• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of pnasPNASInfo for AuthorsSubscriptionsAboutThis Article
Proc Natl Acad Sci U S A. Feb 24, 2009; 106(8): 2688–2693.
Published online Feb 9, 2009. doi:  10.1073/pnas.0809793106
PMCID: PMC2637908
Genetics

Formation of new chromosomes as a virulence mechanism in yeast Candida glabrata

Abstract

In eukaryotes, the number and rough organization of chromosomes is well preserved within isolates of the same species. Novel chromosomes and loss of chromosomes are infrequent and usually associated with pathological events. Here, we analyzed 40 pathogenic isolates of a haploid and asexual yeast, Candida glabrata, for their genome structure and stability. This organism has recently become the second most prevalent yeast pathogen in humans. Although the gene sequences were well conserved among different strains, their chromosome structures differed drastically. The most frequent events reshaping chromosomes were translocations of chromosomal arms. However, also larger segmental duplications were frequent and occasionally we observed novel chromosomes. Apparently, this yeast can generate a new chromosome by duplication of chromosome segments carrying a centromere and subsequently adding novel telomeric ends. We show that the observed genome plasticity is connected with antifungal drug resistance and it is likely an advantage in the human body, where environmental conditions fluctuate a lot.

Keywords: chromosome rearrangements, evolution, genome stability, pathogenicity, segmental duplications

Gene content and chromosome organization differ from species to species. However, in most eukaryotes, including yeasts, the chromosome structure seems to be well preserved within the members of the same species, where regular sexual cycles help to preserve the genome organization. Genomic instability, including aneuploidy and changes in chromosome structure, is apparently very low and usually associated with pathological events, for example, in cancer development in mammals (1, 2). In sexual species, chromosomal rearrangements can lead to sexual isolation and subsequent speciation (3). Candida glabrata, which is the second most prevalent yeast pathogen in humans, has been traditionally classified as a haploid and asexual organism. The genome of one strain has been recently sequenced (4), and the genome structure now provides a tool for understanding C. glabrata virulence. Rapid changes in C. glabrata genomic organization have been reported in many clinical studies (57). In addition, isolates from one patient often exhibit 2 or 3 different karyotypes and during infection the chromosome pattern can change within a few days (6). So far the mechanisms behind the genome flexibility, adaptability, and virulence have been only poorly understood in this yeast.

Results and Discussion

Clinical Isolates of C. glabrata.

We analyzed 40 clinical isolates of C. glabrata obtained from Danish patients that were randomly selected from the Danish Statens Serum Institute collection (Table S1). All isolates were confirmed to belong to the C. glabrata species by sequencing of the D1/D2 domain of LSU rDNA and partial sequencing of mitochondrial SSU rDNA (Table S2). In addition, a more detailed phylogenetic relationship among isolates was resolved by sequencing and analysis of the sequences belonging to the fast evolving intergenic spacer (IGS) region between the nuclear genes CDH1 and ERP6 on chromosome A (see Fig. 2 and Table S2). The variability among strains for this sequence was <2%.

Fig. 2.
Chromosomal rearrangements and phylogenetic relationship among 41 C. glabrata clinical isolates. The tree is based on the IGS region between CAGL0A00605g and CAGL0A00627g on chromosome A, and the scale bars represent the number of base substitutions per ...

Karyotypes Vary A Lot.

The yeast chromosomes were separated by pulsed-field gel electrophoresis (PFGE). Although the strains, based on the 3 sequenced loci, show little sequence variability, their karyotypes were quite variable. The separated chromosomes were hybridized with 93 single-gene probes and 1 multigene probe corresponding to LSU rDNA (Table S3). In the initial mapping we used 2 unique probes per chromosome: 1 from the middle (labeled “m”) and 1 from near a chromosome end (labeled “er” for right or “el” for left) (Table S3 and Figs. S1 and S2). The karyotype of C. glabrata CBS 138, the sequenced strain, was used as a reference, and the expected position of the probes confirmed by hybridization. The largest chromosome size polymorphisms were associated with either translocations of chromosomal arms or interchromosomal duplications involving 12 of 13 chromosomes (Fig. S2). The two largest chromosomes, M and L, contain the rDNA locus and showed pronounced variability in size without any translocations detected. A copy number variation of the rDNA cluster or intrachromosomal segmental duplications/deletions could explain the observed polymorphism. In a few cases, the LSU rDNA probe also hybridized to smaller chromosomes, probably as a result of recent translocation events.

