• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of geronaLink to Publisher's site
J Gerontol A Biol Sci Med Sci. Mar 2009; 64A(3): 351–362.
Published online Mar 4, 2009. doi:  10.1093/gerona/gln055
PMCID: PMC2654997

Induction of Cellular Senescence by Secretory Phospholipase A2 in Human Dermal Fibroblasts through an ROS-Mediated p53 Pathway

Abstract

Secretory phospholipase A2 (sPLA2) is involved in various cellular physiological and pathological responses, especially in inflammatory responses. Accumulating evidence suggests that inflammation is an underlying basis for the molecular alterations that link aging and age-related pathological processes. However, the involvement of sPLA2 in cellular senescence is not clear. In this study, we found that sPLA2 treatment induces cellular senescence in human dermal fibroblasts (HDFs), as confirmed by increases in senescence-associated β-galactosidase activity, changes in cell morphology, and upregulation of p53/p21 protein levels. sPLA2-induced senescence was observed in p16-knockdown HDFs and p16-null mouse fibroblasts, but not in p53-knockdown HDFs and p53-null mouse fibroblasts. Treatment with sPLA2 increases reactive oxygen species (ROS) production, and an antioxidant, N-acetylcysteine, inhibits sPLA2-induced cellular senescence. These results suggest that sPLA2 has a role in cellular senescence in HDFs during inflammatory response by promoting ROS-dependent p53 activation and might therefore contribute to inflammatory disorders associated with aging.

Keywords: Cell aging, Secretory PLA2, Inflammation, p53, ROS

CELLULAR senescence is the process of cell-cycle arrest that accompanies the exhaustion of replicative potential in cultured normal somatic cells (1); this process is considered to be a model of organismal aging (2) and a cellular safeguard against uncontrolled proliferation and cancer formation (3). Diverse factors including telomere shortening, epigenetic derepression of the INK4a/ARF locus, and DNA damage are known to induce cellular senescence (4). Senescent cells are characterized by several molecular and cytological markers, such as an enlarged, flattened morphology and expression of senescence-associated β-galactosidase (SA-β-gal) activity (5). A large body of evidence indicates that the Rb and p53 tumor suppressor pathways are master regulators of cellular senescence (6,7).

Phospholipase A2 (PLA2) hydrolyzes the sn-2 fatty acyl bond of phospholipids to produce free fatty acids including arachidonic acid (AA) and lysophospholipid (lyso PL). AA is converted into prostanoids and leukotrienes by cyclooxygenases (COXs) and lipoxygenases (LOXs), respectively, and lyso PL can serve as a precursor for lipid mediators such as lysophosphatidic acid or platelet-activating factor (PAF) (8). Prostanoids, leukotrienes, and PAF are involved in inflammatory processes (9). In addition to enzyme activity, some PLA2s are reported to exert their activity by binding to specific receptors (10). Therefore, PLA2s have a key role in diverse cellular processes such as phospholipid digestion and metabolism, host defense, signal transduction, and inflammation (9). There are five major families of PLA2s: cytosolic PLA2, secretory PLA2 (sPLA2), Ca2+-independent PLA2s, platelet-activating factor acetylhydrolases, and lysosomal PLA2s (11). sPLA2s are Ca2+-dependent low–molecular weight (14–18 kDa) enzymes that are released in plasma and biological fluids of patients with various inflammatory diseases including rheumatoid arthritis, adult respiratory distress syndrome, inflammatory bowel disease, pancreatitis, and sepsis (9,12). The sPLA2 expression levels are also increased after treatment of cells with proinflammatory cytokines (13) and in diverse pathological conditions such as myocardial infarction, viral hepatitis, renal infarction (14), and wound healing (15,16).

The inflammatory process is proposed to be involved in cellular senescence and organismal aging (17,18). Many genes involved in inflammation, such as cytokines and chemokines, are reportedly altered during cellular senescence (19,20) and animal aging (21,22). Shelton and coworkers (19) assessed senescence-associated gene expression in dermal fibroblasts using a cDNA microarray and concluded that the senescent state mimics inflammatory wound repair processes. Interferon-beta (23) or 5-lipoxygenase (5LO) (24), which is involved in inflammation, induced cellular senescence through a p53-dependent pathway. Plasma/serum levels of inflammatory mediators such as cytokines and acute-phase proteins were also increased in older adults (25). The expression of inflammatory mediators such as interleukin (IL)-1β, IL-6, tumor necrosis factor alpha, and COX-2 was enhanced during aging in mouse adipose tissue (26). Although a variety of evidence suggests that inflammatory processes play a key role in the regulation of cellular senescence, the function of sPLA2 in cellular senescence remains undefined.

In the present study, we show that treatment of human dermal fibroblasts (HDFs) with sPLA2 induces cellular senescence through a p53-dependent pathway. In the process, we confirmed that reactive oxygen species (ROS) are involved in sPLA2-induced senescence. Our data suggest that sPLA2 plays an important role in cellular senescence through a p53-dependent signaling pathway and might therefore contribute to inflammatory disorders associated with aging.

