![]() | ![]() |
Formats:
|
||||||||||||||
TNF-α stimulation inhibits siRNA-mediated RNA interference through a mechanism involving poly-(A) tail stabilization 1Department of Immunology, The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, 92037, CA, USA 2Viral Development Unit, R&D Department, GlaxoSmithKline Biologicals, 15, rue de l’institut, B-1340 Rixensart, Belgium 3The Key Laboratory of the Ministry of Education for Cell Biology and Tumor Cell Engineering, School of Life Sciences, Xiamen University, Xiamen, Fujian 361005, China. *Corresponding author: Email: jhan/at/scripps.edu The publisher's final edited version of this article is available at Biochim Biophys Acta.Summary The control of mRNA stability is a complex biological process that involves numerous factors, including microRNA (miRNA) and short interfering RNA (siRNA). Here, we show that short interfering RNA (siRNA) and microRNA share some similarities in their response to cellular stress. miR16 expedites the degradation of mRNAs containing AU-rich elements (ARE) in their 3’ unltranslated region (UTR). si20 is an siRNA designed to target a non-ARE sequence in the TNF 3’UTR. We found that both si20 and miR16/ARE mediated degradation of mRNAs can be inhibited by stimulating cells with different stresses. By analyzing TNF-α stimulation-mediated stabilization of si20- and miR16-targeted mRNA, we show that this stabilization is not caused by modifying si20 and miR16 loading into Ago2 complexes, or mRNA targeting to Ago2, but by inhibiting mRNA deadenylation. This is the first report showing that a specific siRNA-mediated mRNA degradation can be regulated by inflammatory stimuli, and that deadenylation is involved in this siRNA-mediated mRNA decay. Introduction Gene expression is tightly controlled at various levels, from gene transcription to protein posttranslational modifications [1, 2, 3]. Deregulation of gene expression can result in dramatic phenotypes leading to pathological states [4, 5, 6, 7, 8]. The control of mRNA expression levels and translation have been highlighted as major control checkpoints for transiently expressed molecules like cytokines [9, 10, 11]. In cells of the innate immune system, inflammatory stimuli can be associated with an increase in mRNA translation and stability [12, 13, 14, 15]. AU-rich elements (ARE), present in the 3’ untranslated region (3’UTR) of many unstable mRNAs, control mRNA degradation through the recruitment of ARE binding proteins having various biological activities [14, 15]. Amongst ARE binding proteins that were studied and characterized at the functional level, some are destabilizing factors like tristetraprolin (TTP), some are stabilizing factors like the ELAV-related protein HuR [16–17]. Even more strikingly, the ARE and poly(A) binding protein AUF-1 has several isoforms: p37, p40, p42, and p45 that act in an antagonistic way in the control of ARE-mediated mRNA decay [17]. Research undertaken in our laboratory demonstrated that ARE-mediated mRNA degradation involves short non-coding endogenous RNA molecules called microRNAs (or miRNAs) [18]. In human cells, ARE-mediated mRNA degradation is triggered by the interaction of miR16 with a hexameric ribonucleotide sequence that exists in several ARE sequences. From a thermodynamic point of view, the interaction between miR16 and the hexamer is weak and unlikely to occur in vivo without the help of other factors. [18]. The biogenesis of miRNAs and short-interfering RNAs (siRNAs) share some common features in their maturation steps, processing by Dicer to mature 20–23 nucleotide miRNA/siRNAs and subsequent loading into Ago-containing complexes. Genes of miRNA are transcribed into large miRNA precursors, matured in the nucleus by Drosha to imperfect hairpin-like pre-miRNAs. These pre-miRNA precursors