of Birt-Hogg-Dube gene mRNA in normal and neoplastic human tissues. Mod Pathol. 2004;17:998–1011. [PubMed]
  • Yang Y, Padilla-Nash HM, Vira MA, Abu-Asab MS, Val D, Worrell R, et al. The UOK 257 cell line: a novel model for studies of the human Birt-Hogg-Dube gene pathway. Cancer Genet Cytogenet. 2008;180:100–9. [PMC free article] [PubMed]
  • Zbar B, Alvord WG, Glenn G, Turner M, Pavlovich CP, Schmidt L, et al. Risk of renal and colonic neoplasms and spontaneous pneumothorax in the Birt-Hogg-Dube syndrome. Cancer Epidemiol Biomarkers Prev. 2002;11:393–400. [PubMed]
  • Zhang Y, Gao X, Saucedo LJ, Ru B, Edgar BA, Pan D. Rheb is a direct target of the tuberous sclerosis tumour suppressor proteins. Nat Cell Biol. 2003;5:578–81. [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

  • Cited in Books
    Cited in Books
    PubMed Central articles cited in books
  • Gene
    Gene
    Gene links
  • Gene (nucleotide)
    Gene (nucleotide)
    Records in Gene identified from shared sequence links
  • GEO Profiles
    GEO Profiles
    Related GEO records
  • HomoloGene
    HomoloGene
    HomoloGene links
  • MedGen
    MedGen
    Related information in MedGen
  • Nucleotide
    Nucleotide
    Published Nucleotide sequences
  • Pathways + GO
    Pathways + GO
    Pathways, annotations and biological systems (BioSystems) that cite the current article.
  • Protein
    Protein
    Published protein sequences
  • PubMed
    PubMed
    PubMed citations for these articles
  • Substance
    Substance
    PubChem Substance links
  • Taxonomy
    Taxonomy
    Related taxonomy entry
  • Taxonomy Tree
    Taxonomy Tree

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...