METHODS

Primary HDFs were donated by Dr I. H. Song (Department of Anatomy, College of Medicine, Yeungnam University, Daegu, South Korea). Dulbecco's modified Eagle's Medium (DMEM) was purchased from Life Technologies, Inc (Gaithersburg, MD). sPLA2-IB, N-acetylcysteine (NAC), and dihydrorhodamine 123 were purchased from Sigma Aldrich, Inc (St Louis, MO). p16- or p53-null mouse embryo fibroblasts (MEFs) were provided by Dr H. Lee (Yonsei University, Seoul, South Korea). Caspase-3 activity substrate and the annexin V–fluorescein isothiocyanate (FITC) apoptosis detection kit were purchased from Becton Dickinson, Inc (San Jose, CA). Antibodies against p53, phosphorylated p53 at ser15 residue, p21, Rb, phosphorylated Rb at ser807/811, Ataxia Telangiectasia mutated (ATM), and phosphorylated ATM at ser1981 were purchased from Cell Signaling Technology, Inc (Beverly, MA). A p16 antibody was from Santa Cruz Biotechnology, Inc (Santa Cruz, CA). A rabbit polyclonal antibody against glyceraldehyde-3-phosphate dehydrogenase was donated by Dr K. S. Kwon (KRIBB, Daejeon, South Korea). The pRetroSuper-p53sh and pRetroSuper-p16sh vectors were provided by Dr R. Agami (Division of Tumor Biology, The Netherlands Cancer Institute, Amsterdam, the Netherlands). Stealth Select RNAi against phospholipase A2 group IIA (PLA2G2A) was purchased from Invitrogen, Inc (Carlsbad, CA). The polymerase chain reaction (PCR) primer oligonucleotides for p53 (p53-917F, gcctgaggttggctctga; p53-1142R, gtggtgaggctccccttt), p16 (p16-470F, cttcctggacacgctggt; p16-653R, accttccgcggcatctat), and PLA2G2A (PLA2G2A-609F, gctgctgccacctgtttt; PLA2G2A-833R, tgcctggcctctaggatg; PLA2G2A-707R, tcagcaacgaggggtgctccc) were obtained from Bioneer, Inc (Daejeon, South Korea).

Cell Culture and Treatment

HDFs in DMEM were plated at 1 × 105 cells per 100-mm culture plate and cultured at 37°C in a 5% CO2–humidified incubator. When subcultures reached 80%–90% confluence, serial passaging was performed by trypsinization, and the number of population doublings (PDs) was monitored. For experiments, cells were used in either Passage 6 (PD < 24) or Passage 23 (PD > 55). These are referred to as “young” and “old” cells, respectively. PD was calculated using the geometric equation: PD = log2F/log2I (F = final population number, I = initial population number). Cells at early passages (less than seven passages) were used in all senescence induction experiments. For the induction of senescence, cells were at approximately 40% confluence when they were exposed to the indicated concentrations of sPLA2 (62.5–250 nM) for the indicated times.

Western Blotting

Cells were washed with ice-cold phosphate-buffered saline (PBS) and lysed in 50 μL of ice-cold RIPA buffer (25 mM Tris–HCl [pH 7.4], 150 mM KCl, 5 mM ethylenediaminetetraacetic acid [EDTA], 1% NP-40, 0.5% sodium deoxycholate, 0.5% sodium dodecyl sulfate [SDS], 1 mM Na3VO4, 5 mM NaF, and 1 mM phenylmethylsulfonyl fluoride). The proteins were quantified by the bicinchoninic acid method (Pierce Biotechnology, Inc, Rockford, IL) using bovine serum albumin as a standard. Proteins (30 μg) were resolved by 10% SDS–polyacrylamide gel electrophoresis and then transferred to nitrocellulose membranes. The membranes were incubated overnight at 4°C with antibodies specific to p53, p21, p16, pRb, or phosphorylated-Ataxia Telangiectasia mutated (pATM). After washing three times in Tris-buffered saline (10 mM Tris–HCl [pH 7.5] and 150 mM NaCl) containing 1% Tween 20, horseradish peroxidase–conjugated goat anti-mouse or goat anti-rabbit antibodies were applied. The proteins were visualized using enhanced chemiluminescence with a LAS-3000 image system (Fujifilm Corp, Stanford, CT).

3-(4,5-Dimethylthiazol-2yl)-2,5-Diphenyltetrazolium Bromide Assay

Cells were seeded on 96-well plates at a density of 5 × 102 cells per well. After treatment with various concentrations of sPLA2 for 0, 2, 4, and 6 days, cells were incubated with 1 mg/mL of 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide (MTT) solution for 2 hours. The medium was aspirated, and the resulting formazan product was solubilized in 100 μL of dimethyl sulfoxide. Viability was estimated by measuring absorbance at 570 nm with a BioRad (Hercules, CA) microplate reader.

SA-β-gal Activity Assay

Cellular SA-β-gal activity was measured as previously described (5). Cells were washed twice in PBS, fixed for 5 minutes in 3% paraformaldehyde in PBS, washed three times in PBS, and incubated in SA-β-gal staining solution (40 mM citric acid/phosphate [pH 6.0], 5 mM potassium ferrocyanide, 5 mM potassium ferricyanide, 150 mM NaCl, 2 mM MgCl2, 1 mg/mL of 5-bromo-4-chloro-3-indolyl-X-galactosidase) for 16 hours at 37°C. After SA-β-gal staining, cells were counterstained with 1% eosin for 5 minutes and then washed twice with ethanol. The percentage of blue cells per 400 cells observed under a light microscope was determined.

Flow Cytometric Analyses for Apoptosis and Cell Cycle

Apoptotic analysis was determined by annexin V–FITC staining (BD Biosciences, San Jose, CA) as recommended by the manufacturer. Cells were seeded at 1 × 105 in 60-mm dishes and incubated overnight. Cells were treated with sPLA2 for up to 12 days and then stained with annexin V–FITC in the dark. The FITC fluorescence intensity of 10,000 cells was measured using a Becton Dickinson FACS Caliber flow cytometer. Cell-cycle profiles were analyzed by propidium iodide staining (27). The intracellular propidium iodide fluorescence intensity was detected in a minimum of 10,000 cells in each sample by flow cytometry, and the cell cycle was analyzed by Cell Quest software (Becton Dickinson).