are then translocated to the cytosol by Exportin-5. Dicer further processes the hairpin structures to imperfect double-stranded RNA duplexes that are transferred to RISC [20, 21, 22, 23]. After loading into RISC, the passenger strand of the duplex RNA is destroyed by Ago2 as a consequence of the duplex RNA thermodynamic polarity, while the guide strand is retained into RISC to direct RNAi. The synthesis of siRNA from pSuper vectors is quite similar to the endogenous synthesis of miRNAs. Transcription of siRNA is performed by RNA polymerase III, and the perfectly matching hairpin is transferred into the cytosol where Dicer, present in the RISC-loading complex, generates a duplex RNA. This duplex is then transferred to RISC and the passenger strand is destroyed by Ago2 as a result of the same thermodynamic considerations as for the maturation of miRNAs [20, 21, 22, 23]. siRNA and miRNA are strikingly similar in structures and synthesis pathways; however, studies have also pointed out their different functions. It is well known that the ARE-mediated mRNA degradation, in which miR16 is involved, is subjected to regulation by inflammatory signals. Here we present evidence to demonstrate that siRNA-mediated mRNA decay is also subject to regulation by inflammatory signals. We show that TNF stimulation can inhibit siRNA-mediated RNA degradation by suppression of deadenylation. Material and methods Constructs CMV-ARE and CMV-ΔARE were constructed by PCR amplification from the pBBB-TNF-3’UTR and pBBB-TNF-ΔARE vectors, as described earlier [19]. The forward primer contained a NotI restriction site whereas the reverse primer contained an XhoI restriction site. Both PCR amplification products were introduced into CMV-driven 3xFlag vectors by ligation into NotI and XhoI sites, generating the CMV-ARE and CMV-ΔARE plasmids. The Tet-ARE and Tet-ΔARE plasmids were generated by exchanging the CMV promoter for the Tetracycline responsive promoter from the CMV-ARE and CMV-ΔARE plasmids, respectively. Cloning of si20 and miR16 were performed by ligating duplex oligos into the BamHI and XhoI of pSuper vector in a similar way as was done by the Flemington lab, which is further described on their website (http://www.flemingtonlab.com). The sequence of si20 is ggttgcctctgtctcagaat. The sequence of miR16 is described in our previous work[18]. Flag-Ago2 was from Thomas Tuschl (Rockfeller Institute, New York, NY). Cells and cell culture HEK293T and HeLa Tet-off cells were grown at 37°C in a water-saturated atmosphere containing 5% CO2. Cells were cultured in Dulbecco’s Modified Eagle’s medium (DMEM) with 10% fetal bovine serum (FBS) and further supplemented with 1% of a mixture of 100X-concentrated penicillin-streptomycin-glutamine solution (Invitrogen, Carlsbad, CA). Both cell lines were maintained in 10 cm dishes and passed at ~80% confluence. All transfections were performed using Lipofectamine 2000 (Invitrogen) following the procedure described by the manufacturer. Quantitative RT-PCR Total RNA was isolated from cells using Trizol reagent (Invitrogen) following the manufacturer’s instructions. Quantitative RT-PCR reactions were performed with the one step RT-PCR master mix reagents from Applied Biosystems (Foster City, CA) with the following primers: gtgacaagctgcacgtggat,; acagcacaataaccagcacgtt and Taqman® probe; FAM-ctgagaacttcagctcctgggc-Quantitative RT-PCR was normalized against GAPDH, as described in our previous work[18]. Detection was performed using an ABI 7900HT fast instrument (Applied Biosystems). Northern-blots The procedure to perform Northern blots is described elsewhere [24]. Briefly, Northern-blots were run on agarose gels containing formaldehyde. RNA was transferred to nitrocellulose membranes by capillary transfer. Hybridizations were performed with