Molecular Mechanisms Behind Rearrangements.

Fifteen strains, covering chromosome changes of all 40 isolates, were selected for further mapping, using close to 100 gene probes (Table S3), to understand the organization of centromeres, telomeres, chromosome number, some segmental duplications, and translocations (Fig. 1 and Table S4). Seven reciprocal and 4 nonreciprocal translocations were observed, identifying all but CBS 138 chromosome C to be involved in these rearrangements. Note that if the translocation involved a chromosome end <20 kb, our approach could not classify it as reciprocal. Three of these nonreciprocal translocations were found in several strains, likely representing an early event during the evolutionary history of C. glabrata (Fig. 2). However, the origin of these translocation events is much younger than the chromosomal translocations reported for the Saccharomyces sensu stricto sister species (8).

Fig. 1.
Electrophoretic karyotypes and detailed mapping of selected C. glabrata clinical isolates. A minimum of 4 probes labeled with the same color were used per chromosome: 1 or 2 from the middle of the chromosome marked by squares and 2 from the near of the ...

Interchromosomal duplications represent a subclass of translocations. Five events, where a duplicated chromosomal segment was translocated to another chromosome or fused with another duplicated segment originating from a different chromosome, were observed. The duplicated segments ranged in size from 40 to 700 kb, which is similar to the previously observed Saccharomyces cerevisiae duplications generated during growth under laboratory conditions (9). However, one should note that the observed C. glabrata duplications were characterized in the “native” isolates.

The comparison of chromosomal rearrangements and phylogenetic relationships positioned the origins of the observed rearrangement events to specific branches of the phylogenetic tree (Fig. 2). Only in a single case did similar translocations not cluster together on the phylogenetic tree; the translocations between chromosome M and F in isolates Y645 and Y650 may represent independent events. It is noteworthy that even isolates having the identical intergenic sequences showed chromosomal reorganizations, suggesting a high frequency of chromosome remodeling events. For example, Y649, Y650, and Y666 belong to the same phylogenetic cluster but have undergone different chromosomal rearrangements (Fig. 2).

Novel Chromosomes.

Although in a majority of strains we found 13 chromosomes, 2 isolates, Y624 and Y663, exhibited 14 (Figs. 1 and and3).3). The novel chromosomes are small and seem to be composed of a large 120- to 200-kb segmental duplication that carries the centromere region. In Y624, the novel 120-kb chromosome contains a partial duplication of chromosome E with a subsequent deletion of 40–60 kb (Fig. 3A and Fig. S3A). In Y663, the novel 200-kb chromosome is a partial duplication of chromosome F (Fig. 3B and S3B). These new chromosomes appear to have acquired telomeres. An oligonucleotide mimicking the C. glabrata telomeric repeat gave a clear and specific Southern analysis signal with the 2 small chromosomes, indicating that the most terminal chromosome parts have a structure similar to other chromosomes (Fig. 4). As described in S. cerevisiae (10), when a segment containing an active centromere is duplicated, DNA ends can acquire telomeres by initiating a recombination-dependent DNA replication. Apparently, C. glabrata also possesses an effective mechanism to “add” viable chromosome ends.

Fig. 3.
Segmental duplications involved in the origin of novel chromosomes. (A) Y624 carries a duplication of chromosome E corresponding to a ≈120-kb fragment, which has subsequently deleted a 40- to 60-kb segment. (B) Y663 carries a duplication of chromosome ...
Fig. 4.
Hybridization of C. glabrata telomeric oligonucleotide (32-mer containing 2 16-bp telomere repeats) to separated chromosomes of 2 S. cerevisiae strains (CBS 439 and CBS 382) and 2 C. glabrata strains containing extra chromosomes (Y663 and Y624; see also ...

