• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of endoArchiveHomepageTES HomepageSubscriptionsSubmissionAbout
Endocrinology. Apr 2009; 150(4): 1841–1849.
Published online Nov 20, 2008. doi:  10.1210/en.2008-1023
PMCID: PMC2659278

Prolactin Activates Mitogen-Activated Protein Kinase Signaling and Corticotropin Releasing Hormone Transcription in Rat Hypothalamic Neurons

Abstract

Prolactin (PRL) modulates maternal behavior and mediates hypothalamic pituitary adrenal axis inhibition during lactation via PRL receptors in the brain. To identify mechanisms mediating these effects, we examined the effects of PRL on signaling and CRH transcription in hypothalamic neurons in vivo and in vitro. Western blot of hypothalamic proteins from rats receiving intracerebroventricular PRL injection revealed increases in phosphorylation of the MAPK and ERK. Double-staining immunohistochemistry demonstrated phosphorylated ERK localization in parvocellular CRH neurons as well as magnocellular vasopressin and oxytocin neurons of the hypothalamic paraventricular (PVN) and supraoptic nuclei. PRL also induced ERK phosphorylation in vitro in the hypothalamic cell line, 4B, which expresses PRL receptors, and in primary hypothalamic neuronal cultures. Using reporter gene assays in 4B cells, or quantitative RT-PCR for primary transcript in hypothalamic cell cultures, PRL potentiated forskolin-stimulated CRH transcription through activation of the ERK/MAPK pathway. The effect of PRL in hypothalamic cell cultures was unaffected by tetrodotoxin, suggesting a direct effect on CRH neurons. The data show that PRL activates the ERK/MAPK pathway and facilitates CRH transcription in CRH neurons, suggesting that the inhibitory effect of PRL on hypothalamo-pituitary-adrenal axis activity reported in vivo is indirect and probably mediated through modulation of afferent pathways to the PVN. In addition, the prominent stimulatory action of PRL on the ERK/MAPK pathway in the hypothalamic PVN and supraoptic nucleus is likely to mediate neuroplasticity of the neuroendocrine system during lactation.

Prolactin (PRL) acts as neuromodulator influencing various behavioral and neuroendocrine responses, in addition to its recognized effects as the primary pituitary hormone regulating lactation. PRL, synthesized in pituitary lactotrophs and released into the peripheral circulation, can access the brain bypassing the blood-brain barrier through receptors/transporters in the choroid plexus (1,2). Additionally, the presence of PRL mRNA and immunoreactivity in the hypothalamic paraventricular (PVN), supraoptic (SON), arcuate and ventromedial nuclei, the lateral hypothalamic area, and the amygdala (3,4,5,6) suggest that PRL is also synthesized in the brain.

PRL exerts its actions through receptors belonging to the class 1 cytokine receptor family, coupled to the Janus kinase (Jak)-2/signal transducer and activator of transcription (Stat)-5 signaling cascade. Additionally, in a number of peripheral cell lines, PRL has been shown to activate the MAPK pathway. Two major isoforms of PRL receptors, the long and short forms, differing in their signaling properties, have been described, both of which are expressed in the brain (7,8,9). Thus, PRL meets the criteria as a neuropeptide, including neuronal synthesis and release of PRL (10) and the presence of receptors and specific actions for PRL in the brain. For example, central PRL administration stimulates expression of c-Fos in the SON (11,12) and c-Fos, preproenkephalin, and nerve growth factor-inducible B (NGFI-B) in the arcuate nucleus (11,13,14). In this nucleus, PRL may mediate feedback regulation of PRL through activation of the Jak/Stat5 pathway (15,16,17). Brain PRL is also involved in induction of maternal behavior (18,19), grooming (20), reduction of anxiety-related behavior (12,21), and attenuation of stress-induced hypothalamo-pituitary-adrenal (HPA) axis activity in lactating (22) and nonlactating (12,21) rats. Consistently, increases in immunoreactive PRL (10,22,23) and PRL receptor mRNA expression (23) have been described in the hypothalamus during the peripartum period.

The mechanisms by which brain PRL regulates HPA axis activity and anxiety behavior are unclear, but there is evidence that they could involve modulation of CRH expression. In this regard, pregnancy (24), and lactation (25,26) (for review see Refs. 27,28) as well as chronic intracerebroventricular (icv) infusion of PRL (12) are associated with altered CRH mRNA expression in the PVN. Moreover, the presence of PRL receptors in parvocellular PVN neurons suggests that PRL could directly modulate CRH expression (29,30). The objective of the present study was to identify signaling pathways activated by PRL in the hypothalamus. The results showed that icv PRL infusion induces phosphorylation of MAPK kinase (MEK) in hypothalamic protein extracts and as ERK phosphorylation in CRH neurons of the PVN, and oxytocin (OT) and vasopressin (VP) neurons of the PVN and SON. The consequence of this activation on CRH transcription was examined in the hypothalamic neuronal cell line, 4B, and primary cultures of rat hypothalamic neurons.

Materials and Methods

Twelve-week-old virgin female Wistar rats (230–280 g body weight), purchased from Charles River (Sulzfeld, Germany), were kept under standard conditions with respect to food, humidity, and light periodicity. All animal procedures were approved by the Bavarian local government in accordance with the Guide for the Care and Use of Laboratory Animals by the National Institutes of Health (Bethesda, MD). Ovine PRL (oPRL) was obtained from the National Hormone and Peptide Program (National Institute of Child Health and Human Development, National Institutes of Health, Torrance, CA), antisera MEK-1/2, phospho-MEK (pMEK)-1/2, ERK1/2, phospho-ERK1/2 (pERK), rabbit monoclonal antibody, pERK mouse monoclonal antibody E10; Cell Signaling Technologies (New England Biolabs, Frankfurt, Germany], PRL receptor monoclonal antibody (MA1–610, clone U5; Affinity Bioreagents, Golden, CO), OT monoclonal antibody (Chemicon Temecula, CA), VP monoclonal antibody from antibodies online GmbH (Aachen, Germany) and anti-α-tubulin and -β-tubulin antisera from Sigma-Aldrich (Taufkirchen, Germany). The anti-CRH antiserum was a generous gift from Dr. Wylie Vale (Salk Institute, La Jolla, CA). Secondary antibodies were purchased from Amersham Biosciences (donkey-antirabbit, sheep-antimouse; Freiburg, Germany) or Molecular Probes Inc. (goat-antimouse-IgG, Alexa Fluor 488; goat-antirabbit IgG, Alexa 546; Goettingen, Germany). Two different MEK inhibitors were used in the experiments, U0126 (New England Biolabs, Beverly, MA) and SL327 (Calbiochem/EMD Biosciences, San Diego, CA) because U0126 nonspecifically activated the control vector, pGL3 basic, in the luciferase assays (details below).