full-length RNA probes. Hybridizations were conducted at 70°C in a rotisserie oven for up to 18 hours. Membranes were washed until a specific signal appeared. Anti-sense full length RNA probes were internally labeled with [α-32P] UTP and generated with T7 polymerase (Roche Applied Science, Indianapolis, IN), following the manufacturer’s recommendations and as described in previous publications[24]. Primer extension primer extensions were performed as in our previous work[18]. mRNA degradation experiments and TNF-α treatment HeLa Tet-off cells were grown overnight in a 100 mm plate until reaching 80–85% confluence, and then they were transfected with 20 µg of Tet-ARE or Tet-ΔARE with pSuper-si20. Cells were then cultured for 15 additional hours, collected and redistributed in 12 different wells among two 6-well plates. Cells were grown for an additional 24h. In the first set of six wells, PBS was added 15 min. prior to doxycycline treatment (10 µg/ml), which was added for 0, 0.25, 0.5, 1, and 2 hours to block transcription. In a second set of six wells, 50 ng/ml of TNF-α were introduced 15 min. prior to doxycyclin addition (0, 0.25, 0.5, 1 and 2 hours) and total RNA was isolated with Trizol®. Immunohystochemistry HeLa cells were seeded onto glass cover slips at the bottom of the 6-well plates. Fixation and staining procedures were done as described elsewhere [24]. M2 anti-Flag monoclonal antibodies were from Sigma, anti-TIA-1 goat polyclonal antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA), anti-Dcp1a rabbit polyclonal antibodies were obtained elsewhere [25]. Fluorescent-conjugated secondary antibodies were from Molecular Probes (Invitrogen, Carlsbad, CA). Fluorescence signal was detected with a CCD camera and an Axiovert 200 from Carl Zeiss Inc (Thornwood, NY). Co-immunoprecipitations Cells (HEK-293T cells or HeLa Tet-off cells) were rinsed with PBS and lysed on ice with lysis buffer (20 mM Tris pH 7.5, 0.9% NaCl, 0.5% Triton X-100, and 0.5 mM PMSF). Cell particles were spun down at 10,000 rpm at 4°C for 10 min., and M2 anti-Flag agarose conjugated beads (Sigma, St Louis, MA) were added to the supernatant and incubated at 4°C for 2–4h under gentle agitation. Beads were then washed with lysis buffer 5 times. To extract RNA from the beads, Trizol® was directly added to the beads. Anti-Cap-immunoprecipitation Trizol®-extracted total RNA was utilized for immunoprecipitations. K121 anti-2,2,7-trimethylguanosine agarose-conjugated mouse monoclonal antibodies (Calbiochem, Darmstadt, Germany) were pre-blocked with 100 µg/ml tRNA for 2 hours at 4°C under gentle agitiation. Immunoprecipitation was performed in a lysis buffer (20 mM Tris pH 7.5, 0.9% NaCl, 0.5% Triton X-100) with 100 µg/ml tRNA and K121 beads for 5 hours at 4°C under gentle agitation. Poly(A) tail analysis Poly(A) tail experiments were performed following Lykke-Andersen’s protocol [26]. Trizol®-extracted total RNA was mixed with oligonucleotides complimentary to the 3’UTR of ARE and ΔARE mRNAs, heated to 80°C for 2 min., and cooled down to room temperature to allow annealing of the oligonucleotides with complimentary mRNA sequences. RNAse H reaction buffer and RNAse H were then added to the mixture following the manufacturer’s recommendation (Roche Applied Science). RNAse H digestion was then performed at 37°C for 1 hour, and total RNA was extracted using Trizol® and then resuspended in Northern-blot loading buffer [26]. Results Stabilization of siRNA-targeted mRNA by extracellular stimuli To study the effect of extracellular stimulation on siRNA-mediated mRNA decay, we established reporter mRNA systems. As shown in Figure 1A
