• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of mbcLink to Publisher's site
Mol Biol Cell. Apr 1, 2009; 20(7): 2030–2040.
PMCID: PMC2663921

Tetraspanin Proteins Regulate Membrane Type-1 Matrix Metalloproteinase-dependent Pericellular Proteolysis

Jean E. Schwarzbauer, Monitoring Editor

Abstract

Membrane type-1 matrix metalloproteinase (MT1-MMP) supports tumor cell invasion through extracellular matrix barriers containing fibrin, collagen, fibronectin, and other proteins. Here, we show that simultaneous knockdown of two or three members of the tetraspanin family (CD9, CD81, and TSPAN12) markedly decreases MT1-MMP proteolytic functions in cancer cells. Affected functions include fibronectin proteolysis, invasion and growth in three-dimensional fibrin and collagen gels, and MMP-2 activation. Tetraspanin proteins (CD9, CD81, and TSPAN2) selectively coimmunoprecipitate and colocalize with MT1-MMP. Although tetraspanins do not affect the initial biosynthesis of MT1-MMP, they do protect the newly synthesized protein from lysosomal degradation and support its delivery to the cell surface. Interfering with MT1-MMP-tetraspanin collaboration may be a useful therapeutic approach to limit cancer cell invasion and metastasis.

INTRODUCTION

Matrix metalloproteinases (MMPs) are a family of soluble and membrane-anchored proteolytic enzymes that can remodel the extracellular matrix (ECM) and cleave several other substrates, including cell–cell and cell–matrix adhesion molecules, chemokines, cytokines, latent growth factors, and cell surface receptors (Egeblad and Werb, 2002 blue right-pointing triangle). Membrane type-1 MMP (MT1-MMP; MMP-14) is of particular interest because MT1-MMP knockout mice show severe defects, including skeletal abnormalities and fibrosis (Holmbeck et al., 1999 blue right-pointing triangle). MT1-MMP also plays critical roles during tumor malignancy and is one of the best-validated proteolytic enzyme targets on cancer cells. First, MT1-MMP is up-regulated in several tumor types, including breast, cervical, and ovarian cancer (Drew et al., 2004 blue right-pointing triangle; Zhai et al., 2005 blue right-pointing triangle; Jiang et al., 2006 blue right-pointing triangle) and is significantly associated with adverse outcome (Jiang et al., 2006 blue right-pointing triangle). Second, overexpression of MT1-MMP in the mammary gland of mice results in hyperplasia and spontaneous adenocarcinomas (Ha et al., 2001 blue right-pointing triangle). Third, ectopic expression of MT1-MMP and MT2-MMP, but not soluble MMPs, enables tumor cell penetration of three-dimensional (3D) collagen gels (Hotary et al., 2000 blue right-pointing triangle). Similarly, introduction of MT1-MMP into poorly invasive MCF-7 breast cancer cells renders those cells more invasive in vitro and more tumorigenic in vivo (Borrirukwanit et al., 2007 blue right-pointing triangle). Finally, silencing of endogenous MT1-MMP markedly decreases invasive and migratory properties of breast cancer cells (Jiang et al., 2006 blue right-pointing triangle).

MT1-MMP is regulated at the level of gene transcription, proenzyme activation, subcellular localization, internalization/recycling, dimerization, shedding, inhibition by natural inhibitors (tissue inhibitor of metalloproteinases, RECK), and posttranslational modifications (Itoh and Seiki, 2006 blue right-pointing triangle). In addition MT1-MMP associates with cell surface molecules such as β1 integrins (Galvez et al., 2002 blue right-pointing triangle), CD44 (Mori et al., 2002 blue right-pointing triangle), and tetraspanin proteins such as CD63 (Takino et al., 2003 blue right-pointing triangle), CD151 (Yanez-Mo et al., 2008 blue right-pointing triangle), CD81, and others (Kolesnikova et al., 2009 blue right-pointing triangle). Tetraspanins are a family of cell surface proteins (33 human members), each with four conserved transmembrane domains, characteristic extracellular loops, and short cytoplasmic domains (Hemler, 2003 blue right-pointing triangle). These relatively small proteins (typically 22–30 kDa) generally do not function as classical cell surface receptors. Rather, they serve as molecular organizers of multiprotein membrane complexes, thereby influencing cell proliferation, fusion, signaling, and migration (Stipp et al., 2003b blue right-pointing triangle). Tetraspanins can associate with each other and with other proteins such as integrins, immunoglobulin (Ig) superfamily members, proteoglycans, ligands, and growth factor receptors to form specialized membrane structures called tetraspanin-enriched microdomains (TEMs) (Hemler, 2005 blue right-pointing triangle). The tendency of different tetraspanins to associate closely within TEMs probably underlies the ability of distinct tetraspanins to provide functional compensation for each other (Fradkin et al., 2002 blue right-pointing triangle; Kaji et al., 2002 blue right-pointing triangle). On cancer cells, some tetraspanins (CD151 and CO-029) promote invasion (Claas et al., 1998 blue right-pointing triangle; Yang et al., 2008 blue right-pointing triangle), whereas others (NET-6, CD82, and CD9) behave more as tumor suppressors (Liu and Zhang, 2006 blue right-pointing triangle; Huang et al., 2007 blue right-pointing triangle; Takeda et al., 2007 blue right-pointing triangle).

Given their tendency to localize into cellular lamellipodia and filopodia (Penas et al., 2000 blue right-pointing triangle), tetraspanins are well positioned on the cell surface to orchestrate events such as pericellular proteolysis by membrane-anchored proteases. In this regard, tetraspanin CD151 association with endothelial cell MT1-MMP may inhibit MT1-MMP–dependent MMP-2 activation, while paradoxically supporting MT1-MMP–dependent collagen degradation (Yanez-Mo et al., 2008 blue right-pointing triangle). In another study, association with tetraspanin CD63 was suggested to accelerate lysosomal degradation of MT1-MMP in HeLa cells (Takino et al., 2003 blue right-pointing triangle). Given the importance of MT1-MMP as a proinvasive protease in cancer cells, we set out to identify the functional importance of tetraspanin-MT1-MMP associations in cancer cells. Among seven different tetraspanins analyzed, CD9, CD81, and TSPAN12 showed the most readily detectable associations with MT1-MMP. Hence, functional studies focused mostly on those tetraspanins. To ensure sufficient disruption of TEMs and to minimize functional compensation, we knocked down these tetraspanins two to three at a time. Furthermore, because tetraspanins had been shown to have conflicting effects on MT1-MMP functions, we undertook a comprehensive functional analysis, by using four different assays for MT1-MMP function. In addition, we provide mechanistic insight into how tetraspanins regulate MT1-MMP function.

MATERIALS AND METHODS

Cell Culture

Cell lines were from American Type Culture Collection (Manassas, VA). MCF-7 cells were stably transfected with MT1-MMP-FLAG (MCF-7-MT1), MT1-MMP-green fluorescent protein (GFP) (MCF-7-MT1-GFP, GFP at C terminus), or vector only using FuGENE6 (Roche Diagnostics, Indianapolis IN). FLAG-MT1-MMP from M. Seiki (University of Tokyo, Tokyo, Japan), was cloned into pcDNA3.1 (Invitrogen, Carlsbad CA). MT1-MMP-GFP is from wild type (wt) MT1-MMP cloned into phosphorylated enhanced green fluorescent protein (BD BioSciences, Palo Alto CA) and subcloned into pcDNA3.1. Stable cell lines were sorted as a pool population by flow cytometry. HT1080-FLAG–tagged MT1-MMP cells were generated as described above. TSPAN12-FLAG was cloned into pLXIZ and transfected into the pT67 packaging cell line. HT1080 cells were infected with viral supernatants to generate stable cell lines. All cells were maintained in DMEM (Invitrogen) with 10% fetal bovine serum (FBS).