Caspase-3 Activity Assay

Caspase-3 activity was determined with the fluorescent peptide substrate Ac-DEVD-AMC (Becton Dickinson). Cells were seeded at 3 × 105 in 100-mm dishes, incubated overnight, and then treated with sPLA2 for 4 days. The cells were washed with PBS buffer and then lysed with Triton X-100–containing lysis buffer (30 mM Tris–HCl [pH 7.5], 150 mM NaCl, 1 mM phenylmethylsulfonyl fluoride, 1% Triton X-100, and 10% glycerol). After centrifugation at 12,000 g for 5 minutes, the 50-μL supernatant (containing 100–200 μg protein) was added into a 50-μL caspase reaction solution (40 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid [pH 7.2], 200 mM NaCl, 20 mM EDTA, 0.2% 3-[(3-Cholamidopropyl)dimethylammonio]-1-propanesulfonate, 20% sucrose, and 40 μM Ac-DEVD-AMC) and incubated at 37°C for 1 hour. Fluorescence was measured at an excitation wavelength of 380 nm and an emission wavelength of 460 nm in a fluorescence microplate reader.

Rhodamine Phalloidin Staining

Cells treated with or without sPLA2 (125 or 250 nM) for 4 days were fixed with 3.7% formaldehyde in PBS at room temperature for 10 minutes and permeabilized in PBS containing 0.2% Triton X-100 for 5 minutes. F-actin was stained with 250 nM rhodamine phalloidin in PBS containing 1 μg/mL 4',6-diamidino-2-phenylindole for 5 minutes. F-actin polymerization was assessed by examining stress fiber formation under a fluorescence microscope.

Detection of ROS Production With Dihydrorhodamine 123 or Lucigenin (Bis-N-Methylacridinium)

ROS production was determined by using dihydrorhodamine 123 as a fluorescence probe (28) and lucigenin as a chemilumigenic probe (29). Cells were seeded 5 × 104 in 60-mm dishes, incubated overnight, and then treated with 10 mM NAC for 1 day prior to sPLA2 treatment. After a 4-day incubation with sPLA2 (125 or 250 nM), the cells were washed with a PBS buffer. Cells were treated with DMEM containing 10 μM dihydrorhodamine 123 for 30 minutes and washed two times with DMEM. Intracellular rhodamine 123 fluorescence intensity was observed with a Leica ASMDW confocal microscope, Leica Microsystems GmbH (Wetzlar, Germany). Cells were treated with 200 μM nicotinamide adenine dinucletide phosphate (reduced) and 100 μM lucigenin and then incubated at 37°C for 2 hours in the dark. ROS accumulation was determined by measuring chemiluminescence with a luminometer.

Transfection of p53 or p16 shRNA Retroviral Vectors in Young Cells

For knockdown of p53 or p16, transient transfection of young cells with the pRetroSuper-p53sh vectors or the pRetroSuper-p16sh vectors was carried out using Lipofectamine 2000, (Invitrogen Inc., Carlsbad, CA) according to the protocol of the manufacturer. p53 shRNA or p16 shRNA–transfected cells were treated with 250 nM sPLA2. Every 4 days, cells were washed, transfected again, and treated further with or without sPLA2 for up to 12 days. Knockdown of p53 or p16 RNA levels was confirmed by reverse transcription–polymerase chain reaction (RT-PCR), and SA-β-gal activity in transfected cells was measured.

Transfection of PLA2G2A-RNAi in Old Cells

To reduce the level of sPLA2 RNA in old cells, transient transfection of old cells with the Stealth Select RNAi against PLA2G2A was carried out using Lipofectamine 2000 according to the protocol of the manufacturer. PLA2G2A-RNAi cells were incubated for 4 days. The knockdown of PLA2G2A RNA level was confirmed by RT-PCR, and SA-β-gal activity in PLA2G2A-RNAi cells was measured.

Transfection of the PLA2G2A Overexpression Vector in Young HDFs

For upregulation of PLA2G2A, transient transfection of young cells with the pcDNA3.1-PLA2G2A vector (30) was carried out using Lipofectamine 2000 according to the protocol of the manufacturer. Every 4 days, cells were washed and transfected again for up to 12 days. Upregulation of PLA2G2A level was confirmed by RT-PCR, and SA-β-gal activity in transfected cells was measured.

Statistical Analysis

All data are presented as means ± SDs. The Student's t test was employed for the all analyses. A p value of less than <0.05 was considered statistically significant.

RESULTS

Inhibition of Cell Proliferation in HDFs by sPLA2 Treatment

To investigate the roles of sPLA2 in cellular senescence of HDFs, cell proliferation was measured by the MTT assay. Exposure of HDFs to sPLA2 resulted in time- and dose-dependent inhibition of cell proliferation (Figure 1A). Because sPLA2 is known to induce apoptosis in murine macrophage RAW 264.7 cells (31) and fibroblasts (32), we examined whether the sPLA2-induced inhibition of cell proliferation in HDFs resulted from apoptosis or not. Apoptotic cell death in HDFs treated with sPLA2 for up to 12 days was estimated by measuring caspase-3 activity and annexin V–FITC staining. HDFs were also treated with 100 μM etoposide as a positive control. Although etoposide treatment increased caspase-3 activity and annexin V staining, sPLA2 did not increase apoptotic cell death in HDFs (Figure 1B and C), suggesting that sPLA2-induced inhibition of cell growth was not mediated by apoptotic cell death.