Figure 1B The addition of tetracyclin derivatives (doxycyclin) to the Tet-off system results in quick and complete transcription blocking of the tetracycline responsive promoter. Doxycyclin addition to HeLa Tet-off cells results in very specific, quick, and strong transcription suppression that does not affect many other genes’ expression or cell viability, as compared to other drugs like Actinomycin D. HeLa Tet-off cells were transfected with Tet-ΔARE, Tet-ARE, or Tet-ΔARE and pSuper-si20, as detailed in the legend of figure 1D A range of pSuper-si20/Tet-ΔARE ratios were used to transfect HeLa Tet-off cells to investigate whether the level of si20 plays a role in the presence of the 5’ fragment (Figure 1E It has been well described that cell stimulation can result in the stabilization of some unstable mRNA molecules. Some mRNAs are of low abundance when cells are in a resting stage, whereas inflammatory stimulation results in transcriptional activation that is accompanied by mRNA stabilization, further enhancing the efficiency of the transcriptional pulse. The treatment of CMV-ARE-transfected HEK-293T cells with cytokines results in a general upregulation of ARE mRNA cellular levels, as compared to PBS-treated cells (Figure 2A
To further exclude any promoter activation issue, the ARE mRNA was expressed in HeLa Tet-off cells under the control of the tetracyclin-sensitive promoter (Figure 2C and D Because miRNA is involved in ARE-mediated mRNA degradation, and because certain similarities exist between miRNA and siRNA, we thought to test whether siRNA-mediated mRNA decay is also subject to regulation by extracellular stress stimuli. HEK-293T cells were transfected with Tet-ΔARE and pSuper-si20, and were then exposed to PBS, IFN-α, Il-1β, or TNF-α for 1 hour (Figure 3A
Next, we investigate whether other stress-related stimuli are able to stabilize siRNA-targeted mRNA. HeLa Tet-off cells cotransfected with Tet-ΔARE and pSuper-si20 were pre-stimulated with H2O2, MNNG, or anisomycin, and the mRNA stabilities were measured (Figure 3E TNF-α induced stabilization of siRNA-targeted mRNA is not related to siRNA loading or to mRNA targeting to the Ago2 complex In mammalian cells, the Ago2 complex directs siRNA-dependant mRNA degradation, and therefore TNF-α could interfere with this process at several levels. Since Ago2 is localized in cytoplasmic foci called p-bodies [25], we investigated whether TNF-α stimulation could interfere with the p-body localization of Ago2. HeLa cells were transfected with Flag-Ago2 and stimulated for 1h with IL-1β, TNF-α, or As3+. Ago2 subcellular localization and p-bodies morphology were then analyzed by immuno-histochemistry with anti-Flag (green), anti-Dcp1a (blue; p-body marker) or anti-TIA-1 (red; stress granule marker) (Figure 4A
TNF-α and other inflammatory stimuli could also block miRNA and siRNA loading to the Ago2 complex, therefore interfering with their biological functions. HEK-293T cells were transfected with Flag-Ago2 and pSuper-si20, or with pSuper-miR16. Cells were treated with or without TNF-α and subjected to anti-Flag immunoprecipitation (Figure 4C Another possible explanation for TNF-α-mediated inhibition of ARE/miR16- and si20-mediated mRNA degradation is that the targeting of mRNA to Ago2 complexes is controlled by TNF-α stimulation. To investigate this possibility, HEK-293T cells were transfected with Flag-Ago2 in addition to CMV-ARE (ARE), or with CMV-ΔARE plus pSuper-si20 (ΔARE/si20). Cells were stimulated with TNF-α for 2 hours and subjected to anti-Flag immunoprecipitation. Northern-blotting analyses were then performed on total RNA extracted from the cell lysates or from the Ago2 immuno-complex (Figure 4D Deadenylation of siRNA-targeted mRNA is subjected to regulation by TNF-α stimulation Since decapping and deadenylation are known to be involved in ARE-mediated mRNA degradation, we next examined whether decapping and deadenylation are involved in si20-mediated mRNA decay. Anti-Cap mRNA immunoprecipitations were performed to investigate whether TNF-α stimulation is involved in deccaping inhibition, or whether decapping occurs prior to siRNA-mediated mRNA endonucleolytic degradation (Figure 5B