Intracerebroventricular infusion and hypothalamus protein extraction

For icv infusion, chronic guide cannulas were stereotaxically implanted 2 mm above the lateral brain ventricle under isoflurane anesthesia and closed by a stylet as previously described (31). Rats were housed individually and handled daily to avoid the effects of experimental manipulation on signaling on the day of the experiment. All icv infusions were performed between 0800 and 1100 h in conscious, freely moving rats in diestrous or metestrous (as determined by vaginal smears), using a 25-G infusion system lowered into the guide cannula as previously described (31). Infusions (1 μl PRL, followed by 4 μl isotonic saline, or 5 μl isotonic saline) were performed manually in the course of 2 min. Infusion systems were left in place for 2 additional min to prevent reflux. For Western blot analysis of hypothalamic tissue, rats were randomly allocated to four groups (n = 5 each), which received either vehicle (isotonic saline, group 1) or oPRL (1 μg, groups 2–4). Rats were rapidly killed (within 10 sec from removal from the cage) by decapitation using a guillotine at 5 min (groups 1 and 2), 10 min (group 3), or 30 min (group 4) after the icv infusion.

Brains were immediately removed and the hypothalami dissected and frozen in liquid nitrogen. Cytoplasm proteins were extracted using kit reagents from Panomics (BioCat, Heidelberg, Germany) as previously described (32). Briefly, hypothalami were homogenized on ice in buffer A [10 mm HEPES (pH 7.9), 10 mm KCl, 10 mm EDTA, 0.4% IGEPAL (Panomics, Fremont, CA), 1 mm dithiothreitol, 10 μl/ml protease inhibitor cocktail, 10 μl/ml phosphatase inhibitor cocktail I and II each; Sigma-Aldrich, Steinheim, Germany] and incubated on ice for 15 min. After centrifugation (10 min, 850 g, 4 C), supernatants containing noncellular debris were discarded, the pellets again homogenized in buffer A, vigorously vortexed, incubated for 15 min, and centrifuged at maximum speed (13,000 rpm, 3 min, 4 C). Supernatants were collected as cytosolic protein fractions, and pellets containing the nuclei were resuspended in buffer B [20 mm HEPES (pH 7.9), 400 mm NaCl, 1 mm EDTA, 10% glycerol, 0.4% IGEPAL, 1 mm dithiothreitol, 10 μl/ml protease inhibitor cocktail, containing 10 μl/ml phosphatase inhibitor cocktail I and II] and gently shaken on ice for 2 h. Afterward, samples were centrifuged (13,000 rpm, 5 min, 4 C) and supernatants collected as nuclear protein fractions. Protein concentration was determined using the Bio-Rad protein assay kit with BSA as standard (Bio-Rad, Munich, Germany).

Western blot

Active signaling proteins were measured by Western blot using antibodies recognizing the phosphorylated form and corrected for loading into the gel by the total protein. Twenty or 50 μg of protein extracts from 4B cells or hypothalamus, respectively, were separated on 12% SDS-polyacrylamide gels and transferred onto a nitrocellulose membrane (Bio-Rad). Nonspecific binding was blocked using Tris-buffered saline/0.1% Tween 20 with 5% BSA for 1 h at room temperature. Subsequently the blot was incubated with specific antibodies against pMEK1/2, pERK1/2, MEK1/2, ERK1/2, phosphorylated Stat (pStat)-1, pStat3, Stat1, Stat3 (1:1000 each), PRL receptor (1:2000), or α- or β-tubulin (1:5000) overnight. Blots were washed in Tris-buffered saline/0.1% Tween 20 and incubated with peroxidase-conjugated donkey antirabbit or sheep antimouse IgG (1:1000; Amersham Biosciences), respectively, for 30 min. After a final wash, bands were visualized using chemiluminescence (enhanced chemiluminescence western blotting analysis system and enhanced chemiluminescence Hyperfilm; Amersham Biosciences).

For statistical evaluation, blots were scanned and analyzed using the public domain NIH Image program. Data were normalized using the respective loading controls.

Immunohistochemistry

To determine the cellular localization of pERK1/2 within the hypothalamus, brains were removed 10 min after the icv injection of 1 μg oPRL or vehicle, cut into coronal 4-mm sections using a rat brain matrix, immersed in 4% paraformaldehyde overnight, and processed for paraffin embedding. Immunohistochemistry was performed on coronal paraffin slices (4 μm). Incubation with the primary antibodies (mouse monoclonal pERK1/2 E10, 1:100; CRH rabbit polyclonal antibody, 1:1000 for colocalization of pERK with CRH; rabbit monoclonal pERK1/2, 1:500, in combination with either mouse monoclonal VP 1:500 or -OT, 1:1000 for colocalization of pERK1/2 with VP or OT) was followed by signal enhancement with secondary, fluorescence-coupled antibodies (1:1000; goat-antirabbit IgG Alexa Fluor 546, goat-antimouse IgG Alexa Fluor 488). Three sections per animal (n = 3) were evaluated for percentage of pERK1/2-positive cells in the OT or VP subpopulations of neurons in the PVN and SON.

Cell culture

The hypothalamic cell line 4B (33) was cultured in DMEM supplemented with 10% fetal calf serum, 10% horse serum, and 100 IU penicillin/100 μg streptomycin per milliliter. For analysis of ERK1/2 phosphorylation, cells were stimulated with 1 μg/ml oPRL for 5, 10, 30, or 60 min in the presence of serum or after serum withdrawal for 30 min before the experiment (n = 5 each). Controls were treated with vehicle. After incubation, cells were washed with PBS and harvested in lysis buffer (T-Per tissue protein extraction reagent; Pierce, Rockford, IL) containing 10 μl/ml protease inhibitor cocktail and 10 μl/ml phosphatase inhibitor cocktail I and II each (Sigma-Aldrich, St. Louis, MO). Protein extracts were stored at −80 C.

Transfection and luciferase assay

4B cells were transfected with 0.7 μg DNA (pCRH-Luc or the control vector, pGL3 basic), using Nucleofector solution (Amaxa, Gaithersburg, MD) in RPMI 1640 medium (Life Science Technologies Inc., Gaithersburg, MD) and plated at a density of 6.25 × 104 per well in 48-well plates. All cells were cotransfected with 4 ng of renilla luciferase plasmid to correct for transfection efficiency. After 18 h overnight incubation in normal, serum-containing culture medium, cells were preincubated for 30 min in DMEM supplemented with 0.1% BSA, and then triplicate wells incubated for 6 h with vehicle, the adenylyl cyclase stimulator, forskolin (0.05, 0.1, 0.3, 1, 3, 10 μm), PRL (1 μg/ml), or a combination of the different doses of forskolin and PRL (1 μg/ml) in DMEM with 0.1% BSA. For evaluation of the role of ERK1/2, cells were preincubated with vehicle or the MEK inhibitor SL327 (10 μm; Calbiochem/EMD Biosciences) for 30 min before addition of vehicle, forskolin (0.3 μm), oPRL (1 μg/ml), or a combination of forskolin (0.3 μm) and PRL (1 μg/ml). After incubation, cells were lysed using 100 μl passive lysis buffer (Promega Corp., Madison, WI) for 15 min. twenty microliters of cell extracts were processed for both firefly and renilla luciferase activities (dual luciferase assay system; Promega) using a Fluostar Optima luminometer (BMG Labtech, Offenburg, Germany).