Figure 1.
Inhibition of cell proliferation by secretory phospholipase A2 (sPLA2) treatment in human dermal fibroblasts. Cells were treated with various increasing concentrations of sPLA2 for 0, 2, 4, and 6 days. Cell proliferation was measured by the 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium ...

Induction of Cellular Senescence in HDFs by sPLA2

Because senescent cells are resistant to mitogen-induced proliferation, express SA-β-gal, and have a characteristically enlarged and flattened morphology (6), we examined these characteristics in HDFs treated with sPLA2. Treatment with sPLA2 increased SA-β-gal staining in a dose-dependent manner (Figure 2A and B). In addition to SA-β-gal staining, we measured the changes in autofluorescence from lipofuscin pigment, which is a heterogeneous mixture of lipid and protein products of peroxidation associated with cellular aging (33,34). Lipofuscin autofluorescence was increased in cells treated with sPLA2 for 4 days (Figure 2C and D). Next, morphological changes after sPLA2 treatment were observed using fluorescence microscopic analysis by staining the actin with rhodamine-conjugated phalloidin. After treatment with sPLA2, HDFs flattened and became irregular in shape with an increased diameter, thus exhibiting a phenotype characteristic of senescent cells (Figure 2E). Stress fibers in cells were also increased in HDFs treated with sPLA2 (Figure 2E). Because p53, p21, and pATM protein levels are also known to increase in cellular senescence (35), we measured the levels of p53, p21, and pATM in young cells treated with sPLA2. As expected, p53, p21, and pATM protein levels were increased in sPLA2-treated cells (Figure 2F). However, the levels of Rb, pRb, and p16 proteins were not changed in cells treated with or without sPLA2 (Figure 2F). These results suggest that sPLA2 accelerates cellular senescence in HDFs.

Figure 2.
Induction of cellular senescence in human dermal fibroblasts (HDFs) treated with secretory phospholipase A2 (sPLA2). (A) Senescence-associated β-galactosidase (SA-β-gal) staining. Cells were treated with sPLA2 (125–250 nM) for ...

Induction of Cell-Cycle Arrest in G2/M Phase in HDFs

To investigate whether the growth inhibition of cells by sPLA2 was due to cell-cycle arrest, DNA contents in cells treated with sPLA2 were analyzed by flow cytometry with propidium iodide staining. The majority of cells stimulated with sPLA2 for 3 days were arrested in G2/M phase (Figure 3).

Figure 3.
Induction of G2/M cell-cycle arrest by secretory phospholipase A2 (sPLA2) in human dermal fibroblasts. (A) Cells were treated with sPLA2 (250 nM) for 0, 2, and 4 days. Cell-cycle profiles were analyzed by propidium iodide staining and flow cytometry. ...

Effects of sPLA2 Knockdown or Upregulation on Cellular Senescence

Because treatment with sPLA2 induced cellular senescence in HDFs, we tested the effects of sPLA2 knockdown in old cells or sPLA2 upregulation in young cells on cellular senescence. We tried to repress or upregulate PLA2G2A levels because PLA2G2A was found in platelets and synovial fluid (11). Although the expression level of PLA2G2A RNA was similar in old and young cells, the knockdown of PLA2G2A level in old cells induced a significant decrease in SA-β-gal activity (p < .05) (Figure 4). In contrast, upregulation of PLA2G2A caused an increase in SA-β-gal activity in young cells (Figure 5). These results suggest that sPLA2 may have an important role in the regulation of cellular senescence.

Figure 4.
Effect of secretory phospholipase A2 (sPLA2) knockdown on cellular senescence. Old human dermal fibroblasts were transfected with phospholipase A2 group IIA (PLA2G2A) RNAi (si-sPLA2) or control RNAi (si-control) and incubated for 4 days. sPLA2-knockdown ...
Figure 5.
Effect of secretory phospholipase A2 (sPLA2) upregulation on cellular senescence. Young human dermal fibroblasts were transfected with the pcDNA-PLA2G2A (phospholipase A2 group IIA) overexpression vector (PLA2G2A) or the pcDNA3.1 vector (control). Every ...

Induction of Senescence by sPLA2 in HDFs via a p53-Dependent Pathway

The p53 and the p16/Rb tumor suppressor pathways have a critical role in the senescence response (36,37). Inactivation of these two pathways was reported to abolish cellular senescence (7). It is reasonable to expect that sPLA2 activates specific signaling pathways to engage p53 via p21 protein and/or p16/Rb proteins. To determine which pathway is involved in cellular senescence by sPLA2, we generated p16 or p53 knockdowns in young cells using shRNA retroviral vectors and measured the effects of sPLA2 on cellular senescence. The knockdown of p16 or p53 level was confirmed by RT-PCR (Figure 6A). Treatment with sPLA2 increased SA-β-gal activity in p16-knockdown cells, but not in p53-knockdown cells (Figure 6B and C). To further confirm that a p53-dependent pathway is associated with cellular senescence by sPLA2, the effects of sPLA2 on cellular senescence in p53−/− MEFs and p16−/− MEFs were measured. sPLA2 induced an increase in SA-β-gal activity (Figure 6D) and a characteristically enlarged and flattened morphology in p16−/− MEFs, but not in p53−/− MEFs (Figure 6E). Therefore, these results suggest that cellular senescence induced by sPLA2 is mediated through a p53-dependent pathway.