To investigate whether the mRNA poly(A) tail deadenylation was affected by TNF-α stimulation, we designed oligos that can hybridize to sequences of ΔARE mRNAs for RNAse H digestion. The localization of RH1 oligo on the ΔARE mRNA and the length of digesting products are schematized on Figure 5A Discussion miRNA and siRNA, even if they share common features, have been reported to repress gene expression through different mechanisms, as miRNAs act mainly through translational control mechanisms, whereas siRNAs induce mRNA degradation [27, 28, 29, 30]. The mechanism by which siRNA mediates mRNA degradation is partly uncovered by our work, as Ago2 was demonstrated to direct an endonucleolytic cleavage at the siRNA targeting sites [31]. On the other hand, the mechanism by which miRNA mediates translational initiation suppression is still unclear, and it is only recently that Ago2 was shown to repress translation through a cap binding-like motif within Ago2 [29]. Additionally, Mathonnet et al. reported that miRNA inhibition of translation initiation occurrs in vitro by targeting the cap-binding complex EIF4F [30]. Despite the well accepted translational suppressing function of miRNA, recent work from our and other laboratories has shown that miRNA can also mediate mRNA degradation [18, 34]. Our work described in this report demonstrates that at least some siRNA-mediated mRNA degradation is subjected to regulation by extracellular stimulation, revealing an additional feature that is similar between miRNA- and siRNA-mediated mRNA decay. mRNA instability is a common phenomenon that is associated with mRNAs that are transient, inducible, or tissue-specific. Amongst factors controlling mRNA stability, AU-rich elements (ARE) present in the 3’UTR of many mRNAs have been shown to control their fate by recruiting ARE-binding proteins to the 3’UTR, and by promoting or blocking their degradation [9, 14, 15, 16, 17, 19]. Recently, miRNA was found to be involved in the degradation of ARE-containing mRNAs [18]. Considering that ARE-mediated mRNA degradation is a regulated process, and that miR16 controls ARE-mediated mRNA decay [18], it is highly probable that miR16 is involved in the regulation of the degradation of ARE-containing mRNAs. Wu et al. showed recently that miRNAs direct the deadenylation of targeted mRNAs [34], suggesting that the regulation may occur at this step. siRNA-mediated mRNA degradation is believed to be initiated by cleaving the mRNA target sites complementary to siRNA, followed by 3’→5’ and 5’→3’ exonucleolytic digestions [33]. We observed both 5’ and 3’ fragments in the Ago2 complex (Figure 4D By comparing ARE/miR16- and si20-mediated mRNA degradations, it was quite unexpected to have discovered that the si20-mediated RNAi is regulated by inflammatory mediators (Figure 3 Acknowledgements We thank J. Lykke-Andersen (University of Colorado at Boulder) for providing the anti- Dcp1a antibodies. This work was supported by grants from National Institutes of Health grants AI41637 and AI54696. Footnotes Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that aply to the journal pertain. References 1. Khabar KS, Young HA. Post-transcriptional control of the interferon system. Biochimie. 2007;89:761–769. [PubMed] 2. Wang J, Fillebeen C, Chen G, Biederbick A, Lill R, Pantopoulos K. Iron-dependant degradation of apo-IRP1 by the ubiquitin-proteasome pathway. Mol. Cell. Biol. 2007;27:2423–2430. [PubMed] 3. Quattrone A, Pascale A, Nogues X, Zhao W, Gusev P, Pacini A, Alkon DL. Postranscriptional regulation of gene expression in learning by the neuronal ELAV-like mRNA-stabilizing proteins. Proc. Natl. Acad. Sci. USA. 2001;98:11668–116673. [PubMed] 4. Verrechia F, Mauviel A. Transforming growth factor-beta and fibrosis. World J. Gastroenterol. 