Measurement of CRH primary transcript in primary hypothalamic neuronal cultures

Hypothalami were collected from E17 fetuses and the cells dispersed using collagenase II (1 mg/ml; 149 U/mg) in HEPES dissociation buffer [137 mm NaCl, 5 mm KCl, 0.7 mm Na2HPO4, 25 mm HEPES, 100 mg/ml gentamicin (pH 7.4)] at 37 C. Cells were resuspended in DMEM, 10% fetal bovine serum, and 100 μg/ml gentamicin and incubated for 3 d before transfer to serum-free medium (DMEM, B27 supplement, 100 μg/ml gentamicin) for at least 6 d to eliminate glial cells. On the day of the experiment, cultures were incubated in DMEM/0.1%BSA for 45 min, preincubated with the MEK inhibitor U0126 (10 μm) or vehicle for 30 min or 1 μm tetrodotoxin (Sigma) for 15 min before treatment with vehicle, PRL (1 μg/ml), forskolin (0.3 μm), or the combination of forskolin plus PRL (1 μg/ml) for an additional 45 min. At the end of the incubation, cells were harvested in Trizol (Life Technologies) for preparation of total RNA. RNA was cleaned using RNeasy kit reagents (QIAGEN, Valencia, CA) and subjected to a ribonuclease-free deoxyribonuclease digestion step according to the manufacturer's protocol. RNA concentration and quality of total RNA was determined spectrophotometrically. cDNA was generated from 1–2 μg RNA per sample using SuperScript III first-strand synthesis system for RT-PCR (Invitrogen, Carlsbad, CA), followed by RNase H treatment for 20 min at 37 C.

Quantitative PCR was carried out essentially as previously described (34) using CRH-specific primers [forward: CACAGGCGGCGAATAGCTTAAACCTG(FAM)G, reverse: CAGGTGACCCTTCCTTGGAGA]. PCRs with CRH intronic primers were performed in parallel with glyceraldehyde 3-phosphate dehydrogenase (GAPDH) primers, used as control gene. Predesigned Joe-labeled forward and unlabeled reverse GAPDH primers were obtained from Invitrogen. Relative quantification of CRH hnRNA levels was performed using the comparative threshold cycle method for CRH heteronuclear RNA and GAPDH, as described in the user's manual (35). The absence of RNA detection when the reverse transcription step was omitted indicated the lack of genomic DNA contamination in the RNA samples.

Statistics

Statistical significance of the differences between groups was calculated by one- or two-way ANOVA, followed by Student-Newman-Keuls test. P < 0.05 was considered statistically significant. Data are presented as means ± sem.

Results

PRL-induced activation of the MAPK cascade in rat hypothalamus

The ability of centrally administered PRL to activate signaling pathways in the hypothalamus was investigated in virgin female rats using Western blot with phospho-specific antibodies. Intracerebroventricular PRL (1 μg per 5 μl) resulted in rapid activation of the ERK MAPK pathway in the hypothalamus. As depicted in Fig. 1A1A,, icv injection of PRL caused a rapid increase in MEK1/2 phosphorylation by 5 min (P < 0.05), which started to decline by 10 min and returned to basal by 30 min after PRL. MEK1/2 phosphorylation was followed by an increase in phosphorylation of ERK1/2, which was maximal at 10 min (P < 0.01) and declined by 30 min (Fig. 1B1B).). This was followed by pERK1/2 translocation into the nuclear fractions (Fig. 1C1C)) with a 1.3-fold increase by 30 min. Intracerebroventricular PRL injection had no effect on total MEK1/2 and ERK1/2 protein. Western blot analysis using a phospho-specific anti-Raf-1 antibody on hypothalamic proteins revealed no changes in phosphorylation at any time point studied (data not shown). The sites at which icv PRL induces ERK phosphorylation in the hypothalamus were examined by immunohistrochemistry using a pERK-specific antibody. Microscopical examination of hypothalamic sections from vehicle-injected control rats revealed little pERK staining distinguishable from negative control staining without primary antibody. However, 10 min after icv PRL, injection-specific pERK staining was prominent in the PVN and SON (Fig. 1D1D).

Figure 1
Activation of the ERK1/2 MAPK pathway by PRL in the rat hypothalamus. PRL (1 μg) or vehicle (Veh; n = 5 animals/group) were injected into the lateral brain ventricle of conscious virgin female rats. Five, 10, or 30 min later, the hypothalami were ...

Consistent with the recognized coupling of PRL receptors to the Jak/Stat pathway, Western blot analysis of pStat1 showed a 150% increase in a 91-kDa band recognized by a phospho-specific Stat1 antibody after 10 min (P < 0.05), and pStat3 was stimulated by 2-fold 30 min after icv infusion of PRL (1 μg per 5 μl; P < 0.05). Both pStat1 and pStat3 were translocated into the nucleus (data not shown).

Immunohistochemical localization of pERK in specific hypothalamic nuclei

To determine specific neuronal cell types in which PRL activates the MAPK pathway in the PVN and SON, we performed double-staining immunohistochemical studies in vehicle- and PRL-infused rats. As shown in Fig. 1D1D,, in vehicle-infused controls, pERK staining was almost undetectable, but it became prominent in the PVN and SON after icv PRL infusion. In the PVN, a major proportion of pERK immunostaining was found in the dorsomedial region known to contain CRH neurons (Fig. 1D1D).). Double-staining immunohistochemistry revealed that 70% of CRH-stained neurons also displayed pERK immunoreactivity (Fig. 22,, A–C and Table 11).). Additionally, a subpopulation of the VP-positive cells in the dorsal-lateral region of the PVN costained with pERK1/2 (Fig. 33,, A and B, and Table 11).). There was also colocalization of pERK in OT-stained cells in the PVN (Fig. 33,, C and D, and Table 11).

Figure 2
Colocalization of CRH and pERK in the hypothalamic PVN. Conscious virgin female rats (three per group) received a PRL injection (1 μg, icv) and were killed 10 min later. For visualization of colocalization of pERK with CRH, incubation with two ...
Figure 3
Colocalization of PRL-induced pERK1/2 with VP and OT in the hypothalamic PVN. Conscious rats were treated with PRL (1 μg, icv) for 10 min (n = 3 animals/group). For colocalization with VP and OT, pERK was visualized on 4-μm brain slices ...
Table 1
Percent CRH, OT, or VP neurons showing colocalization with pERK

As in the PVN, icv PRL induced pERK staining in the SON, and a large proportion of this staining colocalized in neurons also staining for OT and VP (Fig. 44,, A, C, D, and F and Table 11).