Figure 6.
Involvement of a p53-dependent pathway in secretory phospholipase A2 (sPLA2)–induced cellular senescence. (A) Young human dermal fibroblasts (HDFs) were transfected with p16 or p53 shRNA retroviral vectors and treated with sPLA2. Knockdown of ...

Involvement of ROS in sPLA2-Induced Cell Senescence

Accumulation of intracellular ROS is known to have an important role in the induction of senescence (24, 38). In view of the known relationship between ROS accumulation and senescence, we investigated whether ROS generation might contribute to senescence phenotypes induced by sPLA2. Because cells treated with sPLA2 exhibit increased autofluorescence (Figure 2C), intracellular levels of ROS were monitored using a process that included an oxidation-sensitive fluorescence dihydrorhodamine 123 probe and a lucigenin probe rather than a dichlorofluorescein-diacetate probe. Fluorescence intensities of rhodamine 123 and chemiluminescence intensities of lucigenin were increased by treatment of HDFs with sPLA2 (Figure 7A and B). To further clarify the association of ROS accumulation with sPLA2-induced cellular senescence, cells were treated with NAC, a well-known antioxidant, prior to sPLA2 treatment and the effects of NAC on the sPLA2-induced senescence were examined. The increase in intracellular ROS levels induced by sPLA2 was repressed by NAC pretreatment (Figure 7A and B). Increases in SA-β-gal activity and in the protein levels of pATM, p53, and p21 were also decreased by NAC pretreatment (Figure 7C–E). These results suggest that sPLA2-induced cellular senescence might be mediated by accumulation of intracellular ROS.

Figure 7.
Effect of N-acetylcysteine (NAC) on the senescence phenotypes of secretory phospholipase A2 (sPLA2)–treated cells. (A) Cells were pretreated with 10 mM NAC for 1 day and then treated with sPLA2 (250 nM) for 4 days. Cells were loaded with dihydrorhodamine ...

Reversal of sPLA2-Induced Cell Senescence by NAC Treatment

We tested whether sPLA2-induced cell senescence is reversible or irreversible by antioxidant treatment. Cells were treated with sPLA2 for the indicated times up to 12 days and then treated with 10 mM NAC for 4 days. SA-β-gal activity was significantly decreased by NAC treatment in sPLA2-treated cells (Figure 8), suggesting that sPLA2-induced cellular senescence might be partially reversible in HDFs.

Figure 8.
Reversal of secretory phospholipase A2 (sPLA2)–induced cellular senescence by N-acetylcysteine (NAC) treatment. Following treatment with sPLA2 (250 nM) for 4, 8, and 12 days, cells were treated with 10 mM NAC for 4 days and then senescence-associated ...

DISCUSSION

The present study provides the first evidence of sPLA2 involvement in cellular senescence of human primary dermal fibroblasts through the p53-dependent DNA-damage signaling pathway induced by intracellular ROS accumulation. We have demonstrated that sPLA2 plays an important role in cellular senescence of HDFs through these findings: (i) increases in SA-β-gal activity (Figure 2A and B) and lipofuscin autofluorescence (Figure 2C and D); (ii) enlarged and flattened cell morphology (Figure 2E); (iii) upregulation of p53 and posttranslational modification of p53 and ATM (Figure 2F); (iv) G2/M cell-cycle arrest (Figure 3); (v) knockdown of sPLA2 in old cells reduced SA-β-gal activity (Figure 4); and (vi) upregulation of sPLA2 in young cells increased SA-β-gal activity (Figure 5). Although a variety of evidence suggests that sPLA2s have a key role in inflammatory processes and inflammation and are important components of the aging process, the role of sPLA2 in senescence is not well understood. sPLA2s produce AA and lyso PL by hydrolyzing phospholipids, and AA is converted into prostaglandins and leukotrienes by COXs and LOXs, respectively. COX-2, an inducible enzyme in the prostaglandin biosynthesis pathway, is upregulated in fibroblasts during replicative senescence (20, 39, 40). Furthermore, AA treatment induces cellular senescence by enhancing COX-2 activity, and inhibition of COX-2 activity by NS-398, a specific COX-2 inhibitor, or by COX-2 siRNA represses cellular senescence in fibroblasts (39, 40). 5LO activity also increases during senescence-like growth arrest induced by oncogenic Ras or culture history in fibroblasts, and overexpression of 5LO promotes cellular senescence via a p53/p21-dependent pathway mediated by ROS (24). Our findings that ROS were increased by sPLA2 treatment (Figure 7A and B) and that pretreatment with NAC, an antioxidant, repressed sPLA2-induced cellular senescence (Figure 7C and D) implicate oxidative stress as a key player in sPLA2-induced cell senescence. PLA2 is reported to increase ROS levels through oxidative metabolism of AA and the hydrolysis of phospholipids in mitochondrial membrane (41). Taken together, our results clearly show that sPLA2-mediated inflammatory processes have an important role in the regulation of cellular senescence.