Reagents and Antibodies

Bafilomycin A1 (vacuolar type H+ ATPase inhibitor), cytochalasin D, thrombin, pepstatin A (aspartyl peptidase inhibitor), E64, 4-(2-aminoethyl)benzenesulfonyl fluoride (AEBSF), anti-FLAG (M2) antibody, anti-β actin antibody, and secondary horseradish peroxidase (HRP)-conjugated goat anti-mouse antibody were from Sigma-Aldrich (St. Louis, MO). ALLM and MG132 were obtained from BIOMOL Research Laboratories (Plymouth Meeting, PA). Plasminogen-depleted fibrinogen was from Calbiochem (San Diego, CA). Protein G-agarose beads, aprotinin, and leupeptin (serine and thiol protease inhibitor) were from Roche Diagnostics. MT1-MMP antibodies (AB815 and LEM2/15.8) and GM6001 were from Millipore Bioscience Research Reagents (Billerica, MA). MT1-MMP antibody (28209) was from Abcam (Cambridge, MA). Anti-GFP antibody was from Clontech (Mountain View, CA). Anti-CD71 and anti-E-cadherin (G-10) antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA). Fibronectin and anti-fibronectin antibody were from BD Biosciences. Secondary HPR-conjugated goat anti-rabbit light chain was from Zymed Laboratories (South San Francisco, CA). Alexa 546-fibrinogen, Alexa 546-phalloidin, ProLong Gold antifade mounting media with 4,6-diamidino-2-phenylindole (DAPI), Alexa 488-donkey anti-rabbit, Alexa 488-donkey anti-mouse, and Alexa 546 goat anti-mouse were from Invitrogen. Type I collagen was from Inamed (Fremont, CA). Antibodies to CD9 included MM2/57 (BioSource International, Camarillo, CA), MEM-61 (GeneTex, San Antonio, TX) and ALB6 (Immunotech, Marseille, France). Other antibodies are TSPAN4 (Tachibana et al., 1997 blue right-pointing triangle), MHC I (W6/32) (Barnstable et al., 1978 blue right-pointing triangle), CD98 (4F2) (Hemler and Strominger, 1982 blue right-pointing triangle), CD147 (8G6), α3 integrin (A3X8), CD63 (6H1), CD81 (M38), CD82 (M104), and CD151 (5C11) (Yang et al., 2002 blue right-pointing triangle).

Immunoprecipitation, Western Blotting, and Zymography

Cells were lysed in 25 mM HEPES, 150 mM NaCl, 5 mM MgCl2, and 5 mM CaCl2 with protease inhibitor cocktail (Roche Diagnostics) and 1% detergent (Triton X-100, Brij 96, Brij 99, or 3-[(3-cholamidopropyl)dimethylammonio]propanesulfonate [CHAPS]) at 4°C. Radioimmunoprecipitation assay contained the above-mentioned components with 1% deoxycholate, 1% Triton X-100, and 0.1% SDS. In some cases, lysates were ultracentrifuged (Beckman L8-80M) at 100,000 × g. Equal lysate volumes were precleared with protein G-agarose beads and then immunoprecipitated with indicated antibodies and protein G overnight at 4°C. Beads were washed and eluted with SDS-sample buffer (50 mM Tris-HCl, pH 6.8, 1% SDS, 0.025% bromophenol blue, and 10% glycerol). Western blot analysis for MT1-MMP and antibody validation was performed as described previously (Lafleur et al., 2006 blue right-pointing triangle). Western blot analysis for CD9, CD81, and actin and antibody validation was performed as described previously (Stipp et al., 2003a blue right-pointing triangle; Kovalenko et al., 2007 blue right-pointing triangle). For zymography, samples were separated on a 10% polyacrylamide gel copolymerized with 1 mg/ml gelatin (Sigma-Aldrich) and developed as described previously (Lafleur et al., 2006 blue right-pointing triangle).

Small Interfering RNA (siRNA) Transfection

Cells were transfected with 10 nM (MCF-7 cells) or 25 nM (HT1080 cells) of indicated siRNAs (Dharmacon RNA Technologies, Lafayette, CO) with Lipofectamine RNAiMAX (Invitrogen). The sense sequences for the siRNAs are as follows: CD9#1, CCAAGAAGGACGUACUCGAUU; CD9#2, UUAAGGAAGUCCAGGAGUU; CD81#1, CCACCAACCUCCUGUAUCUUU; CD81#2, CCAACAACGCCAAGGCUGU; CD151#1, CCUCAAGAGUGACUACAUCUU; TSPAN12#1, GCAAACAGCUUUAAUACACUU; TSPAN12#2, GUACAAUGGUCAGAUAUGGUU; and control#1, UAGCGACUAAACACAUCAA.

3D Collagen and Fibrin Gels

Two days after siRNA transfection, cells were embedded into fibrin or collagen gels. For collagen gels, 5 × 104 cells were resuspended in 400 μl of neutralized and buffered collagen gels (2 mg/ml) and polymerized for 1 h at 37°C. Finally, cells were covered in growth media. For fibrin gels, 5 × 104 cells were resuspended in 400 μl of 2.5 mg/ml fibrinogen in serum-free media and polymerized with thrombin (1 U/ml) for 30 min at 37°C. Then, they were covered with growth media containing 50 μg/ml aprotinin.

Fibronectin Immunofluorescence

siRNA-treated cells were cultured on fibronectin coated (10 μg/ml) Lab-Tek chamber slides (Nalge Nunc International, Rochester, NY) for 24 h in serum-free media with protease inhibitors: 100 μg/ml aprotinin, 5 μM leupeptin, 20 μM E64, 20 μM pepstatin A, and 100 μM AEBSF. Cells were fixed with 4% paraformaldehyde, blocked/permeabilized with 5% bovine serum albumin (BSA)/phosphate-buffered saline (PBS)/0.25% Triton X-100, and immunostained with an anti-fibronectin antibody for 1 h at 20°C. Cells were then incubated with an Alexa 488 secondary antibody and Alexa 546-phalloidin for 1 h at 20°C. Cells were mounted with ProLong Gold antifade mounting media containing DAPI. Specificity of the anti-fibronectin antibody was obtained by negative staining of collagen coated slides (data not shown).

MTT Proliferation and Flow Cytometry

MCF-7-MT1 cells transfected with indicated siRNAs were plated in 96-well plates (2000 cells/well) in triplicate for 1–7 d. An MTT proliferation assay (Roche Diagnostics) was performed each day using an Opsys MR Thermo Lab Systems plate reader. For flow cytometry, cells were blocked with 5% goat serum/1% BSA/0.02% NaN3 in PBS at 4°C and then stained with primary antibodies for 1 h at 4°C. Cells were washed and incubated with Alexa 488-conjugated donkey anti-rabbit or anti-mouse secondary antibodies for 1 h at 4°C and washed before analysis.