Figure 4
Colocalization of PRL-induced pERK1/2 with VP (upper panel) and OT (lower panel) in the hypothalamic SON. Conscious rats were treated with PRL (1 μg, icv) for 10 min (n = 3 animals/group). For colocalization with VP and OT, pERK was visualized ...

PRL-induced ERK1/2 phosphorylation in the hypothalamic cell line 4B

Western blot analysis of total protein extracts from untreated 4B cells, using a specific monoclonal antibody against the PRL receptor, revealed a 40-kDa band corresponding in molecular mass to the short isoform of the PRL receptor, indicating that 4B cells express endogenous PRL receptors (Fig. 5A5A).). Although additional nonspecific bands appeared in cells at passage 21, the specific 40-kDa band was always present, and in no case a band with the molecular size of the long form of the receptor was observed. In the absence of serum (DMEM with 0.1% BSA for 30 min before and during incubation), PRL (1 μg/ml) induced a rapid 3.5-fold increase in ERK1/2 phosphorylation, which reached maximum by 10 min (P < 0.01) and declined to levels not significantly different from basal after 60 min (Fig. 5B5B).). In the presence of serum, basal levels of pERK1/2 were higher (9-fold the values in serum-free medium) and increased further with PRL in an additive or slightly potentiating manner compared with the effect of serum alone (Fig. 5B5B).). In contrast to the transient increase in serum-free medium, in the presence of 20% serum, PRL caused a sustained response with clear potentiation at 60 min.

Figure 5
Effects of PRL on ERK1/2 phosphorylation and CRH transcription in hypothalamic cells. A, Western blot for the PRL receptor in protein extracts from the hypothalamic cell line 4B on passages 21 and 8. A specific 40-kDa band corresponding to the molecular ...

PRL enhances activation of CRH transcription in a MAPK-dependent manner

Because the colocalization of PRL-induced pERK in CRH neurons of the PVN suggests that PRL directly modulates CRH expression, we examined the effects of PRL on CRH transcription in the hypothalamic cell line, 4B, transiently transfected with a CRH promoter-driven luciferase reporter gene and in primary cultures of rat hypothalamic neurons. In 4B cells transfected with the reporter gene, the adenylate cyclase stimulator, forskolin (0.05 to 10 μm), induced the expected dose-dependent increase in CRH promoter activity (Fig. 5C5C).). Incubation of the cells with PRL alone (1 μg/ml) had no significant effect on luciferase activity, but it significantly potentiated the stimulatory effect of forskolin (Fig. 5C5C).). The potentiating effect of PRL on forskolin-induced CRH promoter activation was mediated via activation of the ERK1/2 MAPK cascade because pretreatment with the MEK inhibitor SL327 (10 μm) abolished the potentiation of the forskolin (0.3 μm)-induced CRH promoter activation by PRL (Fig. 5D5D).). The MEK inhibitor alone did not have any effect on basal forskolin-stimulated CRH promoter activity or on the promoterless vector, pGL3 basic.

To examine the effect of PRL on endogenous CRH transcription, we measured changes in CRH primary transcript (CRH hnRNA) in primary cultures of hypothalamic neurons using intronic quantitative RT-PCR. Incubation of primary hypothalamic neuronal cultures with a submaximal stimulatory concentration of forskolin (0.3 μm) increased CRH hnRNA levels by about 2-fold by 45 min (P < 0.05; Fig. 5E5E).). PRL alone tended to increase CRH hnRNA levels, but the changes did not reach statistical significance. However, PRL markedly potentiated the stimulatory effect of forskolin increasing CRH hnRNA levels by more than 4-fold of the basal values (Fig. 5E5E).). As with the reporter gene assay, the potentiating effect of PRL on forskolin-stimulated CRH hnRNA was mediated by activation of MAPK because it was prevented by the MEK inhibitor, U0126. Importantly, the MEK inhibitor had no effect on basal or forskolin-stimulated CRH hnRNA levels.

To determine whether the stimulation of CRH hnRNA production by PRL is directly in the CRH neuron or mediated by neuronal transmission, we examined the effects of PRL on CRH hnRNA levels in the presence and absence of the sodium channel blocker, tetrodotoxin. Consistent with the experiments above, incubation of primary hypothalamic neuronal cultures with a 0.3 μm forskolin increased CRH hnRNA levels by 2.4-fold by 45 min (P < 0.01). PRL alone tended to increase CRH hnRNA levels, but the changes did not reach statistical significance. PRL potentiated the stimulatory effect of forskolin increasing CRH hnRNA to levels 40% higher than those with forskolin alone (P < 0.05, Fig. 5F5F).). Tetrodotoxin added to the cells 15 min before the stimulants completely failed to modify the effect of PRL in the presence or absence of forskolin (Fig. 5F5F).

Discussion

This study shows that in addition to activating the Jak/Stat pathway, PRL activates the ERK1/2 MAPK cascade in discrete hypothalamic regions, including CRH neurons of the PVN as well as magnocellular VP and OT neurons of the SON and PVN. The in vitro studies confirmed that concentrations of PRL in the physiological range (36,37) induce phosphorylation of ERK1/2 in neurons and CRH transcription. Because PRL receptors are present in neurons of the PVN and SON (7,38,39,40), it is likely that PRL exerts these neuronal actions directly within these nuclei.

PRL receptors belong to the cytokine receptor family, which were mainly shown to be coupled to the Jak/Stat pathway. However, in a number of cell lines, PRL also induces ERK1/2 phosphorylation (41,42,43,44,45,46). These distinct signaling modalities of PRL could depend on the receptor subtype being activated. Although the long PRL receptor exhibits full signaling properties (47,48,49), it has been reported that the distant C-terminal part of this isoform has inhibitory properties on MAPK activation via tyrosine and serine-threonine phosphatases (50). On the other hand, the short PRL receptor is unable to couple to Jak/Stat signaling and activates only the ERK 1/2 MAPK cascade due to a truncated C terminus and lack of distal phosphorylation sites. In 4B cells, which express only the short form of the receptor, it is clear that this form mediates the activation of MAPK and stimulation of CRH promoter activity. The inability of PRL to activate the Jak/Stat pathway in 4B cells is also consistent with the absence of the long form of the receptor in these cells. The PRL receptor subtype mediating the effects in the hypothalamus is less clear. PRL receptor mRNA, protein and binding sites for 125I-labeled PRL have been localized in the PVN and SON (7,29,30,38,39,51,52). In situ hybridization studies described expression of mRNA for the long PRL receptor predominantly in OT, but only in a few VP neurons (40). The same report also identifies the long PRL receptor in the dorsomedial PVN (53), the same region shown to coexpress pERK in 70% of CRH neurons after icv PRL infusion in the present study. Thus, it is possible that the effects of PRL in the CRH neurons are mediated by the long form of the receptor. However, the cellular distribution of the short PRL receptor has not been studied in detail, and the participation of this isoform cannot be ruled out.