One important question is what signal mediates the cellular senescence induced by sPLA2 in HDFs. Accumulating evidence suggests that p53 and p16/Rb tumor suppressor pathways are key regulators of the senescence response (36, 37). We found that p53 is required for sPLA2-induced senescence: (i) SA-β-gal staining by sPLA2 treatment was increased in p16-knockdown HDFs, but not in p53-knockdown cells (Figure 6B and C); (ii) SA-β-gal staining by sPLA2 treatment was increased in p16−/− MEFs, but not in p53−/− MEFs (Figure 6D and E); (iii) sPLA2 induced p53 phosphorylation at serine 15 and ATM phosphorylation (Figure 2F); and (iv) the levels of p16, Rb, and pRb proteins were not changed in HDFs treated with or without sPLA2 (Figures 2F and and7E).7E). The phosphorylation of p53 at serine 15 is a critical senescence-inducible modification (42) that is regulated by ATM kinase (23). ATM phosphorylates p53 at serine 15 in response to DNA damage (43,44). Cellular senescence induced by several genes and molecules, such as inhibitor of growth 2 (45), 5LO (24), interferon-beta (23), phosphatidylcholine-specific phospholipase C (46), and insulin-like growth factor binding protein-5 (47), is regulated by the p53-dependent pathway. ATM activation by DNA-damage signaling is critical for oncogene-induced senescence (48), as well as stress-induced premature senescence caused by ionizing irradiation or oxidative stress (49). Because cellular senescence mediated through a p53-dependent pathway has been suggested to be reversible (6), we further confirmed that sPLA2-induced cellular senescence might be partially reversible by NAC treatment (Figure 8). Taken together, our data suggest that sPLA2 induces cellular senescence through DNA-damage–dependent p53 activation mediated by ROS in HDFs.

The catalytic activity of sPLA2 and the concentrations of PLA2-IB and PLA2-IIA in serum are relatively low in healthy individuals. The normal range for the catalytic activity of PLA2 is 0–0.44 U/L for men and 0.044–1.11 U/L for women (50). Mean PLA2-IB and PLA2-IIA concentrations are 2.4–6.5 and 2.1–3.7 μg/L, respectively, in sera of healthy individuals (51). However, sPLA2 concentrations in serum are increased in patients with infections, injuries, and inflammatory diseases such as acute pancreatitis, abdominal trauma, sepsis, various forms of arthritis, cancer, pregnancy complications, and postoperative states (51). PLA2 concentrations in sera during pathological conditions are 479 μg/L in sepsis and 1,444 μg/L in typhoid fever (12). The PLA2 concentration in arthritic synovial fluid ranges from 80 to 2,710 μg/L (52). In our experiments, we treated cells with up to 250 nM (3,500 μg/L) of PLA2-IB to observe cellular senescence, which is just above the range of PLA2 concentrations observed in pathological conditions, suggesting that sPLA2 contributes to cellular senescence in pathological conditions.

Senescent cells reportedly accumulate in aging human skin (5) and human liver (53). In addition, senescent cells have been detected at various sites of inflammatory pathology, such as in rheumatoid arthritis (54), osteoarthritis (55,56), hepatitis (53), chronic wound tissues (57,58), and atherosclerotic tissues (59,60). Cellular senescence might also affect time to healing in chronic wounds such as venous leg ulcers; an ulcer may become hard to heal when greater than 15% in senescent cells was identified in venous ulcers (61). Senescent cells are proposed to contribute to aging phenotypes or aging-related pathology: (i) by accumulation of nondividing senescent cells, which compromise tissue renewal or repair, and (ii) by secretion of degradative enzymes and cytokines that can alter the tissue microenvironment, thus altering tissue structure and function (6). Therefore, our results regarding the role of sPLA2 in cellular senescence suggest that sPLA2-mediated cellular senescence contributes to the age-related decline of tissue structure and/or the genesis and progression of various inflammatory diseases associated with age.

FUNDING

This work was supported by the Korea Science and Engineering Foundation grant funded by the Korea government (Ministry of Education, Science and Technology) (R13-2005-005-01001-0) and by a grant from the Korea Health 21 R&D Project, Ministry of Health & Welfare, Republic of Korea (02-PJ10-PG6-AG01-0003).