In addition to de novo chromosome generation, we observed chromosome fusions. For example, Y622 carries 2 chimeric chromosomes, a fusion of chromosomes D and E, and a fusion of parts of chromosome E and M (Fig. 3 C and D and Fig. S4A). The original chromosome E is missing from the isolate. A 50- to 80-kb region carrying the chromosome E centromere is deleted from the chromosome D + E chimera. However, these sequences are present in the chromosome E + M chimera. Because the segment of chromosome E in this chimera is larger than the segment deleted from the chromosome D + E chimera, it is likely that the chromosome E segment was duplicated and translocated to chromosome M before the chromosome E centromere was deleted from the chromosome D + E chimera. These structures of these novel fusion chromosomes show that it is important that the chimeric chromosomes contain a single active centromere so as not to destabilize chromosome partitioning during mitosis (11). Surprisingly, Y665 showed only 11 chromosomal bands (Fig. 1). However, the probes specific for the chromosome E and C genes hybridized to the loading well, indicating that these 2 chromosomes adopted a structure that does not allow them to move into the gel. Chromosome circularization, observed in other yeasts (12), could explain such a retarded movement in the electrophoretic field.

Another interesting aspect of the novel chromosomes are their breakage points (Table S5). C. glabrata does not posses the major repeat sequences, like Candida albicans, and transposons, like S. cerevisiae (4). However, several classes of mini- and mega-satellites have been found (13), and two of them coincide with the internal deletions of the Y624 minichromosome (Fig. 3A and Fig. S4C) and the Y622 fusion chromosome D+E (Fig. 3C and Fig. S4A). In addition, some of the observed breakpoints correlate with the regions, which were involved in the “historical” rearrangements taking place during the evolution of Hemiascomycetes (Figs. S3 and S4).

Our C. glabrata isolates with segmental aneuploidy and extra chromosomes did not exhibit any significant delay in cell proliferation when compared with other isolates. However, the genetic stability of the novel chromosomes was decreased. When C. glabrata Y624 and Y663, carrying extra chromosomes, were grown in liquid yeast extract/peptone/dextrose (YPD) medium for 70 generations, a number of the resulting cells lost the extra chromosome (Fig. 5). The loss was observed in 40% of the resulting progeny originating from Y624 and in 70% of the progeny derived from Y663. Is there any advantage then to keeping the duplicated regions and novel chromosomes?

Fig. 5.
Chromosome loss in Y624 and Y663 grown in YPD for 70 generations. (A) Karyotypes of the parental Y624 strain (line 1) and 6 randomly selected progeny cell lineages (lines 2–7). The position of the small chromosome is indicated by an arrow. (B ...

Duplicated Genes.

Aneuploidy by gain of small chromosomes or segmental aneuploidy were the most prevalent events on the left arm of chromosome E (chrEL, 3 events of 8) and the left arm of chromosome F (chrFL, 2 events of 8) (Fig. 1). Several genes on chrEL and chrFL potentially play a role in C. glabrata interaction with the host. Both duplicated segments of ChrFL encode a transporter of the ATP-binding cassette family (CAGL0F01419g) that is highly similar to S. cerevisiae AUS1. The small chromosome F encodes an ortholog of S. cerevisiae ABC transporter PDR5 (CAGL0F02717g) known in C. glabrata as PDH1. Its paralog, known as CDR1 (CAGL0M01760g), is present on chromosome M and was found duplicated in Y622. ABC transporters are implicated in pleiotropic drug resistance, and therefore the duplications could increase the level of drug resistance. Inspection of the chrEL arm showed that the 3 duplicated segments, in Y621, Y622, and Y624, encode the cluster of the S. cerevisiae YPS orthologs coding for extracellular glycosyl phosphatidylinositol-linked aspartyl proteases (CAGL0E01419g, CAGL0E01727g, CAGL0E01749g, CAGL0E01771g, CAGL0E01793g, CAGL0E01815g, CAGL0E01837g, CAGL0E01859g, CAGL0E01881g) and an ortholog of PLB3 encoding phospholipase B (CAGL0E02321g). The novel chromosome in Y624 has deleted a large part of this region but kept YPS2 (CAGL0E01419g) encoding a protease and PLB3 (CAGL0E02321g) encoding a phospholipase B. Secreted aspartyl proteases and a phospholipase B have been shown to play an important role in C. albicans virulence (1416). Recently, Kaur et al. (17) have shown that in C. glabrata the aspartyl protease-encoding genes are required for survival in macrophages.