On the other hand, the confinement of the long receptor isoform to a few VP neurons suggests that the short form of the receptor mediates the marked induction of pERK by PRL in VP neurons of the SON. The occurrence of both the long and short isoforms in the hypothalamus is in keeping with our observation that icv PRL administration activates both the Jak/Stat pathway and the MAPK cascade in this region. Concerning the Jak/Stat pathway it has been shown that icv PRL induces Stat5 activation associated with the regulation of tuberoinfundibular dopamine neuron activity (15,54). The present experiments extend this observation by showing that icv PRL also activates Stat1 and Stat3 in the hypothalamus.

It should be noted that PRL alone is a weak stimulator of ERK phosphorylation in 4B cells, but the effect was markedly potentiated in the presence of serum. This suggests that the effects observed in vivo depend on the interaction of PRL and other neurotransmitters or trophic factors accessible to neurons. The mechanisms by which PRL receptor occupancy mediates activation of the ERK1/2 MAPK are unlikely to involve the Jak/Stat pathway because the Jak1/2 inhibitor pyridone 6 failed to suppress PRL-induced ERK phosphorylation in hypothalamic cell cultures (Liu, Y., A. Blume, and G. Aguilera, unpublished observations). It has been reported that PRL can activate protein kinase C (PKC) in primary neuronal cultures (55,56), and PKC can induce transactivation of the MAPK pathway. Moreover, in mediobasal hypothalamic neurons in culture containing tuberoinfundibular dopamine neurons, PRL can induce ERK1/2 phosphorylation in a PKC-dependent manner (17). The involvement of these pathways in ERK phosphorylation by PRL in magnocellular OT and VP neurons, and CRH neurons of the PVN, is under current investigation.

The ability of icv of PRL to phosphorylate ERK in most CRH neurons is in keeping with a role of PRL modulating HPA axis activity and CRH-modulated behavior. Because in vivo experiments involving chronic icv infusion of PRL or PRL receptor antisense oligonucleotides strongly suggest that icv PRL acts as an inhibitor of HPA axis responses to stressful stimuli (12,22), it was unexpected to find that PRL increased rather than inhibited forskolin-stimulated CRH transcription. There are several potential explanations for this apparent discrepancy. First, our in vitro experiments in 4B cells and primary hypothalamic neurons in the presence of tetrodotoxin demonstrate a direct stimulatory effect of PRL on CRH transcription, whereas the inhibition observed in vivo could reflect modulation of afferent pathways to the CRH neuron. In support of this, chronic icv PRL attenuated neuronal responsiveness in limbic brain regions including the central amygdala, hippocampus, and thalamic subregions (12), areas implicated in the control of the HPA axis and emotional stress responsiveness (57,58,59). Second, the effects of short-time exposure of the cell culture to PRL (45 min for CRH hnRNA and 6 h for luciferase activity) may differ from the effects of chronic increases in icv PRL during lactation or chronic minipump administration of the peptide (10,12,23,60). Thus, it is possible that PRL has a biphasic effect on CRH expression, with an acute stimulatory and a chronic inhibitory effect. Supporting this possibility is the report that icv injection of PRL rapidly increases CRH mRNA in the PVN only 30 min later (61). Similar to the effects of PRL on ERK phosphorylation, PRL alone had a minor stimulatory effect on CRH transcription in vitro, but it profoundly potentiated the effect of low doses of the adenylyl cyclase stimulator, forskolin. The ability of MEK inhibitors to completely block the stimulatory effect of PRL on CRH transcription in both cell types, primary neuronal cultures and the cell line 4B, indicates that the effect is indeed mediated by activation of the MAPK cascade.

The stimulatory effect of acute PRL on CRH expression could play a role in the regulation of the HPA axis during lactation, a physiological condition associated with hyperprolactinemia and elevated HPA axis activity under basal conditions (28). For example, studies in lactating rats have shown increased basal CRH mRNA (25) and plasma corticosterone (28) levels, the latter being important for the metabolic demands of lactation. Therefore, it is possible that high PRL levels during lactation contribute to the high basal activity of the HPA axis. In support, acute icv PRL elevates plasma ACTH and corticosterone concentrations in virgin female rats (Torner, L., and I. D. Neumann, unpublished data). In contrast to the elevated basal activity of the HPA axis in lactation, responsiveness to stress is attenuated at this time. Chronic elevations in prolactinergic activity in the brain are involved in the inhibition of HPA axis responses in lactation (22). For example, chronic PRL infusion attenuates HPA axis responses in virgin female rats. Moreover, other indirect inhibitory actions of PRL may mediate the blunted responses to various stressors (27,28,62,63). In addition, the present demonstration that icv PRL activates the MAPK pathway in magnocellular OT neurons that PRL also regulates oxytocinergic neuronal activity confirms our recent finding in chronically PRL-treated virgin rats, which is highly relevant (74) during lactation.

In peripheral tissues or cells, PRL-induced activation of ERK1/2 has been linked to proliferation (64,65,66). Similarly, in the brain, PRL promotes olfactory neurogenesis (67) and white matter remyelination (68). Moreover, PRL prevents chronic stress-induced reduction in hippocampal neurogenesis (73). Ongoing in vitro and in vivo studies in our laboratories show that PRL induces the expression of Egr-1 in the hypothalamic PVN and SON, in a MAPK-dependent manner (Blume, A., G. Aguilera, and I. D. Neumann, unpublished data). This transcription factor is linked to neuronal plasticity (69), and its induction by PRL could contribute to the high level of hypothalamic neuroplasticity, in particular of the OT system, found in lactation (70,71). In conjunction with the high expression of PRL receptors in these neurons during pregnancy and lactation (40), the present observations suggest a role for PRL in the physiological regulation of the OT neuron. In the present study, icv PRL also induced ERK phosphorylation in VP neurons of the PVN and SON. It has been shown that PRL induces VP release into the circulation (72), an effect that is likely to contribute to the mechanisms for antidiuresis required for fluid conservation and regulation of water homeostasis during lactation. Moreover, PRL-induced activation of VP neurons may contribute to the role of VP in maternal behavior (75).