Internalization

MCF-7-MT1-GFP cells were incubated with 0.5 mg/ml EZ-link Sulfo-NHS-SS-biotin (Pierce Chemical, Rockford, IL) at 4°C for 1 h. Cells were washed in PBS and incubated in serum-free media for 0, 10, or 30 min at 37°C. Cells were washed and incubated with reducing solution (42 mM glutathione, 75 mM NaCl, 1 mM EDTA, 1% BSA, and 75 mM NaOH) for 40 min at 4°C. Cells were washed with PBS, lysed as described above for immunoprecipitation with 1% Triton X-100 lysis buffer, and MT1-MMP was immunoprecipitated with an anti-GFP antibody. Eluates were analyzed by Western blotting using ExtrAvidin-HRP.

Pulse-Chase

MCF-7-MT1-FLAG cells were incubated with DMEM lacking l-cysteine and l-methionine (Invitrogen), 10% dialyzed FBS, 25 mM HEPES, l-glutamine, and penicillin/streptomycin for 30 min at 37°C. Cells were pulsed (30 min) with the above-mentioned media with 0.2 mCi/ml EasyTag Expression Protein Labeling Mix [35S]l-methionine and [35S]l-cysteine (PerkinElmer Life and Analytical Sciences, Waltham, MA). Cells were chased with DMEM lacking l-cysteine and l-methionine, 10% dialyzed FBS, 25 mM HEPES, l-glutamine, penicillin/streptomycin, 0.2 mM l-cysteine, and 0.2 mM l-methionine. Cells were lysed as described above for immunoprecipitation with 1% Triton X-100 lysis buffer with 10 mg/ml BSA. Lysates were precleared and immunoprecipitated using 28209 anti-MT1-MMP antibody. Eluates were separated on a 4–20% gradient gel (Invitrogen), transferred to polyvinylidene difluoride membrane, and exposed to a PhosphorImager screen (GE Healthcare, Chalfont St. Giles, Buckinghamshire, United Kingdom) overnight. Cell surface pulse-chase experiments were as described above, except that before immunoprecipitation, intact cells were cooled to 4°C and then incubated with the M2 anti-FLAG antibody for 2 h at 4°C, and then lysed.

RNA Isolation and Reverse Transcription-Polymerase Chain Reaction (RT-PCR)

RNA was harvested using RNeasy mini columns (QIAGEN, Valencia CA). Reverse transcription was performed with the SuperScript first-strand synthesis system (Invitrogen). PCR was performed with PCR buffer (1.5 mM MgCl2), 200 μM dNTPs (Roche Diagnostics), 200 nM forward and reverse primers, 5 U of Taq DNA polymerase (Roche Diagnostics), and template. PCR conditions were as follows: 94°C for 2 min and then 35 cycles (TSPAN12) or 25 cycles (glyceraldehyde-3-phosphate dehydrogenase [GAPDH]) of 94°C 15 s, 60°C 30 s, and 72°C 1 min by using a DNA Engine Peltier thermal cycler (Bio-Rad, Hercules, CA).

Primers used were as follows: TSPAN12 5′, CTCTTGATAAAGGTCACTGAGATC; TSPAN12 3′, TGTTGCTTCTTGCATGGTACTTTG; GAPDH 5′, CGGAGTCAACGGATTTGGTCGTAT; and GAPDH 3′, AGCCTTCTCCATGGTGGTGAAGAC.

Statistical Analysis

Where indicated, a t test (2-tailed, unequal variance) was performed when comparing two groups; control versus tetraspanin knockdown. The p values were obtained for each tetraspanin knockdown condition (single, double, or triple) compared with the control.

Image and Data Acquisition, Including Microscopy

For zymograms and Western blots, original gels or films, respectively, were scanned using an Epson perfection 1650 scanner. Images were cropped using Adobe Photoshop 6.0 (Adobe Systems, Mountain View, CA) and imported into Canvas 9.0 for labeling. For 35S pulse-chase experiments, images were obtained by PhosphorImager (Scanner Control, version 4.1; GE Healthcare). For all RT-PCR, DNA images were acquired with a Gene Genius Bio Imaging System and GeneSnap software version 4.0. Where indicated, densitometry was performed with ImageQuant version 5.2 (GE Healthcare). Phase-contrast images were acquired using an Axiovert 135 microscope (Carl Zeiss, Jena, Germany) and RT monochrome Spot camera and software, version 3.3 (Diagnostic Instruments, Sterling Heights, MI) with a 40× objective (Figure 2D) or a 10× objective (Figure 3A). Growth area in Figure 3 was quantitated using Scion Image, version 1.62, while focused on the same plane for each sample. Immunofluorescent images were acquired with a Nikon Eclipse TE300 fluorescent microscope and RT SE. Spot camera and software, version 4.6 (Diagnostic Instruments) with a 40× objective. Fibronectin degradation was quantitated by measuring pixel density (using ImageQuant 5.2) within comparably sized areas of fibronectin proteolysis. Confocal images were acquired with a Zeiss LSM 510 META confocal microscope (Harvard NeuroDiscovery Center, Boston, MA). Z-stack reconstructions (143.4 × 143.4 × 22.1 μm) were performed from images taken every 1.1 μm with a 63× objective, and images were viewed with a Zeiss LSM Image Browser, version 3.5.0.223. Flow cytometry data acquisition was performed using a FACSCalibur flow cytometer with CellQuest software, version 3.3, with data analyzed using FlowJo software, version 6.4.4 (BD Biosciences).

Figure 2.
Tetraspanin effects on MT1-MMP subcellular localization. (A) MCF-7-MT1-GFP cells were treated with the indicated control (IgG and MHC I) and tetraspanin (CD9 and CD81) antibodies (50 μg/ml for 2 d), fixed (in 4% paraformaldehyde), blocked in 5% ...
Figure 3.
Quantitation of tetraspanin effects on MT1-MMP-dependent cell growth/invasion within 3D fibrin gels. (A) MCF-7-MT1 and MCF-7-VC cells were treated for 2 d with siRNAs, and then cells were embedded within fibrin gels for the indicated times. Representative ...

RESULTS

MT1-MMP Association with Tetraspanin Proteins

MT1-MMP may associate with at least four different tetraspanin proteins (Takino et al., 2003 blue right-pointing triangle; Yanez-Mo et al., 2008 blue right-pointing triangle; Kolesnikova et al., 2009 blue right-pointing triangle). To clarify which might associate best with MT1-MMP on tumor cell lines, we immunoprecipitated CD9, CD63, CD81, CD82, CD151, and TSPAN4 from MCF-7-MT1 and MDA-MB-231 cells (Figure 1A). CD9 and CD81 yielded the most MT1-MMP, as seen by gelatin zymography and Western blot. TSPAN12 also associated with MT1-MMP, as seen upon immunoprecipitating TSPAN12-FLAG from HT1080 cells (Figure 1B). Antibodies to other tetraspanins (CD63, CD82, and CD151) or other abundant cell surface proteins (major histocompatibility complex I [MHC I], CD147) yielded little or no MT1-MMP (Figures 1, A and B). All tetraspanins and negative control proteins analyzed were well expressed by MCF-7-MT1, HT1080, and MDA-MB-231 cells with the exception of CD9 in HT1080 cells (Supplemental Table 1). In a reciprocal experiment, immunoprecipitation of MT1-MMP-FLAG but not control proteins (MHC I and CD147) yielded CD9 and CD81 (Figure 1C).

Figure 1.
Specific tetraspanins associating with MT1-MMP. (A) MCF-7-MT1 and MDA-MB-231 cells were lysed in 1% Brij 99 lysis buffer, and the indicated tetraspanins were immunoprecipitated (TSPAN, cocktail of tetraspanin antibodies against CD9, CD63, CD81, CD82, ...