In C. albicans an aneuploidy and a specific segmental aneuploidy, consisting of an isochromosome composed of 2 left arms of chromosome 5, have been found to occur in response to antifungal drug selection (18). Increases and decreases in drug resistance were strongly associated with gain and loss of this isochromosome that bears genes involved in azole drug resistance. In C. glabrata, the original isolate of Y663 carrying the minichromosome could tolerate 129.6 mg/L of fluconazole (Table S1). The Y663 clones, which lost the minichromosome (Fig. 5) could only tolerate 14.4 mg/L of fluconazole. In addition, when Y663 was grown in YPD in the presence of azole (at a concentration of 40 mg/L) for 70 generations, all resulting progeny still kept the extra minichromosomes, whereas in the absence of azole, the loss of minichromosome was observed in 70% of the progeny, indicating that the extra chromosome F confers a growth advantage in the presence of the drug. Apparently, the increase and decrease in gene dosage is a strategy used by C. glabrata to overcome environmental pressure, such as the presence of antifungal agents. The observed variable genome structure in the examined pathogenic isolates is therefore an adaptation on the different environmental conditions provided by each individual patient and his/her therapeutic regime.

C. glabrata Genome Is Very Dynamic.

It was recently reported by Torres et al. (19) that aneuploidy in S. cerevisiae is associated with a proliferative disadvantage. However, in C. glabrata, segmental duplications, chromosomal rearrangements, and extra chromosomes occur and persist at high frequency.

The high occurrence of certain chromosome events in C. glabrata, i.e., chromosome fusions, possible circularizations, nonreciprocal translocations, and novel chromosomes, suggests some sort of telomere dysfunction. So far, 3 telomeric proteins (Rap1, Sir3, Rif1) involved in transcriptional silencing have been analyzed in C. glabrata (20, 21). Our inspection of the sequenced C. glabrata genome shows that homologues of S. cerevisiae TEN1 and RIF2 are missing. The 2 proteins function in telomere end protection and length regulation (22, 23). Notably, deletion of RIF2 in S. cerevisiae leads to recombination-dependent, telomerase-independent telomere elongation (24).

The observed genome dynamics in C. glabrata has in general not been seen in other yeasts, except in some mutant backgrounds. However, in certain parasitic protozoa, such as Leishmania, a great variation in karyotypes has been reported, and in addition, aneuploidy, gene amplification, and deletion have been reported to be associated with changes in the drug resistance and virulence (25, 26). Elevated chromosome dynamics is not compatible with sexual lifestyle and meiosis but beneficial for adaptation to changing environmental conditions. Apparently, C. glabrata has to “sacrifice” its sexual nature to better tolerate the consequences of the enhanced genome mutability. The observed elevated adaptability potential should well be taken into account when developing future drugs against this increasingly invasive human pathogen.

Materials and Methods

Yeast Strains.

The isolates of C. glabrata originate from Danish patients, were collected at Danish hospitals from 1986 to 1999, and were initially identified by carbon assimilation tests (27). The clinical isolates used in this study were randomly selected from a collection of ≈250 isolates (see also ref. 28 and Table S1). The yeast strains were grown at 25 °C in YPD medium consisting of 1% yeast extract, 1% Bacto Peptone, and 2% glucose and in the minimal medium (SD) consisting of 0.17% YNB (yeast nitrogen base without amino acids and without ammonium sulfate), 0.5% ammonium sulfate, and 2% dextrose.

PCR and Sequencing of PCR Products.

Genomic DNA was extracted according to Philippsen et al. (29). Two regions, nuclear 26S ribosomal RNA coding D1/D2 domain and the mitochondrial small rRNA (SSU), were analyzed to confirm the species identity. The D1/D2 domain of the nuclear 26rDNA (LSU rDNA) was amplified with primers NL1 (5′P-GCA TAT CAA TAA GCG GAG GAA AAG-3′P) and NL4 (5′P-GGT CCG TGT TTC AAG ACG G-3′P). In the case of the mitochondrial small rRNA (SSU), YM5 (5′P-AAG AAT ATG ATG TTG GTT CAG A-3′P) and YM13 (5′P-ATT CTA CGG ATC CTT TAA ACC A-3′P) primers were used. Two primers (NL1, NL4) were used to sequence the D1/D2 domain and 2 primers (YM5, YM13) were used to sequence the mitochondrial SSU gene.