Overall, our data demonstrate that PRL activates the ERK/MAPK pathway in the hypothalamus, specifically in CRH neurons of the dorsomedial PVN and in OT and VP neurons of the PVN and SON. In conjunction with previous reports, the demonstration that PRL-induced ERK1/2 activation stimulates CRH transcription, suggests that PRL has dual actions on HPA axis activity, with a direct stimulatory effect in the CRH neuron and indirect inhibitory actions probably mediated by modulation of neural pathways to the PVN. In addition, the ability of PRL to activate the ERK/MAPK pathway in the hypothalamic PVN and SON suggests a role for PRL modulating magnocellular neuron function and mediating neuroplasticity of the neuroendocrine system during lactation.

Acknowledgments

The authors thank Luxiola Gonzalez (University of Regensburg) for expert technical assistance and Dr. W. Vale (Salk Institute, La Jolla, CA) for providing the CRH antibody.

Footnotes

This work was partially supported by the Intramural Research Program of the National Institutes of Health/National Institute of Child Health and Human Development (to G.A.), the Bayrische Forschungsstiftung (to A.B. and I.D.N.), the Deutsche Forschungsgemeinschaft (to I.D.N.), and the German Ministry for Education and Research (to I.D.N.).

Disclosure Summary: The authors have nothing to disclose.

First Published Online November 20, 2008

Abbreviations: GAPDH, Glyceraldehyde 3-phosphate dehydrogenase; HPA, hypothalamo-pituitary-adrenal; icv, intracerebroventricular; Jak, Janus kinase; MEK, MAPK kinase; oPRL, ovine PRL; OT, oxytocin; pERK, phospho-ERK; PKC, protein kinase C; pMEK, phospho-MEK; PRL, prolactin; pStat, phosphorylated Stat; PVN, paraventricular nucleus; SON, supraoptic nucleus; Stat, signal transducer and activator of transcription; VP, vasopressin.