2007;13:3056–3062. [PubMed] 5. Lubberts E, Koenders MI, Van den Berg WB. The role of T-cell interleukin-17 in conducting destructive arthritis: lessons from animal models. Arthritis Res. Ther. 2005;7:29–37. [PubMed] 6. Salahshor S, Goncalves J, Chetty R, Gallinger S, Woodgett JR. Differential gene expression profile reveals deregulation of pregnancy specific beta1 glycoprotein 9 early during colorectal carcinogenesis. BMC Cancer. 2005;5:66. [PubMed] 7. Huang HF, Murphy TF, Shu P, Barton AB, Barton BE. Stable expression of constitutively-activated STAT3 in benign prostatic epithelial cells changes their phenotype to that resembling malignant cells. Mol. Cancer. 2005;4:2. [PubMed] 8. Carrick DM, Lai WS, Blackshear PJ. The tandem CCCH zinc finger protein tristetraprolin and its relevance to cytokine mRNA turnover and arthritis. Arthritis Res. Ther. 2004;6:248–264. [PubMed] 9. Zhao W, Liu M, Kirkwood KL. p38alpha stabilizes interleukin-6 mRNA via multiple AU-rich elements. J. Biol. Chem. 2007 Epub ahead of print. 10. Zhao C, Hamilton T. Introns regulate the raye of unstable mRNA decay. J. Biol. Chem. 2007;282:20230–20237. [PubMed] 11. Vasudevan S, Steitz JA. AU-rich-element-mediated upregulation of translation by FXR1 and Argonaute 2. Cell. 2007;128:1105–1118. [PubMed] 12. Fan J, Heller NM, Gorospe M, Atasoy U, Stellato C. The role of post-transcriptional regulation in chemokine gene expression in inflammation and allergy. Eur. Respir. J. 2005;26:933–947. [PubMed] 13. Wang G, Guo X, Floros J. Differences in the translation efficiency and mRNA stability mediated by 5'-UTR splice variants of human SP-A1 and SP-A2 genes. Am. J. Physiol. Lung Cell. Mol. Physiol. 2005;289:497–508. 14. Dean JL, Sarsfield SJ, Tsounakou E, Saklatvala J. p38 Mitogen-activated protein kinase stabilizes mRNAs that contain cyclooxygenase-2 and tumor necrosis factor AU-rich elements by inhibiting deadenylation. J. Biol. Chem. 2003;278:39470–39476. [PubMed] 15. Kontoyiannis D, Kotlyarov A, Carballo E, Alexopoulou L, Blackshear PJ, Gaestel M, Davis R, Flavell R, Kollias G. Interleukin-10 targets p38 MAPK to modulate ARE-dependent TNF mRNA translation and limit intestinal pathology. EMBO J. 2001;20:3760–3770. [PubMed] 16. Lai WS, Parker J, Grissom SF, Stumpo DJ, Blackshear PJ. Novel mRNA targets for tristetraprolin (TTP) identified by global analysis of stabilized transcripts in TTP-deficient fibroblasts. Mol. Cell. Biol. 2006;26:9196–9208. [PubMed] 17. Dean JL, Sul G, Clark AR, Saklatvala J. The involvement of AU-rich elementbinding proteins in p38 mitogen-activated protein kinase pathway-mediated mRNA stabilization, Cell. Signal. 2004;16:1113–1121. [PubMed] 18. Jing Q, Huang S, Guth S, Zarubin T, Motoyama A, Chen J, Di Padova F, Lin SC, Gram H, Han J. Involvement of microRNA in AU-rich element-mediated mRNA instability. Cell. 2005;120:623–634. [PubMed] 19. Stoecklin G, Stubbs T, Kedersha N, Wax S, Rigby WF, Blackwell TK, Anderson P. MK2-induced tristetrarolin: 14-3-3 complexes prevent stress granule association and ARE-mRNA decay. EMBO J. 2004;23:1313–1324. [PubMed] 20. Murchison EP, Hannon GJ. miRNAs on the move: miRNA biogenesis and the RNAi machinery. Curr. Opin. Cell Biol. 2004;16:223–229. [PubMed] 21. Kim K, Lee YS, Carthew RW. Conversion of pre-RISC to holo-RISC by Ago2 during assembly of RNAi complexes. RNA. 2007;13:22–29. [PubMed] 22. Miyoshi K, Tsukumo H, Nagami T, Siomi H, Siomi MC. Slicer function of Drosophila Argonautes and its involvement in RISC formation. Genes Dev. 2005;19:2837–2848. [PubMed] 23. Matranga C, Tomari Y, Shin C, Bartel DP, Zamore PD. Passenger-strnad cleavage