CD81 immunoprecipitation from HT1080 cells yielded MT1-MMP regardless of whether lysates were centrifuged at 100,000 × g (Supplemental Figure 1A). Hence, MT1-MMP-tetraspanin associations are not a protein insolubility artifact. MT1-MMP-tetraspanin association was also observed in MDA-MB-231, BT549, 293, U87, and NT2 cancer cells. Cells with minimal MT1-MMP expression (HeLa, LN827, MCF-7, A549, and K562) did not yield MT1-MMP zymogram activity (Supplemental Figure 1B).

Choice of lysis buffer is critical in these experiments. Immunoprecipitation of TSPAN12 yielded MT1-MMP in relatively stringent conditions (1% Brij 96 or TX-100), whereas CD9 and CD81 associations were seen in less stringent conditions (1% Brij 99 and CHAPS) (Supplemental Figure 2A and Supplemental Table 2). To confirm that tetraspanin-MT1-MMP associations are not postlysis artifacts, HT1080 1% Brij 99 lysates, containing TSPAN12-FLAG or MT1-MMP-GFP, were either mixed 1:1 or kept separate. Immunoprecipitation of FLAG yielded TSPAN12-FLAG and immunoprecipitation of GFP yielded MT1-MMP-GFP. There was no evidence of postlysis association between FLAG- and GFP-tagged proteins (Supplemental Figure 2B). As a positive control, immunoprecipitation of TSPAN12-FLAG yielded endogenous MT1-MMP (Supplemental Figure 2B, bottom left). Immunoprecipitation of CD81 yielded comparable amounts of both endogenous MT1-MMP and MT1-MMP-GFP (Supplemental Figure 2B, right). Hence, the GFP moiety does not interfere with MT1-MMP-GFP-tetraspanin association.

We also treated MCF-7-MT1-GFP cells with anti-CD9, anti-CD81, or control antibodies. Cells were then fixed and assessed for MT1-MMP-GFP and CD9 expression. Antibodies to CD9 or CD81, but not control antibodies (IgG or anti-MHC I), triggered coclustering of MT1-MMP-GFP (green) and CD9 (red) into overlapping punctate complexes (Figure 2A, white arrowheads). Cell morphology was not noticeably altered by antibody treatment (Figure 2A, bottom). These results support the conclusion that MT1-MMP associates with tetraspanins CD9 and CD81.

Tetraspanins Promote MT1-MMP–dependent Functions

In previous studies, tetraspanins CD63 and CD151 were suggested to inhibit MT1-MMP–dependent MMP-2 activation (Takino et al., 2003 blue right-pointing triangle; Yanez-Mo et al., 2008 blue right-pointing triangle), while paradoxically promoting collagen degradation (Yanez-Mo et al., 2008 blue right-pointing triangle). Here, we undertook a comprehensive assessment of the effects of tetraspanins (CD9, CD81, and TSPAN12) on tumor cell MT1-MMP, by using four different functional assays. To focus attention on MT1-MMP, we mostly compared the functions of MCF-7-MT1 and MCF-7-VC cells. The former cells are stably transfected to express moderate levels of MT1-MMP, whereas the latter are vector control cells, with minimal background MMP activity. To efficiently disrupt the tetraspanin network in MCF-7-VC and MCF-7-MT1 cells, we silenced tetraspanins (CD9, CD81, and TSPAN12) in combinations of two or three at a time. Evidence for efficient knockdown of CD9, CD81, and TSPAN12 is shown in Supplemental Figure 3, A–C.

Tetraspanin effects on MT1-MMP function were first analyzed using Alexa 546-labeled 3D fibrin gels. During a 2-d growth interval, control siRNA-treated MCF7-MT1-GFP cells created large fibrin-depleted boroughs, as seen in both XY planes and in Z stacks (Figure 2B, left). By contrast, CD9/CD81/TSPAN12 siRNA-treated cells showed smaller regions of fibrin proteolysis (Figure 2A, right). Also evident were striking differences in MT1-MMP-GFP localization. In control siRNA-treated cells, MT1-MMP-GFP was localized mainly at the periphery, with some intracellular signal (Figure 2B, left). On tetraspanin knockdown, MT1-MMP-GFP became predominantly intracellular (Figure 2B, right).

In another 3D fibrin gel experiment, embedded MCF-7-VC and MCF-7-MT1 cells were monitored for changes in invasion and growth, due to tetraspanin knockdown (Figure 3). Using MT1-MMP to escape from fibrin growth constraints (Hotary et al., 2003 blue right-pointing triangle), control siRNA-treated MCF-7-MT1 cells efficiently spread, invaded, and proliferated within fibrin gels (Figure 3A, row 3). By contrast, CD9/CD81/TSPAN12 knockdown cells showed minimal invasion and growth (Figure 3A, row 4). Double knockdown (CD9/CD81) MCF-7-MT1 cells also were markedly impaired, whereas single knockdown cells were affected to a lesser extent (Figure 3B). Because MCF-7-VC cells are minimally fibrinolytic, they were unable to escape matrix growth constraints. Consequently, they grew as immobile cysts, regardless of tetraspanin knockdown (Figure 3A, rows 1 and 2; and B). Proliferation of MCF-7-MT1 cells was not significantly affected by tetraspanin knockdown in a 2D proliferation/viability assay (Figure 3C).

Similar experiments were then carried out using 3D collagen gels. Once again, control siRNA-treated MCF7-MT1 cells, but not tetraspanin knockdown cells, escaped from a 3D growth restraint (Supplemental Figure 4B). Again, triple knockdown and CD9/CD81 double knockdown were most effective, whereas other double and single knockdowns were less effective (Supplemental Figure 4B). By contrast, tetraspanin knockdown had little effect on control MCF-7 cells (Supplemental Figure 4A).

A third type of ECM degradation assay was then carried out, involving MT1-MMP-dependent pericellular fibronectin degradation. On plating on fibronectin overnight, MCF-7-MT1 cells efficiently cleared fibronectin, leaving dark patches in the fluorescent green lawn (Figure 4, top left). However, fibronectin degradation was significantly reduced after knockdown of CD9/CD81 or CD9/CD81/TSPAN12 (Figure 4, bottom). Other single or double knockdowns had minimal effect on MCF-7-MT1 cells (Figure 4). As expected, control MCF-7-VC cells did not degrade fibronectin, with or without tetraspanin knockdown (Figure 4, far right).

Figure 4.
Tetraspanin effects on MT1-MMP-dependent fibronectin degradation. MCF-7-VC and MCF-7-MT1 cells were treated with siRNAs, plated 4 d later on fibronectin (FN)-coated slides, and then incubated overnight in serum-free media with protease inhibitors (50 ...

We next analyzed pro-MMP-2 activation, which is principally mediated by MT1-MMP (Sato et al., 1994 blue right-pointing triangle). Compared with control knockdown, CD9/CD81/TSPAN12 knockdown in MCF-7-MT1 cells caused activation of pro-MMP-2 to be ~78% inhibited (Figure 5A). We also analyzed tetraspanin knockdown effects on endogenous MT1-MMP in HT1080 cells. Because HT1080 cells do not express CD9, we knocked down CD81, TSPAN12, and CD151 (which weakly associates with MT1-MMP). Again, tetraspanin knockdown decreased pro-MMP-2 activation, this time by ~40% (Figure 5B). The effect was particularly obvious when cytochalasin D (cyto D) was added to increase MT1-MMP protein levels in HT1080 cells. Cyto D has been shown previously to increase the transcription of MT1-MMP (Yan et al., 2000 blue right-pointing triangle). Little MMP-2 activation was seen in MCF-7-VC cells (Figure 5C), thus confirming that MMP-2 activation is almost entirely MT1-MMP dependent in our MCF-7 cell system.