References

  • Mangurian LP, Walsh RJ, Posner BI 1992 Prolactin enhancement of its own uptake at the choroid plexus. Endocrinology 131:698–702 [PubMed]
  • Walsh R, Slaby F, Posner B 1987 A receptor-mediated mechanism for the transport of prolactin from blood to cerebrospinal fluid. Endocrinology 120:1846–1850 [PubMed]
  • Ben-Jonathan N, Mershon JL, Allen DL, Steinmetz RW 1996 Extrapituitary prolactin: distribution, regulation, functions, and clinical aspects. Endocr Rev 17:639–669 [PubMed]
  • Clapp C, Torner L, Gutierrez-Ospina G, Alcantara E, Lopez-Gomez F, Nagano M, Kellly P, Mejia S, Ma M, Martinez de la Escalera G 1994 The prolactin gene is expressed in the hypothalamic-neurohypophyseal system and the protein is processed into a 14-kDa fragment with activity like 16-kDa prolactin. Proc Natl Acad Sci USA 91:10384–10388 [PMC free article] [PubMed]
  • Emanuele N, Jurgens J, Halloran M, Tentler J, Lawrence A, Kelley M 1992 The rat prolactin gene is expressed in brain tissue: detection of normal and alternatively spliced prolactin messenger RNA. Mol Endocrinol 6:35–42 [PubMed]
  • Toubeau G, Desclin J, Parmentier M, Pasteels J 1979 Cellular localization of a prolactin-like antigen in the rat brain. J Endocrinol 83:261–266 [PubMed]
  • Chiu S, Wise P 1994 Prolactin receptor mRNA localization in the hypothalamus by in situ hybridization. J Neuroendocrinol 6:191–199 [PubMed]
  • Nagano M, Kelly P 1994 Tissue distribution and regulation of rat prolactin receptor gene expression: quantitative analysis by polymerase chain reaction. J Biol Chem 269:13337–13345 [PubMed]
  • Ouhtit A, Morel G, Kelly P 1994 Visualization of gene expression of short and long forms of prolactin receptor in the rat. Endocrinology 133:135–144 [PubMed]
  • Torner L, Maloumby R, Nava G, Aranda J, Clapp C, Neumann ID 2004 In vivo release and gene upregulation of brain prolactin in response to physiological stimuli. Eur J Neurosci 19:1601–1608 [PubMed]
  • Cave B, Wakerley J, Luckman S, Tortonese D 2001 Hypothalamic targets for prolactin: assessment of c-Fos induction in tyrosine hydroxylase- and propiomelanocortin-containing neurones in the rat arcuate nucleus following acute central prolactin administration. Neuroendocrinology 74:386–395 [PubMed]
  • Donner N, Bredewold R, Maloumby R, Neumann ID 2007 Chronic intracerebral prolactin attenuates neuronal stress circuitries in virgin rats. Eur J Neurosci 25:1804–1814 [PubMed]
  • Nahi F, Arbogast LA 2003 Prolactin modulates hypothalamic preproenkephalin, but not proopiomelanocortin, gene expression during lactation. Endocrine 20:115–122 [PubMed]
  • Sagrillo CA, Selmanoff M 1998 Effects of prolactin on expression of the mRNAs encoding the immediate early genes zif/268 (NGF1-A), nur/77 (NGF1-B), c-fos and c-jun in the hypothalamus. Brain Res Mol Brain Res 61:62–68 [PubMed]
  • Grattan DR, Xu J, McLachlan MJ, Kokay IC, Bunn SJ, Hovey RC, Davey HW 2001 Feedback regulation of PRL secretion is mediated by the transcription factor, signal transducer, and activator of transcription 5b. Endocrinology 142:3935–3940 [PubMed]
  • Lerant A, Kanyicska B, Freeman ME 2001 Nuclear translocation of STAT5 and increased expression of Fos related antigens (FRAs) in hypothalamic dopaminergic neurons after prolactin administration. Brain Res 904:259–269 [PubMed]
  • Ma FY, Grattan DR, Goffin V, Bunn SJ 2005 Prolactin-regulated tyrosine hydroxylase activity and messenger ribonucleic acid expression in mediobasal hypothalamic cultures: the differential role of specific protein kinases. Endocrinology 146:93–102 [PubMed]
  • Bridges RS, Numan M, Ronsheim PM, Mann PE, Lupini CE 1990 Central prolactin infusions stimulate maternal behavior in steroid-treated, nulliparous female rats. Proc Natl Acad Sci USA 87:8003–8007 [PMC free article] [PubMed]
  • Lucas BK, Ormandy CJ, Binart N, Bridges RS, Kelly PA 1998 Null mutation of the prolactin receptor gene produces a defect in maternal behavior. Endocrinology 139:4102–4107 [PubMed]
  • Drago F, Bohus B, Gispen WH, Scapagnini U, De Wied D 1983 Prolactin-enhanced grooming behavior: interaction with ACTH. Brain Res 263:277–282 [PubMed]
  • Torner L, Toschi N, Pohlinger A, Landgraf R, Neumann ID 2001 Anxiolytic and anti-stress effects of brain prolactin: improved efficacy of antisense targeting of the prolactin receptor by molecular modeling. J Neurosci 21:3207–3214 [PubMed]
  • Torner L, Toschi N, Nava G, Clapp C, Neumann ID 2002 Increased hypothalamic expression of prolactin in lactation: involvement in behavioural and neuroendocrine stress responses. Eur J Neurosci 15:1381–1389 [PubMed]
  • Pi XJ, Grattan DR 1999 Increased prolactin receptor immunoreactivity in the hypothalamus of lactating rats. J Neuroendocrinol 11:693–705 [PubMed]
  • Johnstone HA, Wigger A, Douglas AJ, Neumann ID, Landgraf R, Seckl JR, Russell JA 2000 Attenuation of hypothalamic-pituitary-adrenal axis stress responses in late pregnancy: changes in feedforward and feedback mechanisms. J Neuroendocrinol 12:811–822 [PubMed]
  • da Costa AP, Ma X, Ingram CD, Lightman SL, Aguilera G 2001 Hypothalamic and amygdaloid corticotropin-releasing hormone (CRH) and CRH receptor-1 mRNA expression in the stress-hyporesponsive late pregnant and early lactating rat. Brain Res Mol Brain Res 91:119–130 [PubMed]
  • Lightman SL, Young 3rd WS 1989 Lactation inhibits stress-mediated secretion of corticosterone and oxytocin and hypothalamic accumulation of corticotropin-releasing factor and enkephalin messenger ribonucleic acids. Endocrinology 124:2358–2364 [PubMed]
  • Walker CD, Toufexis DJ, Burlet A 2001 Hypothalamic and limbic expression of CRF and vasopressin during lactation: implications for the control of ACTH secretion and stress hyporesponsiveness. Prog Brain Res 133:99–110 [PubMed]
  • Lightman SL, Windle RJ, Wood SA, Kershaw YM, Shanks N, Ingram CD 2001 Peripartum plasticity within the hypothalamo-pituitary-adrenal axis. Prog Brain Res 133:111–129 [PubMed]
  • Bakowska JC, Morrell JI 1997 Atlas of the neurons that express mRNA for the long form of the prolactin receptor in the forebrain of the female rat. J Comp Neurol 386:161–177 [PubMed]
  • Bakowska JC, Morrell JI 2003 The distribution of mRNA for the short form of the prolactin receptor in the forebrain of the female rat. Brain Res Mol Brain Res 116:50–58 [PubMed]
  • Neumann ID, Torner L, Wigger A 2000 Brain oxytocin: differential inhibition of neuroendocrine stress responses and anxiety-related behaviour in virgin, pregnant and lactating rats. Neuroscience 95:567–575 [PubMed]
  • Blume A, Bosch OJ, Miklos S, Torner L, Wales L, Waldherr M, Neumann ID 2008 Oxytocin reduces anxiety via ERK1/2 activation: local effect within the rat hypothalamic paraventricular nucleus. Eur J Neurosci 27:1947–1956 [PubMed]
  • Kasckow J, Mulchahey JJ, Aguilera G, Pisarska M, Nikodemova M, Chen HC, Herman JP, Murphy EK, Liu Y, Rizvi TA, Dautzenberg FM, Sheriff S 2003 Corticotropin-releasing hormone (CRH) expression and protein kinase A mediated CRH receptor signalling in an immortalized hypothalamic cell line. J Neuroendocrinol 15:521–529 [PubMed]
  • Liu Y, Kamitakahara A, Kim AJ, Aguilera G 2008 Cyclic adenosine 3′,5′-monophosphate responsive element binding protein phosphorylation is required but not sufficient for activation of corticotropin-releasing hormone transcription. Endocrinology 149:3512–3520 [PMC free article] [PubMed]
  • Livak KJ, Schmittgen TD 2001 Analysis of relative gene expression data using real-time quantitative PCR and the 2[-ΔΔC(T)] method. Methods 25:402–408 [PubMed]
  • Hirasawa M, Mouginot D, Kozoriz MG, Kombian SB, Pittman QJ 2003 Vasopressin differentially modulates non-NMDA receptors in vasopressin and oxytocin neurons in the supraoptic nucleus. J Neurosci 23:4270–4277 [PubMed]