facilitates assembly of siRNA into Ago2-containing RNAi enzye complexes. Cell. 2005;123:607–620. [PubMed] 24. Liu J, Valencia-Sanchez MA, Hannon GJ, Parker R. MicroRNA-dependent localization of targeted mRNAs to mammalian p-bodies. Nat. Cell. Biol. 2005;7:719–723. [PubMed] 25. Lykke-Andersen J, Wagner E. Recruitment and activation of mRNA decay enzymes by two ARE-mediated decay activation domains in the proteins TTP and BRF-1. Genes Dev. 2005;19:351–361. [PubMed] 26. Fenger-Gron M, Fillman C, Norrild B, Lykke-andersen J. Multiple processing body factors and the ARE binding protein TTP activate mRNA decapping. Mol. Cell. 2005;20:905–915. [PubMed] 27. Valencia Sanchez MA, Liu J, Hannon GJ, Parker R. Control of translation and mRNA degradation by miRNAs and siRNAs. Genes Dev. 2006;20:515–524. [PubMed] 28. Thermann R, Hentze MW. Drosophila miR2 induces pseudo-polysomes and inhibits translation initiation. Nature. 2007;447:875–878. [PubMed] 29. Kiriakidou M, Tan GS, Lamprinaki S, De Plnell-Saguer M, Nelson PT, Mourelatos Z. An mRNA M7G cap binding-like motif within human Ago2 represses translation. Cell. 2007;129:1141–1151. [PubMed] 30. Mathonnet G, Fabian MR, Svitkin YV, Parsyan A, Huck L, Murata T, Biffo S, Merrick WC, Darzynkiewicz E, Pillai RS, Fillipowicz W, Duchaine TF, Sonenberg N. MicroRNA inhibition of translation initiation in vitro by targeting the cap-binding complex eIF4F. Science. 2007;317:1764–1767. [PubMed] 31. Meister G, Landthaler M, Patkaniowska A, Dorsett Y, Teng G, Tuschl T. Human Argonaute2 mediates RNA cleavage targeted by miRNAs and siRNAs. Mol. Cell. 2004;15:185–197. [PubMed] 32. Liu X, Jiang F, Kalida S, Smith D, Liu Q. Dicer-2 and R2D2 coordinately bind siRNA to promote assembly of the siRISC complexes. RNA. 2006;12:1514–1520. [PubMed] 33. Orban TI, Izzauralde E. Decay of mRNAs targeted by RISC requires XRN1, the Ski complex, and the exosome. RNA. 2005;11:459–469. [PubMed] 34. Wu L, Fan J, Belasco JG. MicroRNAs direct rapid deadenylation of mRNA. Proc. Natl. Acad. Sci. USA. 2006;103:4034–4039. [PubMed] 35. Chan SP, Slack FJ. microRNA-mediated silencing inside p-bodies. RNA Biol. 2006;3:97–100. [PubMed] 36. Pauley KM, Eystathioy T, Jakymiw A, Hamel JC, Fritzler MJ, Chan EK. Formation of GW bodies is a consequence of microRNA genesis. EMBO Rep. 2006;7:904–910. [PubMed] 37. Eulalio A, Behl-Ansmant I, Schweizer D, Izaurralde E. P-body formation is a consequence, not the cause, of RNA-mediated gene silencing. Mol. Cell. Biol. 2007;27:3970–3981. [PubMed] 38. Kedersha N, Stoecklin G, Avodele M, Yacono P, Lykke-Andersen J, Fritzler MJ, Scheuner D, Kaufman RJ, Golan DE, Anderson P. Stress granules and processing bodies are dynamically linked sites of mRNP remodeling. J. Cell. Biol. 2005;169:871–884. [PubMed] 39. Yang WH, Yu JH, Gulick T, Bloch KD, Bloch DB. RNA-associated protein 55 (RAP55) localizes to mRNA processing bodies and stress granules. RNA. 2006;12:547–554. [PubMed] 40. Gilks N, Kedersha N, Avodeles M, Shen L, Stoecklin G, Dember LM, Anderson P. Stress granule assembly is mediated by prion-like aggregation of TIA-1. Mol. Biol. Cell. 2004;15:5383–5398. [PubMed] 41. Cramer P, Srebrow A, Kadener S, Werbajh S, de la Mata M, Melen G, Noquès G, Kornblihtt AR. Coordination between transcription and pre-mRNA processing. FEBS Lett. 2001;498:179–182. [PubMed] 42. Read RL, Norbury CJ. Roles for cytoplasmic polyadenylation in cell cycle regulation. J. Cell Biochem. 2002;87:258–265. [PubMed] 43. Ohrt T, Merkle D, Birkenfeld K, Echeverri CJ, Schwille P. In situ fluorescence analysis demonstrates active siRNA exclusion from the nucleus by Exportin 5. Nucleic Acids Res. 2006;34:1369–1380. [PubMed] |
PubMed related articles
Your browsing activity is empty. Activity recording is turned off. |
|||||||||||||
Biochimie. 2007 Jun-Jul; 89(6-7):761-9.