Figure 5.
Tetraspanin effects on MT1-MMP–dependent pro-MMP-2 activation. (A) MCF-7-MT1 cells were treated with control or CD9/CD81/TSPAN12 (3xTSPAN) siRNAs and after 4 d, cells were plated and incubated overnight in serum-free media supplemented with conditioned ...

Mechanistic Insights: How Do Tetraspanins Affect MT1-MMP Functions?

Tetraspanin knockdown (CD9/CD81/TSPAN12) in MCF-7-MT1 cells decreased levels of both full-length and cleaved MT1-MMP (cMT1) by 75 and 80%, respectively, as seen by densitometric quantitation (Figure 6A). Cell surface expression of MT1-MMP was also diminished, by 40–60%, as seen by flow cytometry using two different anti-MT1-MMP antibodies (Figure 6B). Surface expressions of other abundant cell surface proteins (MHC I, E-cadherin, and α3 integrin) were mostly unaffected, whereas CD9 and CD81 were appropriately diminished (Figure 6B). To confirm CD9/CD81/TSPAN12 knockdown results above, a second set of CD9, CD81, and TSPAN12 siRNAs were tested. Again, substantial knockdown of CD9, CD81, and TSPAN12 was accompanied by ~50% reduction in expression of MT1-MMP (Supplemental Table 3).

Figure 6.
Tetraspanin effects on MT1-MMP expression. (A) TX114 cell lysates from MCF-7-MT1 samples in Figure 5A were blotted for MT1-MMP (AB815 antibody) and actin. Densitometry was performed on Western blots to yield indicated percent values relative to control ...

Tetraspanin knockdown (CD81/TSPAN12/CD151) also decreased expression of total endogenous MT1-MMP (full length and cMT1) in HT1080 cells. Expression decreased by 45–55%, depending on whether cytochalasin D was absent or present (Figure 6C). Cell surface expression of endogenous HT1080 MT1-MMP also showed a significant decrease (~30%), as detected by flow cytometry using two different anti-MT1-MMP antibodies. Control experiments confirmed knockdown of CD81, CD151, and TSPAN12 (Figure 6D and Supplemental Figure 4D), whereas other abundant cell surface proteins (MHC I and CD98) were unaffected (Figure 6D).

To address the mechanism whereby tetraspanins affect MT1-MMP protein levels, we first analyzed cell surface internalization. Knockdown of CD9/CD81/TSPAN12 did not affect MT1-MMP internalization in MCF-7-MT1-GFP cells, as determined using a reducible biotin accessibility assay (Supplemental Figure 5). Next, we used pulse-chase [35S]Met/Cys labeling to assess MT1-MMP delivery to the cell surface. After siRNA treatment, MCF-7-MT1 cells were pulsed (30 min) and then chased for 0, 20, 45, 90, or 210 min. Before lysis, cells were incubated with anti-FLAG antibody, which bound to extracellular pro- and active MT1-MMP-FLAG. After lysis, cell surface MT1-MMP-FLAG proteins were immunoprecipitated and analyzed (Figure 7A). Already at 30-min pulse, 0-min chase, there was less newly synthesized MT1-MMP delivered to the surface of CD9/CD81/TSPAN12 knockdown cells (Figure 7A), despite there being similar amounts of total MT1-MMP synthesized in control and tetraspanin knockdown cells (Figure 7B, time zero). Later time points (20-, 45-, and 90-min chase) confirmed the deficit in cell surface delivery caused by tetraspanin knockdown (Figure 7A). Figure 7D confirmed CD9 and CD81 knockdown and decreased levels of total MT1-MMP. Pulse-chase analysis of total MT1-MMP (Figure 7B) showed that tetraspanin knockdown did not diminish total MT1-MMP synthesis rates nor affect much the rapid conversion of pro- to active form. However, total MT1-MMP was degraded at a faster rate, and very little of the autocatalytically generated cMT1 was produced upon CD9/CD81/TSPAN12 knockdown. These results indicate that silencing of CD9/CD81/TSPAN12 causes less MT1-MMP to reach the cell surface. Instead, it seems to be rerouted to an intracellular compartment and degraded at a faster rate.

Figure 7.
Tetraspanins affect MT1-MMP trafficking and stability. (A) MCF-7-MT1 cells were transfected with control or CD9/CD81/TSPAN12 (3xTSPAN) siRNAs. After 4 d, the cell surface subset of MT1-MMP was analyzed by [35S]Met/Cys pulse-chase (see Materials and Methods ...

To gain further insight into MT1-MMP degradation, we treated control or CD9/CD81/TSPAN12-silenced MCF-7-MT1-GFP cells with lysosome and proteasome inhibitors. Lysosome inhibitors (chloroquine, bafilomycin A1, and pepstatin A/leupeptin combination) largely protected total MT1-MMP from CD9/CD81/TSPAN12 knockdown-induced degradation (Figure 7C). By contrast, proteasome inhibitors (MG132 and lactacystin) did not protect MT1-MMP from degradation.

DISCUSSION

The role of MT1-MMP as a proinvasive protease during tumor cell invasion has been well established (Osenkowski et al., 2004 blue right-pointing triangle; Itoh and Seiki, 2006 blue right-pointing triangle). MT1-MMP associates with various tetraspanin proteins (Takino et al., 2003 blue right-pointing triangle; Yanez-Mo et al., 2008 blue right-pointing triangle; Kolesnikova et al., 2009 blue right-pointing triangle), resulting in possible negative regulation of expression (Takino et al., 2003 blue right-pointing triangle), and both negative and positive functional regulation (Yanez-Mo et al., 2008 blue right-pointing triangle). Here, we describe how multiple tetraspanins associate with newly synthesized MT1-MMP in cancer cells, thereby preventing its lysosomal degradation, supporting cell surface expression and uniformly enhancing MT1-MMP functions in multiple proteolysis assays.

Functional Consequences of Tetraspanin Association

Among seven tetraspanins tested, CD9, CD81, and TSPAN12 showed the most robust MT1-MMP association, as seen by reciprocal coimmunoprecipitation and antibody-induced colocalization. Removal of tetraspanins CD9, CD81, and/or TSPAN12 markedly diminished all MT1-MMP–dependent functions tested. MT1-MMP promotes fibronectin proteolysis, leading to enhanced cell migration and invasion (Takino et al., 2007 blue right-pointing triangle). Tetraspanin knockdown impaired MT1-MMP–dependent proteolysis of two-dimensional fibronectin, which should lead to impaired cell migration and invasion. MT1-MMP also supports tumor proliferation by relieving growth constraints imposed by 3D ECM (Hotary et al., 2003 blue right-pointing triangle). Tetraspanin knockdown markedly diminished cancer cell invasion and proliferation within 3D fibrin and collagen gels, consistent with relief of growth constraints. These results may help to explain why loss of tetraspanin-MT1-MMP association correlated with diminished glioblastoma growth within a 3D in vivo setting (Kolesnikova et al., 2009 blue right-pointing triangle). Another important function of MT1-MMP is to activate MMP-2 (Sato et al., 1994 blue right-pointing triangle). Tetraspanin knockdown markedly diminished activation of MMP-2 by MT1-MMP (either endogenous or overexpressed) in two different tumor cell lines. Given that MMP-2 also can be a key player during tumor cell invasion/tumor progression (Itoh et al., 1998 blue right-pointing triangle), loss of MMP-2 activation likely contributes to impaired tumor cell functions caused by tetraspanin knockdown.