  • Oliver C, Mical RS, Porter JC 1977 Hypothalamic-pituitary vasculature: evidence for retrograde blood flow in the pituitary stalk. Endocrinology 101:598–604 [PubMed]
  • Crumeyrolle-Arias M, Latouche J, Jammes H, Djiane J, Kelly PA, Reymond MJ, Haour F 1993 Prolactin receptors in the rat hypothalamus: autoradiographic localization and characterization. Neuroendocrinology 57:457–466 [PubMed]
  • Roky R, Paut-Pagano L, Goffin V, Kitahama K, Valatx JL, Kelly PA, Jouvet M 1996 Distribution of prolactin receptors in the rat forebrain. Immunohistochemical study. Neuroendocrinology 63:422–429 [PubMed]
  • Kokay IC, Bull PM, Davis RL, Ludwig M, Grattan DR 2006 Expression of the long form of the prolactin receptor in magnocellular oxytocin neurons is associated with specific prolactin regulation of oxytocin neurons. Am J Physiol Regul Integr Comp Physiol 290:R1216–R1225 [PubMed]
  • Das R, Vonderhaar BK 1995 Transduction of prolactin's (PRL) growth signal through both long and short forms of the PRL receptor. Mol Endocrinol 9:1750–1759 [PubMed]
  • Buckley AR, Rao YP, Buckley DJ, Gout PW 1994 Prolactin-induced phosphorylation and nuclear translocation of MAP kinase in Nb2 lymphoma cells. Biochem Biophys Res Commun 204:1158–1164 [PubMed]
  • Camarillo IG, Linebaugh BE, Rillema JA 1997 Differential tyrosyl-phosphorylation of multiple mitogen-activated protein kinase isoforms in response to prolactin in Nb2 lymphoma cells. Proc Soc Exp Biol Med 215:198–202 [PubMed]
  • Carey GB, Liberti JP 1995 Stimulation of receptor-associated kinase, tyrosine kinase, and MAP kinase is required for prolactin-mediated macromolecular biosynthesis and mitogenesis in Nb2 lymphoma. Arch Biochem Biophys 316:179–189 [PubMed]
  • Gubbay O, Critchley HO, Bowen JM, King A, Jabbour HN 2002 Prolactin induces ERK phosphorylation in epithelial and CD56(+) natural killer cells of the human endometrium. J Clin Endocrinol Metab 87:2329–2335 [PubMed]
  • Das R, Vonderhaar BK 1996 Activation of raf-1, MEK, and MAP kinase in prolactin responsive mammary cells. Breast Cancer Res Treat 40:141–149 [PubMed]
  • Boyle-Feysot C, Goffin V, Edery M, Binart N, Kelly P 1998 Prolactin (PRL) and its receptor: actions, signal transduction pathways and phenotypes observed in knockout mice. Endocr Rev 19:225–268 [PubMed]
  • Lesueur L, Edery M, Ali S, Paly J, Kelly PA, Djiane J 1991 Comparison of long and short forms of the prolactin receptor on prolactin-induced milk protein gene transcription. Proc Natl Acad Sci USA 88:824–828 [PMC free article] [PubMed]
  • Wakao H, Gouilleux F, Groner B 1994 Mammary gland factor (MGF) is a novel member of the cytokine regulated transcription factor gene family and confers the prolactin response. EMBO J 13:2182–2191 [PMC free article] [PubMed]
  • Goupille O, Barnier JV, Guibert B, Paly J, Djiane J 2000 Effect of PRL on MAPK activation: negative regulatory role of the C-terminal part of the PRL receptor. Mol Cell Endocrinol 159:133–146 [PubMed]
  • Pi XJ, Grattan DR 1998 Differential expression of the two forms of prolactin receptor mRNA within microdissected hypothalamic nuclei of the rat. Brain Res Mol Brain Res 59:1–12 [PubMed]
  • Pi XJ, Grattan DR 1998 Distribution of prolactin receptor immunoreactivity in the brain of estrogen-treated, ovariectomized rats. J Comp Neurol 394:462–474 [PubMed]
  • Rho JH, Swanson LW 1989 A morphometric analysis of functionally defined subpopulations of neurons in the paraventricular nucleus of the rat with observations on the effects of colchicine. J Neurosci 9:1375–1388 [PubMed]
  • Anderson ST, Barclay JL, Fanning KJ, Kusters DH, Waters MJ, Curlewis JD 2006 Mechanisms underlying the diminished sensitivity to prolactin negative feedback during lactation: reduced STAT5 signaling and up-regulation of cytokine-inducible SH2 domain-containing protein (CIS) expression in tuberoinfundibular dopaminergic neurons. Endocrinology 147:1195–1202 [PubMed]
  • DeVito WJ, Stone S, Avakian C 1991 Prolactin stimulation of protein kinase C activity in the rat hypothalamus. Biochem Biophys Res Commun 176:660–667 [PubMed]
  • Pasqualini C, Guibert B, Frain O, Leviel V 1994 Evidence for protein kinase C involvement in the short-term activation by prolactin of tyrosine hydroxylase in tuberoinfundibular dopaminergic neurons. J Neurochem 62:967–977 [PubMed]
  • LeDoux JE 1994 Emotion, memory and the brain. Sci Am 270:50–57 [PubMed]
  • Herman JP, Cullinan WE 1997 Neurocircuitry of stress: central control of the hypothalamo-pituitary-adrenocortical axis. Trends Neurosci 20:78–84 [PubMed]
  • Davis M, Whalen PJ 2001 The amygdala: vigilance and emotion. Mol Psychiatry 6:13–34 [PubMed]
  • Pi XJ, Grattan DR 1999 Increased expression of both short and long forms of prolactin receptor mRNA in hypothalamic nuclei of lactating rats. J Mol Endocrinol 23:13–22 [PubMed]
  • Fujikawa T, Soya H, Tamashiro KL, Sakai RR, McEwen BS, Nakai N, Ogata M, Suzuki I, Nakashima K 2004 Prolactin prevents acute stress-induced hypocalcemia and ulcerogenesis by acting in the brain of rat. Endocrinology 145:2006–2013 [PubMed]
  • Stern JM, Goldman L, Levine S 1973 Pituitary-adrenal responsiveness during lactation in rats. Neuroendocrinology 12:179–191 [PubMed]
  • Slattery DA, Neumann ID 2008 No stress please! Mechanisms of stress hyporesponsiveness of the maternal brain. J Physiol 586:377–385 [PMC free article] [PubMed]
  • Clevenger C, Torigoe T, Reed J 1994 Prolactin induces rapid phosphorylation and activation of prolactin receptor-associated RAF-1 kinase in a T-cell line. J Biol Chem 269:5559–5565 [PubMed]
  • Erwin R, Kirken R, Malabarba M, Farrar W, Rui H 1995 Prolactin activates Ras via signaling proteins SHC, growth factor receptor bound 2, and son of sevenless. Endocrinology 136:3512–3518 [PubMed]
  • Rao Y-P, Buckley D, Buckley A 1995 Rapid activation of mitogen-activated protein kinase and p21ras by prolactin and interleukin-2 in rat Nb2 node lymphoma cells. Cell Growth Differ 6:1235–1244 [PubMed]
  • Shingo T, Gregg C, Enwere E, Fujikawa H, Hassam R, Geary C, Cross JC, Weiss S 2003 Pregnancy-stimulated neurogenesis in the adult female forebrain mediated by prolactin. Science 299:117–120 [PubMed]
  • Gregg C, Shikar V, Larsen P, Mak G, Chojnacki A, Yong VW, Weiss S 2007 White matter plasticity and enhanced remyelination in the maternal CNS. J Neurosci 27:1812–1823 [PubMed]
  • James AB, Conway AM, Morris BJ 2006 Regulation of the neuronal proteasome by Zif268 (Egr1). J Neurosci 26:1624–1634 [PubMed]
  • Chevaleyre V, Moos FC, Desarmenien MG 2002 Interplay between presynaptic and postsynaptic activities is required for dendritic plasticity and synaptogenesis in the supraoptic nucleus. J Neurosci 22:265–273 [PubMed]
  • Langle SL, Poulain DA, Theodosis DT 2002 Neuronal-glial remodeling: a structural basis for neuronal-glial interactions in the adult hypothalamus. J Physiol Paris 96:169–175 [PubMed]
  • Mejia S, Torner LM, Jeziorski MC, Gonzalez C, Morales MA, de la Escalera GM, Clapp C 2003 Prolactin and 16K prolactin stimulate release of vasopressin by a direct effect on hypothalamo-neurohypophyseal system. Endocrine 20:155–162 [PubMed]
  • Torner L, Karg S, Blume A, Kandasamy M, Kuhn H-G, Winkler J, Aigner L, Neumann ID, Prolactin prevents chronic stress-induced decrease of adult hippocampal neurogenesis and promotes neuronal fate. J Neurosci, in press [PubMed]
  • Donner N, Neumann ID, Effects of chronic intracerebral prolactin on the oxytocinergic and vasopressinergic system of virgin ovariectomized rats. Neuroendocrinology, in press. [PubMed]
  • Bosch OJ, Neumann ID 2008 Brain vasopressin is an important regulator of maternal behavior independent of dams trait anxiety. Proc Natl Acad Sci USA 105:17139–144 [PMC free article] [PubMed]

Articles from Endocrinology are provided here courtesy of The Endocrine Society
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...