References

1. Hayflick L, Moorhead PS. The serial cultivation of human diploid cell strains. Exp Cell Res. 1961;25:585–621. [PubMed]
2. Patil CK, Mian IS, Campisi J. The thorny path linking cellular senescence to organismal aging. Mech Ageing Dev. 2005;126:1040–1045. [PubMed]
3. Campisi J. Cellular senescence as a tumor-suppressor mechanism. Trends Cell Biol. 2001;11:S27–S31. [PubMed]
4. Collado M, Blasco MA, Serrano M. Cellular senescence in cancer and aging. Cell. 2007;130:223–233. [PubMed]
5. Dimri GP, Lee X, Basile G, et al. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci U S A. 1995;92:9363–9367. [PMC free article] [PubMed]
6. Campisi J. Senescent cells, tumor suppression, and organismal aging: good citizens, bad neighbors. Cell. 2005;120:513–522. [PubMed]
7. Ye X, Zerlanko B, Zhang R, et al. Definition of pRB- and p53-dependent and -independent steps in HIRA/ASF1a-mediated formation of senescence-associated heterochromatin foci. Mol Cell Biol. 2007;27:2452–2465. [PMC free article] [PubMed]
8. Dennis EA. Diversity of group types, regulation, and function of phospholipase A2. J Biol Chem. 1994;269:13057–13060. [PubMed]
9. Triggiani M, Granata F, Frattini A, Marone G. Activation of human inflammatory cells by secreted phospholipases A2. Biochim Biophys Acta. 2006;1761:1289–1300. [PubMed]
10. Valentin E, Lambeau G. Increasing molecular diversity of secreted phospholipases A(2) and their receptors and binding proteins. Biochim Biophys Acta. 2000;1488:59–70. [PubMed]
11. Schaloske RH, Dennis EA. The phospholipase A2 superfamily and its group numbering system. Biochim Biophys Acta. 2006;1761:1246–1259. [PubMed]
12. Nevalainen TJ, Haapamaki MM, Gronroos JM. Roles of secretory phospholipases A(2) in inflammatory diseases and trauma. Biochim Biophys Acta. 2000;1488:83–90. [PubMed]
13. Capper EA, Marshall LA. Mammalian phospholipases A(2): mediators of inflammation, proliferation and apoptosis. Prog Lipid Res. 2001;40:167–197. [PubMed]
14. Masuda S, Murakami M, Ishikawa Y, et al. Diverse cellular localizations of secretory phospholipase A2 enzymes in several human tissues. Biochim Biophys Acta. 2005;1736:200–210. [PubMed]
15. Rys-Sikora KE, Konger RL, Schoggins JW, et al. Coordinate expression of secretory phospholipase A(2) and cyclooxygenase-2 in activated human keratinocytes. Am J Physiol Cell Physiol. 2000;278:C822–C833. [PubMed]
16. Oestvang J, Johansen B. PhospholipaseA2: a key regulator of inflammatory signalling and a connector to fibrosis development in atherosclerosis. Biochim Biophys Acta. 2006;1761:1309–1316. [PubMed]
17. Chung HY, Kim HJ, Kim KW, et al. Molecular inflammation hypothesis of aging based on the anti-aging mechanism of calorie restriction. Microsc Res Tech. 2002;59:264–272. [PubMed]
18. Vasto S, Candore G, Balistreri CR, et al. Inflammatory networks in ageing, age-related diseases and longevity. Mech Ageing Dev. 2007;128:83–91. [PubMed]
19. Shelton DN, Chang E, Whittier PS, et al. Microarray analysis of replicative senescence. Curr Biol. 1999;9:939–945. [PubMed]
20. Yoon IK, Kim HK, Kim YK, et al. Exploration of replicative senescence-associated genes in human dermal fibroblasts by cDNA microarray technology. Exp Gerontol. 2004;39:1369–1378. [PubMed]
21. Lee CK, Klopp RG, Weindruch R, et al. Gene expression profile of aging and its retardation by caloric restriction. Science. 1999;285:1390–1393. [PubMed]
22. Lee CK, Weindruch R, Prolla TA. Gene-expression profile of the ageing brain in mice. Nat Genet. 2000;25:294–297. [PubMed]
23. Moiseeva O, Mallette FA, Mukhopadhyay UK, et al. DNA damage signaling and p53-dependent senescence after prolonged beta-interferon stimulation. Mol Biol Cell. 2006;17:1583–1592. [PMC free article] [PubMed]
24. Catalano A, Rodilossi S, Caprari P, et al. 5-Lipoxygenase regulates senescence-like growth arrest by promoting ROS-dependent p53 activation. EMBO J. 2005;24:170–179. [PMC free article] [PubMed]
25. Krabbe KS, Pedersen M, Bruunsgaard H. Inflammatory mediators in the elderly. Exp Gerontol. 2004;39:687–699. [PubMed]
26. Wu D, Ren Z, Pae M, et al. Aging up-regulates expression of inflammatory mediators in mouse adipose tissue. J Immunol. 2007;179:4829–4839. [PubMed]
27. Krishan A. Rapid flow cytofluorometric analysis of mammalian cell cycle by propidium iodide staining. J Cell Biol. 1975;66:188–193. [PMC free article] [PubMed]
28. Royall JA, Ischiropoulos H. Evaluation of 2′,7′-dichlorofluorescin and dihydrorhodamine 123 as fluorescent probes for intracellular H2O2 in cultured endothelial cells. Arch Biochem Biophys. 1993;302:348–355. [PubMed]
29. Li Y, Zhu H, Kuppusamy P, Roubaud V, Zweier JL, Trush MA. Validation of lucigenin (bis-N-methylacridinium) as a chemilumigenic probe for detecting superoxide anion radical production by enzymatic and cellular systems. J Biol Chem. 1998;273:2015–2023. [PubMed]
30. Park DW, Kim JR, Kim SY, et al. Akt as a mediator of secretory phospholipase A2 receptor-involved inducible nitric oxide synthase expression. J Immunol. 2003;170:2093–2099. [PubMed]
31. Lee C, Park DW, Lee J, et al. Secretory phospholipase A2 induces apoptosis through TNF-alpha and cytochrome c-mediated caspase cascade in murine macrophage RAW 264.7 cells. Eur J Pharmacol. 2006;536:47–53. [PubMed]
32. Zhao M, Brunk UT, Eaton JW. Delayed oxidant-induced cell death involves activation of phospholipase A2. FEBS Lett. 2001;509:399–404. [PubMed]
33. Goodwin EC, Yang E, Lee CJ, et al. Rapid induction of senescence in human cervical carcinoma cells. Proc Natl Acad Sci U S A. 2000;97:10978–10983. [PMC free article] [PubMed]