Deletion of individual tetraspanins in mice and flies has yielded relatively minor developmental effects (Hemler, 2005 blue right-pointing triangle), likely due to functional compensation among different tetraspanins (Fradkin et al., 2002 blue right-pointing triangle; Kaji et al., 2002 blue right-pointing triangle). Here, compared with single tetraspanin knockdowns, depletion of two or three tetraspanins more notably diminished MT1-MMP expression and functions. Among combinations tested, CD9/CD81 knockdown was most effective, consistent with these molecules providing overlapping (i.e., partly compensating) contributions toward MT1-MMP expression and function. In this regard, the structurally similar CD9 and CD81 molecules partially compensate for each other during oocyte fertilization (Rubinstein et al., 2006 blue right-pointing triangle). CD9 and CD81 are not known to support tumor invasion and growth, perhaps because they are usually studied one at a time. Notably, CD9/CD81 null and MT1-MMP null mice show striking similarities. Both strains show diminished size, abnormal bone-associated phenotypes (e.g., osteopenia), and alveolar airspace enlargement (Holmbeck et al., 1999 blue right-pointing triangle; Hemler, 2003 blue right-pointing triangle; Takeda et al., 2003 blue right-pointing triangle; Atkinson et al., 2005 blue right-pointing triangle). Hence, the CD9/CD81 null mouse phenotype could arise, at least partly, from altered MT1-MMP regulation.

Compared with CD9/CD81 double knockdown results, TSPAN12/CD9/CD81 triple knockdown effects were only slightly more obvious, possibly because endogenous TSPAN12 protein is less abundant than CD9 and CD81. Nonetheless, knockdown of endogenous TSPAN12 individually did have a small but significant effect on MT1-MMP functions within 3D fibrin and collagen matrices, suggesting that TSPAN12 can be a contributor. Its wide expression (Serru et al., 2000 blue right-pointing triangle) should enable collaboration with MT1-MMP on many cancer cell types. Further study of endogenous TSPAN12 protein awaits the development of appropriate antibody reagents.

Our CD81/CD151/TSPAN12 knockdown diminished MT1-MMP-dependent MMP-2 activation in HT1080 cells. Elsewhere, CD151 knockdown stimulated MT1-MMP–dependent MMP-2 activation on endothelial cells (Yanez-Mo et al., 2008 blue right-pointing triangle). These results are not necessarily contradictory because 1) knockdown of CD151 alone may be insufficient to disrupt MT1-MMP function within TEMs, and 2) regulation of MT1-MMP may differ in primary endothelial cells compared with tumor cell lines. In addition, in tumor cell lines MT1-MMP associations are much more robust with CD9 and CD81 (compared with CD151).

Tetraspanin Effects on MT1-MMP: Mechanistic Insights

Tetraspanin knockdown decreased MT1-MMP expression (both cell surface and total) in both overexpressed and endogenous systems. Hence, combinations of tetraspanins (especially CD9, CD81, TSPAN12, and CD151) support MT1-MMP expression. Elsewhere, knockdown of CD151 alone did not affect MT1-MMP expression (Yanez-Mo et al., 2008 blue right-pointing triangle), and CD63 knockdown increased rather than decreased MT1-MMP expression (Takino et al., 2003 blue right-pointing triangle). Because we did not observe CD63 association with MT1-MMP, we did not pursue CD63 further. MT1-MMP association with other cell surface proteins, including CD44, syndecan, and αV integrins (Barbolina and Stack, 2008 blue right-pointing triangle), leads to shedding and/or proteolytic processing. However, MT1-MMP does not seem to cause tetraspanin proteolysis.

For total MT1-MMP, initial synthesis and stability were unaltered upon tetraspanin removal—decreased expression was not seen until later time points (e.g., 2- to 4-h chase). However, cell surface MT1-MMP expression was greatly diminished even at early time points. Rather than going to the cell surface, newly synthesized MT1-MMP is apparently diverted to an intracellular compartment and subsequently degraded at an accelerated rate. Consistent with this, confocal microscopy showed that MT1-MMP was not only diminished in tetraspanin knockdown cells but also shifted away from the surface and into intracellular compartments. We considered that tetraspanin knockdown might cause MT1-MMP to be rapidly removed soon after it arrives at the cell surface. However, we did not observe increases in MT1-MMP internalization or shedding into exosome/microvesicle particles (unpublished data), again consistent with MT1-MMP not reaching the cell surface. After tetraspanin silencing, MT1-MMP disappearance was inhibited by lysosomal protease inhibitors chloroquine, bafilomycin A1, and pepstatin A/leupeptin combination. These results suggest that MT1-MMP is diverted into lysosomal compartments and degraded.

There is precedent for tetraspanins supporting partner protein surface expression. CD81 facilitates EWI-2 (Stipp et al., 2003a blue right-pointing triangle) and CD19 (Shoham et al., 2006 blue right-pointing triangle) surface expression, and tetraspanins UP1a and UP1b enable UPII and UPIII surface expression (Hu et al., 2005 blue right-pointing triangle). However, in these cases, tetraspanin absence impairs intracellular maturation. By contrast, diminished cell surface MT1-MMP is not accompanied by delayed maturation (Figure 7B). Hence, tetraspanins may affect MT1-MMP at a post-endoplasmic reticulum/Golgi stage, by a novel mechanism.

Because tetraspanins such as CD9, CD81, CD151 (Berditchevski, 2001 blue right-pointing triangle), and TSPAN12 (our unpublished data) associate with integrins, MT1-MMP should be brought into proximity with integrins, as demonstrated in endothelial cells for CD151 and MT1-MMP (Yanez-Mo et al., 2008 blue right-pointing triangle). Hence, tetraspanins may coordinate processes of cell adhesion and ECM proteolysis during cell invasion and migration. Within invading cells, MT1-MMP in lamellipodia and invadopodia is well positioned for localized ECM degradation (Itoh, 2006 blue right-pointing triangle). Indeed, silencing of proteins such as TI-VAMP/VAMP-7, Sec3/Sec8/IQGAP1, or RAb8 leads to disruption of invadopodia formation and/or loss of MT1-MMP-dependent tumor cell invasion (Bravo-Cordero et al., 2007 blue right-pointing triangle; Sakurai-Yageta et al., 2008 blue right-pointing triangle; Steffen et al., 2008 blue right-pointing triangle). Tetraspanin protein complexes contribute to the organization of lamellipodia, filopodia, and uropodia (Shigeta et al., 2003 blue right-pointing triangle; Stipp et al., 2003a blue right-pointing triangle) and therefore should also contribute to invadopodia. However, it remains to be seen whether ablation of tetraspanins, and loss of cell surface MT1-MMP expression, is accompanied by disruption of invadopodia.