The IGS region between the nuclear CAGL0A00605g and CAGLA00627g genes on chromosome A was amplified with primers 00605 (5′P-C TCA CAA ATG GAT TCC TTA AAG AGT TCG-3′P) and 00627 (5′P-GT C ACC AGA GTT GGA GTA CAT GTA G-3′P), and the following conditions were applied: 94 °C initial denaturation for 3 min, then 35 cycles of 45 s at 94 °C, 1 min at 52 °C, and 1 min at 72 °C, followed by 72 °C for 5 min (1 cycle). The IGS region (CAGL0A00605g–CAGL0A00627g) comprising 690 bases was sequenced with primers 00605 and 00627 by MWG Biotech.

The DNA probes (see Fig. S1 and Table S3) for Southern blot analyses were obtained by PCR amplification using C. glabrata CBS 138 genomic DNA as a template. PCR conditions for all probes were 94 °C initial denaturation for 3 min, then 35 cycles of 45 s at 94 °C, 45 s at 56 °C, and 1 min at 72 °C, followed by 72 °C for 5 min (1 cycle).

Phylogenetic Relationships.

The sequences of the IGS region were aligned by using the ClustalX (1.83) program (30), and the relationship was inferred by using the neighbor-joining method (31). The phylogenetic tree was linearized assuming equal evolutionary rates in all lineages (32). The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed by using the Maximum Composite Likelihood method (33) and are in the units of the number of base substitutions per site. All positions containing gaps and missing data were eliminated from the dataset (Complete deletion option). There were a total of 671 positions in the final dataset. Phylogenetic analyses were constructed in MEGA4 (34).

PFGE and Southern Hybridization.

Chromosomes of all clinical isolates were separated by PFGE using a CHEF Mapper XA (Bio-Rad) and a 5-step program, as follows: step 1, 240-s pulse for 6 h; step 2, 160-s pulse for 13 h; step 3, 120-s pulse for 10 h; step 4, 90-s pulse for 10 h; and step 5, 60-s pulse for 3 h. The included angle was 60° and the voltage was 150 V (4.5 V/cm). Chromosomes and membranes were prepared as described (35). ORF DNA on the membrane was detected by Southern blot analysis using 32P-labeled PCR products as probes (GE Healthcare) (Fig. S1 and Table S3). After prehybridization, the membrane was hybridized (0.25 M Na2HPO4, 7% SDS, 1 mM EDTA) at 60 °C for 15 h and washed twice at room temperature for 5 min and once at 60 °C for 30 min with 2% SDS, 100 mM Na2HPO4. The membrane was stripped by using the hot SDS procedure protocol (GE Healthcare) and rehybridized more than once. Signals were detected by using Imaging Screen-K (35 × 43 cm; Bio-Rad) and Personal Molecular Imager FX (Bio-Rad). We used 93 single-gene probes and 1 multigene probe to detect and analyze the chromosomal rearrangements.

In the case of the telomeric probe, the 5′ end of the telomeric oligonucleotide sequence (32-mer containing 2 16-bp telomere repeats, TCTGGGTGCTGTGGGGTCTGGGTGCTGTGGGG) was labeled with [γ32P]-ATP with T4 polynucleotide kinase (Abgene). The membrane was prehybridized and hybridized at room temperature and washed at different temperature stringencies for 30 min.

Batch Culture Growth and Chromosome Stability.

All clinical isolates and C. glabrata CBS 138 strain were grown in 50 mL of YPD at 25 °C to OD600 = 10. Cultures were inoculated with 120 μL of overnight culture, and OD600 was measured every 3 h to determine the cell doubling time.

To study instability of extra chromosomes the strains Y624 and Y663 were first plated on YPD medium to isolate single colonies. The single colonies were analyzed by PFGE to confirm the aneuploidy. Three independent aneuploid single colonies from each isolate were inoculated in 2 mL of YPD and cultivated for 70 generations at 25 °C. Every day the cultures were reinoculated, and 2 μL of the old culture was transferred into new liquid YPD. Finally, 14 single colonies were checked by PFGE for loss of the extra chromosomes. To determine the doubling time, 3 single colonies with and 3 single colonies without extra chromosome were grown in 50 mL of SD medium at 25 °C to OD600 = 7. Cultures were inoculated with 120 μL of overnight culture, and OD600 was measured every 3 h.