[Biochimie. 2007]Mol Cell Biol. 2007 Apr; 27(7):2423-30.
[Mol Cell Biol. 2007]Proc Natl Acad Sci U S A. 2001 Sep 25; 98(20):11668-73.
[Proc Natl Acad Sci U S A. 2001]World J Gastroenterol. 2007 Jun 14; 13(22):3056-62.
[World J Gastroenterol. 2007]Arthritis Res Ther. 2005; 7(1):29-37.
[Arthritis Res Ther. 2005]Cell. 2005 Mar 11; 120(5):623-34.
[Cell. 2005]Curr Opin Cell Biol. 2004 Jun; 16(3):223-9.
[Curr Opin Cell Biol. 2004]RNA. 2007 Jan; 13(1):22-9.
[RNA. 2007]Genes Dev. 2005 Dec 1; 19(23):2837-48.
[Genes Dev. 2005]Cell. 2005 Nov 18; 123(4):607-20.
[Cell. 2005]EMBO J. 2004 Mar 24; 23(6):1313-24.
[EMBO J. 2004]Cell. 2005 Mar 11; 120(5):623-34.
[Cell. 2005]Cell. 2005 Mar 11; 120(5):623-34.
[Cell. 2005]Nat Cell Biol. 2005 Jul; 7(7):719-23.
[Nat Cell Biol. 2005]Cell. 2005 Mar 11; 120(5):623-34.
[Cell. 2005]Nat Cell Biol. 2005 Jul; 7(7):719-23.
[Nat Cell Biol. 2005]Genes Dev. 2005 Feb 1; 19(3):351-61.
[Genes Dev. 2005]Mol Cell. 2005 Dec 22; 20(6):905-15.
[Mol Cell. 2005]Genes Dev. 2005 Feb 1; 19(3):351-61.
[Genes Dev. 2005]Genes Dev. 2006 Mar 1; 20(5):515-24.
[Genes Dev. 2006]Nature. 2007 Jun 14; 447(7146):875-8.
[Nature. 2007]Cell. 2007 Jun 15; 129(6):1141-51.
[Cell. 2007]Science. 2007 Sep 21; 317(5845):1764-7.
[Science. 2007]Mol Cell. 2004 Jul 23; 15(2):185-97.
[Mol Cell. 2004]J Biol Chem. 2003 Oct 10; 278(41):39470-6.
[J Biol Chem. 2003]EMBO J. 2001 Jul 16; 20(14):3760-70.
[EMBO J. 2001]Mol Cell Biol. 2006 Dec; 26(24):9196-208.
[Mol Cell Biol. 2006]Cell Signal. 2004 Oct; 16(10):1113-21.
[Cell Signal. 2004]EMBO J. 2004 Mar 24; 23(6):1313-24.
[EMBO J. 2004]RNA. 2005 Apr; 11(4):459-69.
[RNA. 2005]Proc Natl Acad Sci U S A. 2006 Mar 14; 103(11):4034-9.
[Proc Natl Acad Sci U S A. 2006]