Implications

Broad-spectrum synthetic inhibitors, targeting MMP active sites, have undergone extensive clinical testing. Unfortunately, these agents failed to provide useful cancer therapy in humans (Overall and Kleifeld, 2006 blue right-pointing triangle). Hence, the challenge remains to target MMPs successfully with minimal harmful side effects. For a membrane-bound protease, interfering with subcellular localization may be a beneficial alternative to typical active site inhibition approaches. Anti-tetraspanin antibody effects on MT1-MMP localization may represent a promising step in this direction. Furthermore, because adult mice survive well without CD9 and CD81 expression (Takeda et al., 2003 blue right-pointing triangle), therapies targeting these molecules should not be excessively toxic. This approach could potentially provide alternative treatment options for tumor invasion and metastasis and other pathological conditions dependent on pericellular proteolysis.

Supplementary Material

[Supplemental Materials]

ACKNOWLEDGMENTS

This work was supported by National Institutes of Health grant GM-38903 and a Canadian Institutes of Health Research (CIHR) fellowship (to M.A.L.).

Abbreviations used:

GFP
green fluorescent protein
MMP
matrix metalloproteinase
MT1-MMP
membrane type-1 matrix metalloproteinase
TEM
tetraspanin-enriched microdomain.

Footnotes

This article was published online ahead of print in MBC in Press (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E08-11-1149) on February 11, 2009.