Antifungal Drugs.

Fluconazole susceptibility was measured on RPMI medium 1640 agar plates (0.84% RPMI medium 1640 with l-glutamine and no bicarbonate, 3.45% Mops, 2% glucose, 1.5% bacto agar adjusted to pH 7 with 1 M NaOH) with 6 different concentrations of fluconazole (4.8, 14.4, 43.2, 129.6, 388.8, and 1166.4 mg/L). Appropriate 10 times dilutions of each cell suspension (containing 10, 102, and 103 cells) were plated on RPMI medium 1640 agar plates. The plates were incubated for 48 h at 37 °C.

In the case of strain Y663, the aneuploid single colonies were additionally grown for 70 generations in YPD + 40 mg/L fluconazole. Every day the cultures were reinoculated by transfer of 2 μL of the old culture into a new liquid YPD + fluconazole. Appropriate dilutions of each individual suspension were plated on YPD, and the 14 resulting single colonies were checked by PFGE for chromosome loss.

Supplementary Material

Supporting Information:

Acknowledgments.

We thank Linda Hellborg, Morten Kielland-Brandt, Torsten Nilsson-Tillgren, and Ken Wolfe for comments on the early version of this manuscript and Eimantas Astromskas for technical assistance in some experiments. This work was supported by the Swedish Research Council and the Fysiografen, Crafoord, Lindström, Lawski, and Sörensen Foundations.

Footnotes

The authors declare no conflict of interest.

This article is a PNAS Direct Submission.

This article contains supporting information online at www.pnas.org/cgi/content/full/0809793106/DCSupplemental.