34. Lee BY, Han JA, Im JS, et al. Senescence-associated beta-galactosidase is lysosomal beta-galactosidase. Aging Cell. 2006;5:187–195. [PubMed]
35. Atadja P, Wong H, Garkavtsev I, et al. Increased activity of p53 in senescing fibroblasts. Proc Natl Acad Sci U S A. 1995;92:8348–8352. [PMC free article] [PubMed]
36. Ferbeyre G, de Stanchina E, Lin AW, et al. Oncogenic ras and p53 cooperate to induce cellular senescence. Mol Cell Biol. 2002;22:3497–3508. [PMC free article] [PubMed]
37. Ben-Porath I, Weinberg RA. The signals and pathways activating cellular senescence. Int J Biochem Cell Biol. 2005;37:961–976. [PubMed]
38. Blander G, de Oliveira RM, Conboy CM, et al. Superoxide dismutase 1 knock-down induces senescence in human fibroblasts. J Biol Chem. 2003;278:38966–38969. [PubMed]
39. Han JH, Roh MS, Park CH, et al. Selective COX-2 inhibitor, NS-398, inhibits the replicative senescence of cultured dermal fibroblasts. Mech Ageing Dev. 2004;125:359–366. [PubMed]
40. Zdanov S, Bernard D, Debacq-Chainiaux F, et al. Normal or stress-induced fibroblast senescence involves COX-2 activity. Exp Cell Res. 2007;313:3046–3056. [PubMed]
41. Muralikrishna Adibhatla R, Hatcher JF. Phospholipase A2, reactive oxygen species, and lipid peroxidation in cerebral ischemia. Free Radic Biol Med. 2006;40:376–387. [PubMed]
42. Webley K, Bond JA, Jones CJ, et al. Posttranslational modifications of p53 in replicative senescence overlapping but distinct from those induced by DNA damage. Mol Cell Biol. 2000;20:2803–2808. [PMC free article] [PubMed]
43. Banin S, Moyal L, Shieh S, et al. Enhanced phosphorylation of p53 by ATM in response to DNA damage. Science. 1998;281:1674–1677. [PubMed]
44. Canman CE, Lim DS, Cimprich KA, et al. Activation of the ATM kinase by ionizing radiation and phosphorylation of p53. Science. 1998;281:1677–1679. [PubMed]
45. Pedeux R, Sengupta S, Shen JC, et al. ING2 regulates the onset of replicative senescence by induction of p300-dependent p53 acetylation. Mol Cell Biol. 2005;25:6639–6648. [PMC free article] [PubMed]
46. Cheng Y, Zhao Q, Liu X, et al. Phosphatidylcholine-specific phospholipase C, p53 and ROS in the association of apoptosis and senescence in vascular endothelial cells. FEBS Lett. 2006;580:4911–4915. [PubMed]
47. Kim KS, Seu YB, Baek SH, et al. Induction of cellular senescence by insulin-like growth factor binding protein-5 through a p53-dependent mechanism. Mol Biol Cell. 2007;18:4543–4552. [PMC free article] [PubMed]
48. Mallette FA, Gaumont-Leclerc MF, Ferbeyre G. The DNA damage signaling pathway is a critical mediator of oncogene-induced senescence. Gene Dev. 2007;21:43–48. [PMC free article] [PubMed]
49. Naka K, Tachibana A, Ikeda K, et al. Stress-induced premature senescence in hTERT-expressing ataxia telangiectasia fibroblasts. J Biol Chem. 2004;279:2030–2037. [PubMed]
50. Aufenanger J, Zimmer W, Puttmann M, et al. Determination of the catalytic activity of phospholipase A2: E. coli-based assay compared to a photometric micelle assay. Eur J Clin Chem Clin Biochem. 1993;31:777–785. [PubMed]
51. Nevalainen TJ. Serum phospholipases A2 in inflammatory diseases. Clin Chem. 1993;39:2453–2459. [PubMed]
52. Kortekangas P, Aro HT, Nevalainen TJ. Group II phospholipase A2 in synovial fluid and serum in acute arthritis. Scand J Rheumatol. 1994;23:68–72. [PubMed]
53. Paradis V, Youssef N, Dargere D, et al. Replicative senescence in normal liver, chronic hepatitis C, and hepatocellular carcinomas. Hum Pathol. 2001;32:327–332. [PubMed]
54. Schmid M, Rodemann HP, Aicher WK. Frequency of terminally differentiated fibroblasts in the synovial membrane of rheumatoid arthritis patients. Z Rheumatol. 2004;63:483–489. [PubMed]
55. Price JS, Waters JG, Darrah C, et al. The role of chondrocyte senescence in osteoarthritis. Aging Cell. 2002;1:57–65. [PubMed]
56. Dai SM, Shan ZZ, Nakamura H, et al. Catabolic stress induces features of chondrocyte senescence through overexpression of caveolin 1: possible involvement of caveolin 1-induced down-regulation of articular chondrocytes in the pathogenesis of osteoarthritis. Arthritis Rheum. 2006;54:818–831. [PubMed]
57. Mendez MV, Stanley A, Park HY, et al. Fibroblasts cultured from venous ulcers display cellular characteristics of senescence. J Vasc Surg. 1998;28:876–883. [PubMed]
58. Harding KG, Moore K, Phillips TJ. Wound chronicity and fibroblast senescence—implications for treatment. Int Wound J. 2005;2:364–368. [PubMed]
59. Minamino T, Miyauchi H, Yoshida T, et al. Endothelial cell senescence in human atherosclerosis: role of telomeres in endothelial dysfunction. J Cardiol. 2003;41:39–40. [PubMed]
60. Hayashi T, Matsui-Hirai H, Miyazaki-Akita A, et al. Endothelial cellular senescence is inhibited by nitric oxide: implications in atherosclerosis associated with menopause and diabetes. Proc Natl Acad Sci USA. 2006;103:17018–17023. [PMC free article] [PubMed]
61. Stanley A, Osler T. Senescence and the healing rates of venous ulcers. J Vasc Surg. 2001;33:1206–1211. [PubMed]

Articles from The Journals of Gerontology Series A: Biological Sciences and Medical Sciences are provided here courtesy of Oxford University Press
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

  • MedGen
    MedGen
    Related information in MedGen
  • PubMed
    PubMed
    PubMed citations for these articles
  • Substance
    Substance
    PubChem Substance links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...