REFERENCES

  • Atkinson J. J., Holmbeck K., Yamada S., Birkedal-Hansen H., Parks W. C., Senior R. M. Membrane-type 1 matrix metalloproteinase is required for normal alveolar development. Dev. Dyn. 2005;232:1079–1090. [PubMed]
  • Barbolina M. V., Stack M. S. Membrane type 1-matrix metalloproteinase: substrate diversity in pericellular proteolysis. Semin. Cell Dev. Biol. 2008;19:24–33. [PMC free article] [PubMed]
  • Barnstable C. J., Bodmer W. F., Brown G., Galfre G., Milstein C., Williams A. F., Ziegler A. Production of monoclonal antibodies to group A erythrocytes, HLA and other human cell surface antigens-new tools for genetic analysis. Cell. 1978;14:9–20. [PubMed]
  • Berditchevski F. Complexes of tetraspanins with integrins: more than meets the eye. J. Cell Sci. 2001;114:4143–4151. [PubMed]
  • Borrirukwanit K., Lafleur M. A., Mercuri F. A., Blick T., Price J. T., Fridman R., Pereira J. J., Leardkamonkarn V., Thompson E. W. The type I collagen induction of MT1-MMP-mediated MMP-2 activation is repressed by alphaVbeta3 integrin in human breast cancer cells. Matrix Biol. 2007;26:291–305. [PubMed]
  • Bravo-Cordero J. J., Marrero-Diaz R., Megias D., Genis L., Garcia-Grande A., Garcia M. A., Arroyo A. G., Montoya M. C. MT1-MMP proinvasive activity is regulated by a novel Rab8-dependent exocytic pathway. EMBO J. 2007;26:1499–1510. [PMC free article] [PubMed]
  • Claas C., Seiter S., Claas A., Savelyeva L., Schwab M., Zoller M. Association between the rat homologue of CO-029, a metastasis-associated tetraspanin molecule and consumption coagulopathy. J. Cell Biol. 1998;141:267–280. [PMC free article] [PubMed]
  • Drew A. F., Blick T. J., Lafleur M. A., Tim E. L., Robbie M. J., Rice G. E., Quinn M. A., Thompson E. W. Correlation of tumor- and stromal-derived MT1-MMP expression with progression of human ovarian tumors in SCID mice. Gynecol. Oncol. 2004;95:437–448. [PubMed]
  • Egeblad M., Werb Z. New functions for the matrix metalloproteinases in cancer progression. Nat. Rev. Cancer. 2002;2:161–174. [PubMed]
  • Fradkin L. G., Kamphorst J. T., DiAntonio A., Goodman C. S., Noordermeer J. N. Genomewide analysis of the Drosophila tetraspanins reveals a subset with similar function in the formation of the embryonic synapse. Proc. Natl. Acad. Sci. USA. 2002;99:13663–13668. [PMC free article] [PubMed]
  • Galvez B. G., Matias-Roman S., Yanez-Mo M., Sanchez-Madrid F., Arroyo A. G. ECM regulates MT1-MMP localization with beta1 or alphavbeta3 integrins at distinct cell compartments modulating its internalization and activity on human endothelial cells. J. Cell Biol. 2002;159:509–521. [PMC free article] [PubMed]
  • Ha H. Y., et al. Overexpression of membrane-type matrix metalloproteinase-1 gene induces mammary gland abnormalities and adenocarcinoma in transgenic mice. Cancer Res. 2001;61:984–990. [PubMed]
  • Hemler M. E. Tetraspanin proteins mediate cellular penetration, invasion, and fusion events and define a novel type of membrane microdomain. Annu. Rev. Cell Dev. Biol. 2003;19:397–422. [PubMed]
  • Hemler M. E. Tetraspanin functions and associated microdomains. Nat. Rev. Mol. Cell. Biol. 2005;6:801–811. [PubMed]
  • Hemler M. E., Strominger J. L. Characterization of antigen recognized by the monoclonal antibody (4F2): different molecular forms on human T and B lymphoblastoid cell lines. J. Immunol. 1982;129:623–628. [PubMed]
  • Holmbeck K., et al. MT1-MMP-deficient mice develop dwarfism, osteopenia, arthritis, and connective tissue disease due to inadequate collagen turnover. Cell. 1999;99:81–92. [PubMed]
  • Hotary K., Allen E., Punturieri A., Yana I., Weiss S. J. Regulation of cell invasion and morphogenesis in a three-dimensional type I collagen matrix by membrane-type matrix metalloproteinases 1, 2, and 3. J. Cell Biol. 2000;149:1309–1323. [PMC free article] [PubMed]
  • Hotary K. B., Allen E. D., Brooks P. C., Datta N. S., Long M. W., Weiss S. J. Membrane type I matrix metalloproteinase usurps tumor growth control imposed by the three-dimensional extracellular matrix. Cell. 2003;114:33–45. [PubMed]
  • Hu C. C., Liang F. X., Zhou G., Tu L., Tang C. H., Zhou J., Kreibich G., Sun T. T. Assembly of urothelial plaques: tetraspanin function in membrane protein trafficking. Mol. Biol. Cell. 2005;16:3937–3950. [PMC free article] [PubMed]
  • Huang H., Sossey-Alaoui K., Beachy S. H., Geradts J. The tetraspanin superfamily member NET-6 is a new tumor suppressor gene. J. Cancer Res. Clin. Oncol. 2007;133:761–769. [PubMed]
  • Itoh T., Tanioka M., Yoshida H., Yoshioka T., Nishimoto H., Itohara S. Reduced angiogenesis and tumor progression in gelatinase A-deficient mice. Cancer Res. 1998;58:1048–1051. [PubMed]
  • Itoh Y. MT1-MMP: a key regulator of cell migration in tissue. IUBMB Life. 2006;58:589–596. [PubMed]
  • Itoh Y., Seiki M. MT1-MMP: a potent modifier of pericellular microenvironment. J. Cell. Physiol. 2006;206:1–8. [PubMed]
  • Jiang W. G., Davies G., Martin T. A., Parr C., Watkins G., Mason M. D., Mansel R. E. Expression of membrane type-1 matrix metalloproteinase, MT1-MMP in human breast cancer and its impact on invasiveness of breast cancer cells. Int. J. Mol. Med. 2006;17:583–590. [PubMed]
  • Kaji K., Oda S., Miyazaki S., Kudo A. Infertility of CD9-deficient mouse eggs is reversed by mouse CD9, human CD9, or mouse CD81; polyadenylated mRNA injection developed for molecular analysis of sperm-egg fusion. Dev. Biol. 2002;247:327–334. [PubMed]
  • Kolesnikova T., Kazarov A., Lemieux M. E., Lafleur M. A., Kesari S., Kung A. L., Hemler M. E. Glioblastoma Inhibition by Cell Surface Immunoglobulin Protein EWI-2, In Vitro and In Vivo. Neoplasia. 2009;11:77–86. [PMC free article] [PubMed]
  • Kovalenko O. V., Yang X. H., Hemler M. E. A novel cysteine cross-linking method reveals a direct association between claudin-1 and tetraspanin CD9. Mol. Cell Proteomics. 2007;6:1855–1867. [PubMed]
  • Lafleur M. A., Mercuri F. A., Ruangpanit N., Seiki M., Sato H., Thompson E. W. Type I collagen abrogates the clathrin-mediated internalization of membrane type 1 matrix metalloproteinase (MT1-MMP) via the MT1-MMP hemopexin domain. J. Biol. Chem. 2006;281:6826–6840. [PubMed]
  • Liu W. M., Zhang X. A. KAI1/CD82, a tumor metastasis suppressor. Cancer Lett. 2006;240:183–194. [PubMed]
  • Mori H., Tomari T., Koshikawa N., Kajita M., Itoh Y., Sato H., Tojo H., Yana I., Seiki M. CD44 directs membrane-type 1 matrix metalloproteinase to lamellipodia by associating with its hemopexin-like domain. EMBO J. 2002;21:3949–3959. [PMC free article] [PubMed]
  • Osenkowski P., Toth M., Fridman R. Processing, shedding, and endocytosis of membrane type 1-matrix metalloproteinase (MT1-MMP) J. Cell. Physiol. 2004;200:2–10. [PubMed]
  • Overall C. M., Kleifeld O. Tumour microenvironment–opinion: validating matrix metalloproteinases as drug targets and anti-targets for cancer therapy. Nat. Rev. Cancer. 2006;6:227–239. [PubMed]
  • Penas P. F., Garcia-Diez A., Sanchez-Madrid F., Yanez-Mo M. Tetraspanins are localized at motility-related structures and involved in normal human keratinocyte wound healing migration. J. Invest. Dermatol. 2000;114:1126–1135. [PubMed]
  • Rubinstein E., Ziyyat A., Prenant M., Wrobel E., Wolf J. P., Levy S., Le Naour F., Boucheix C. Reduced fertility of female mice lacking CD81. Dev. Biol. 2006;290:351–358. [PubMed]
  • Sakurai-Yageta M., Recchi C., Le Dez G., Sibarita J. B., Daviet L., Camonis J., D'Souza-Schorey C., Chavrier P. The interaction of IQGAP1 with the exocyst complex is required for tumor cell invasion downstream of Cdc42 and RhoA. J. Cell Biol. 2008;181:985–998. [PMC free article] [PubMed]
  • Sato H., Takino T., Okada Y., Cao J., Shinagawa A., Yamamoto E., Seiki M. A matrix metalloproteinase expressed on the surface of invasive tumour cells. Nature. 1994;370:61–65. [PubMed]
  • Serru V., Dessen P., Boucheix C., Rubinstein E. Sequence and expression of seven new tetraspans. Biochim. Biophys. Acta. 2000;1478:159–163. [PubMed]
  • Shigeta M., Sanzen N., Ozawa M., Gu J., Hasegawa H., Sekiguchi K. CD151 regulates epithelial cell-cell adhesion through PKC- and Cdc42-dependent actin cytoskeletal reorganization. J. Cell Biol. 2003;163:165–176. [PMC free article] [PubMed]
  • Shoham T., Rajapaksa R., Kuo C. C., Haimovich J., Levy S. Building of the tetraspanin web: distinct structural domains of CD81 function in different cellular compartments. Mol. Cell. Biol. 2006;26:1373–1385. [PMC free article] [PubMed]
  • Steffen A., Le Dez G., Poincloux R., Recchi C., Nassoy P., Rottner K., Galli T., Chavrier P. MT1-MMP-dependent invasion is regulated by TI-VAMP/VAMP7. Curr. Biol. 2008;18:926–931. [PubMed]
  • Stipp C. S., Kolesnikova T. V., Hemler M. E. EWI-2 regulates alpha3beta1 integrin-dependent cell functions on laminin-5. J. Cell Biol. 2003a;163:1167–1177. [PMC free article] [PubMed]
  • Stipp C. S., Kolesnikova T. V., Hemler M. E. Functional domains in tetraspanin proteins. Trends Biochem. Sci. 2003b;28:106–112. [PubMed]
  • Tachibana I., Bodorova J., Berditchevski F., Zutter M. M., Hemler M. E. NAG-2, a novel transmembrane-4 superfamily (TM4SF) protein that complexes with integrins and other TM4SF proteins. J. Biol. Chem. 1997;272:29181–29189. [PubMed]
  • Takeda T., Hattori N., Tokuhara T., Nishimura Y., Yokoyama M., Miyake M. Adenoviral transduction of MRP-1/CD9 and KAI1/CD82 inhibits lymph node metastasis in orthotopic lung cancer model. Cancer Res. 2007;67:1744–1749. [PubMed]
  • Takeda Y., et al. Tetraspanins CD9 and CD81 function to prevent the fusion of mononuclear phagocytes. J. Cell Biol. 2003;161:945–956. [PMC free article] [PubMed]
  • Takino T., Miyamori H., Kawaguchi N., Uekita T., Seiki M., Sato H. Tetraspanin CD63 promotes targeting and lysosomal proteolysis of membrane-type 1 matrix metalloproteinase. Biochem. Biophys. Res. Commun. 2003;304:160–166. [PubMed]
  • Takino T., Saeki H., Miyamori H., Kudo T., Sato H. Inhibition of membrane-type 1 matrix metalloproteinase at cell-matrix adhesions. Cancer Res. 2007;67:11621–11629. [PubMed]
  • Yan L., Moses M. A., Huang S., Ingber D. E. Adhesion-dependent control of matrix metalloproteinase-2 activation in human capillary endothelial cells. J. Cell Sci. 2000;113:3979–3987. [PubMed]
  • Yanez-Mo M., et al. MT1-MMP collagenolytic activity is regulated through association with tetraspanin CD151 in primary endothelial cells. Blood. 2008;112:3217–3226. [PubMed]
  • Yang X., Claas C., Kraeft S. K., Chen L. B., Wang Z., Kreidberg J. A., Hemler M. E. Palmitoylation of tetraspanin proteins: modulation of CD151 lateral interactions, subcellular distribution, and integrin-dependent cell morphology. Mol. Biol. Cell. 2002;13:767–781. [PMC free article] [PubMed]
  • Yang X. H., Richardson A. L., Torres-Arzayus M. I., Zhou P., Sharma C., Kazarov A. R., Andzelm M. M., Strominger J. L., Brown M., Hemler M. E. CD151 accelerates breast cancer by regulating alpha 6 integrin function, signaling, and molecular organization. Cancer Res. 2008;68:3204–3213. [PubMed]
  • Zhai Y., Hotary K. B., Nan B., Bosch F. X., Munoz N., Weiss S. J., Cho K. R. Expression of membrane type 1 matrix metalloproteinase is associated with cervical carcinoma progression and invasion. Cancer Res. 2005;65:6543–6550. [PubMed]

Articles from Molecular Biology of the Cell are provided here courtesy of American Society for Cell Biology
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...