References

1. Gauwerky CE, Croce CM. Chromosomal translocations in leukemia. Semin Cancer Biol. 1993;4:333–340. [PubMed]
2. Sharpless NE, et al. Impaired nonhomologous end-joining provokes soft tissue sarcomas harboring chromosomal translocations, amplifications, and deletions. Mol Cell. 2001;8:1187–1196. [PubMed]
3. Delneri D, et al. Engineering evolution to study speciation in yeasts. Nature. 2003;422:68–72. [PubMed]
4. Dujon B, et al. Genome evolution in yeasts. Nature. 2004;430:35–44. [PubMed]
5. Klempp-Selb B, Rimek D, Kappe R. Karyotyping of Candida albicans and Candida glabrata from patients with Candida sepsis. Mycoses. 2000;43:159–163. [PubMed]
6. Shin JH, et al. Changes in karyotype and azole susceptibility of sequential bloodstream isolates from patients with Candida glabrata candidemia. J Clin Microbiol. 2007;45:2385–2391. [PMC free article] [PubMed]
7. Lin CY, Chen YC, Lo HJ, Chen KW, Li SY. Assessment of Candida glabrata strain relatedness by pulsed-field gel electrophoresis and multilocus sequence typing. J Clin Microbiol. 2007;45:2452–2459. [PMC free article] [PubMed]
8. Fischer G, James SA, Roberts IN, Oliver SG, Louis EJ. Chromosomal evolution in Saccharomyces. Nature. 2000;405:451–454. [PubMed]
9. Koszul R, Caburet S, Dujon B, Fischer G. Eukaryotic genome evolution through the spontaneous duplication of large chromosomal segments. EMBO J. 2004;23:234–243. [PMC free article] [PubMed]
10. McEachern MJ, Haber JE. Break-induced replication and recombinational telomere elongation in yeast. Annu Rev Biochem. 2006;75:111–135. [PubMed]
11. McClintock B. The significance of responses of the genome to challenge. Science. 1984;226:792–801. [PubMed]
12. Naito T, Matsuura A, Ishikawa F. Circular chromosome formation in a fission yeast mutant defective in two ATM homologues. Nat Genet. 1998;20:203–206. [PubMed]
13. Thierry A, Bouchier C, Dujon B, Richard GF. Megasatellites: A peculiar class of giant minisatellites in genes involved in cell adhesion and pathogenicity in Candida glabrata. Nucleic Acids Res. 2008;36:5970–5982. [PMC free article] [PubMed]
14. Ghannoum MA. Potential role of phospholipases in virulence and fungal pathogenesis. Clin Microbiol Rev. 2000;13:122–143. [PMC free article] [PubMed]
15. Mukherjee PK, et al. Reintroduction of the PLB1 gene into Candida albicans restores virulence in vivo. Microbiology. 2001;147:2585–2597. [PubMed]
16. Naglik J, Albrecht A, Bader O, Hube B. Candida albicans proteinases and host/pathogen interactions. Cell Microbiol. 2004;6:915–926. [PubMed]
17. Kaur R, Ma B, Cormack BR. A family of glycosylphosphatidylinositol-linked aspartyl proteases is required for virulence of Candida glabrata. Proc Natl Acad Sci USA. 2007;104:7628–7633. [PMC free article] [PubMed]
18. Selmecki A, Forche A, Berman J. Aneuploidy and isochromosome formation in drug-resistant Candida albicans. Science. 2006;313:367–370. [PMC free article] [PubMed]
19. Torres EM, et al. Effects of aneuploidy on cellular physiology and cell division in haploid yeast. Science. 2007;317:916–924. [PubMed]
20. Haw R, Yarragudi AD, Uemura H. Isolation of a Candida glabrata homologue of RAP1, a regulator of transcription and telomere function in Saccharomyces cerevisiae. Yeast. 2001;18:1277–1284. [PubMed]
21. Castaño I, et al. Telomere length control and transcriptional regulation of subtelomeric adhesins in Candida glabrata. Mol Microbiol. 2005;55:1246–1258. [PubMed]
22. Wotton D, Shore D. A novel Rap1p-interacting factor, Rif2p, cooperates with Rif1p to regulate telomere length in Saccharomyces cerevisiae. Genes Dev. 1997;11:748–760. [PubMed]
23. Grandin N, Damon C, Charbonneau M. Ten1 functions in telomere end protection and length regulation in association with Stn1 and Cdc13. EMBO J. 2001;20:1173–1183. [PMC free article] [PubMed]
24. Teng SC, Chang J, McCowan B, Zakian VA. Telomerase-independent lengthening of yeast telomeres occurs by an abrupt Rad50p-dependent, Rif-inhibited recombinational process. Mol Cell. 2000;6:947–952. [PubMed]
25. Beverley SM. Gene amplification in Leishmania. Annu Rev Microbiol. 1991;45:417–444. [PubMed]
26. Ubeda JM, et al. Modulation of gene expression in drug-resistant Leishmania is associated with gene amplification, gene deletion, and chromosome aneuploidy. Genome Biol. 2008;9:R115. [PMC free article] [PubMed]
27. Wickerham LJ, Burton KA. Carbon assimilation tests for the classification of yeasts. J Bacteriol. 1948;56:363–371. [PMC free article] [PubMed]
28. Mentel M, Spírek M, Jørck-Ramberg D, Piskur J. Transfer of genetic material between pathogenic and food-borne yeasts. Appl Environ Microbiol. 2006;72:5122–5125. [PMC free article] [PubMed]
29. Philippsen P, Stotz A, Scherf C. DNA of Saccharomyces cerevisiae. Methods Enzymol. 1991;194:169–182. [PubMed]
30. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The CLUSTALX windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997;25:4876–4882. [PMC free article] [PubMed]
31. Saitou N, Nei M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol Biol Evol. 1987;4:406–425. [PubMed]
32. Takezaki N, Rzhetsky A, Nei M. Phylogenetic test of the molecular clock and linearized trees. Mol Biol Evol. 1995;12:823–833. [PubMed]
33. Tamura K, Nei M, Kumar S. Prospects for inferring very large phylogenies by using the neighbor-joining method. Proc Natl Acad Sci USA. 2004;101:11030–11035. [PMC free article] [PubMed]
34. Tamura K, Dudley J, Nei M, Kumar S. Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol. 2007;24:1596–1599. [PubMed]
35. Petersen RF, Nilsson-Tillgren T, Piskur J. Karyotypes of Saccharomyces sensu lato species. Int J Syst Bacteriol. 1999;49:1925–1931. [PubMed]

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...