• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
J Neurosci. Author manuscript; available in PMC May 12, 2009.
Published in final edited form as:
PMCID: PMC2610538
NIHMSID: NIHMS79793

Synapsins are late activity-induced genes regulated by birdsong

Abstract

The consolidation of long-lasting sensory memories requires the activation of gene expression programs in the brain. In spite of considerable knowledge about the early components of this response, little is known about late components (i.e. genes regulated 2-6 hr after stimulation) and the relationship between early and late genes. Birdsong represents one of the best natural behaviors to study sensory-induced gene expression in awake, freely behaving animals. Here we show that the expression of several isoforms of synapsins, a group of phosphoproteins thought to regulate the dynamics of synaptic vesicle storage and release, is induced by auditory stimulation with birdsong in the caudomedial nidopallium (NCM) of the zebra finch (Taeniopygia guttata) brain. This induction occurs mainly in excitatory (non-GABAergic) neurons and is modulated (suppressed) by early song-inducible proteins. We also show that ZENK, an early song-inducible transcription factor, interacts with the syn3 promoter in vivo, consistent with a direct regulatory effect and an emerging novel view of ZENK action. These results demonstrate that synapsins are a late component of the genomic response to neuronal activation and that their expression depends on a complex set of regulatory interactions between early and late regulated genes.

Keywords: immediate early genes, zenk, egr-1, zif268, ngfi-a, krox-24, neuronal plasticity, memory, auditory, synapse, cycloheximide, learning, zebra finch, songbird

INTRODUCTION

Brain activation triggers rapid transcriptional events thought to lead to long-lasting neuronal changes underlying long-term memories. This response comprises direct effectors that exert cellular actions independent of further RNA/protein synthesis, and inducible transcription factors (ITFs) that regulate late target genes (Curran and Morgan, 1985; Sheng and Greenberg, 1990; Nedivi et al., 1993; Lanahan and Worley, 1998; Clayton, 2000; Velho and Mello, 2007). Whereas early gene mapping has been instrumental to the analysis of brain activation by specific stimuli and behaviors (Chaudhuri, 1997; Mello, 2002), late effectors or targets are mostly unknown.

Synapsins are phosphoproteins associated with the synaptic vesicle membrane and thought to modulate different aspects of synaptic transmission (Greengard et al., 1993; Hilfiker et al., 1999). They are encoded by three genes (syn1-3) with multiple transcripts (Kao et al., 1999) that have been linked to schizophrenia and sporadic seizures (Chen et al., 2004; Lachman et al., 2005; Cavalleri et al., 2007), and their deletion leads to seizures (Gitler et al., 2004). Changes in syn1 expression occur in the retina after prolonged exposure to an enriched environment (Pinaud et al., 2002) and in the hippocampus during the induction of long-term potentiation or prolonged exposure to stressors (Morimoto et al., 1998a,b; Alfonso et al., 2006; Iwata et al., 2006). Importantly, syn1-2 promoters respond to EGR-1 (an ITF, a.k.a. ZENK) in cultured neuronal-like cells (Thiel et al., 1994; Petersohn et al., 1995). Thus, synapsins are candidate ITF targets, but their in vivo regulation in a manner dependent on early protein synthesis has not been shown.

Brain gene regulation by natural stimuli is well documented in songbirds. Stimulation with song, a learned vocal communication signal, induces ITFs (zenk, c-fos and c-jun) in high-order auditory areas (Mello et al., 1992; Mello and Clayton, 1994; Nastiuk et al., 1994; Bolhuis et al., 2000; Velho et al., 2005), particularly the caudomedial nidopallium (NCM). ITF induction reflects the acoustic properties and novelty of the stimulus, and is modulated by attention/arousal, age, and experience (Clayton, 2000; Mello, 2002; Mello et al., 2004; Velho and Mello, 2007). Repeated stimulation habituates NCM’s electrophysiological responses, an effect whose long-term maintenance depends on RNA and protein synthesis during distinct periods following song exposure (Chew et al., 1995). Moreover, MAP-kinase signaling in NCM is required for ITF expression (Cheng and Clayton, 2004; Velho et al., 2005) and the auditory memorization of tutor song (London and Clayton, 2008). Thus, song-induced gene expression is required for long-lasting neuronal changes and song auditory memories.

We hypothesized that synapsins might be late song-regulated genes. In support, we found that the expression of synapsins in zebra finch NCM increases upon song stimulation with a protracted time-course compared to early genes. This effect occurs primarily in excitatory neurons and is under a suppressive action by early song-induced proteins. We also show that ZENK protein binds in vivo to the syn3 promoter. Thus, synapsins are an integral late component of the brain’s response to stimulation, and a likely late effector of long-lasting changes in responsive neurons.

MATERIAL AND METHODS

Identification of zebra finch synapsins (see Fig. 1)

Fig 1
The syn2 and syn3 zebra finch homologues. A) Top, structure of the syn2 gene in the zebra finch; middle, syn2a and 2b transcripts. B) Top, structure of the syn3 gene in the zebra finch; middle, syn3 transcript. In A and B, numbers denote exons in the ...

PCR primers (forward: 5′ccgcacaccgactgggccaa3′; reverse: 5′gtcctcatgtargccttgtagt3′) were designed based on a conserved domain within synapsin 2 (syn2) mRNA sequences from several species in GenBank. Standard touch-down PCR reaction was performed with DNA from a zebra finch cDNA library (Holzenberger et al., 1997; Denisenko-Nehrbass et al., 2000) with annealing temperatures starting at 63°C minus 1 degree per cycle for 8 cycles, and 22 additional cycles at 55°C. The amplified product was excised from an agarose gel, eluted using Qiagen Gel Extraction Kit® (Qiagen Inc, Valencia, CA, USA), inserted into pPCRScript (Stratagene Inc., La Jolla, CA, USA) and used to transform bacterial cells following standard procedures. Insert identity was confirmed by sequencing and analysis using DNAStar software (DNAStar Inc., Madison, WI, USA). This amplified cDNA (GenBank accession # AY494948; Fig. 1A) does not discriminate between the two syn2 isoforms. We also identified a set of ESTs representing syn2 from an EST collection derived from a normalized zebra finch brain cDNA library (ESTIMA collaborative consortium; see http://titan.biotec.uiuc.edu/songbird). These ESTs comprised a contig (PTA_05.6657.C1.Contig7234) encompassing most of the shared sequences of syn2a and 2b.

A partial cDNA representing the zebra finch synapsin 2a isoform (Fig. 1A, syn2a) was PCR-amplified from the same cDNA library using a forward primer (5′gccggcatccccagcgtcaact3′) based on exon 4 sequence from the previously obtained syn2 clone (GenBank accession # AY494948) and a reverse primer (5′tgaaagctgtgggtgcgactgagg3′) based on a conserved domain within exon 13 from sequences of several species. The resulting amplification product was cloned and analyzed as above (GenBank accession # FJ004640). Additional syn2a clones obtained from ESTIMA comprise a contig (SB.929.C1.Contig 1194). One of the ESTs (GenBank accession # CK234869) within this contig contains a poly-A tail, indicating we have identified the complete 3′ UTR of this isoform. Partial ESTIMA cDNAs representing the zebra finch synapsin 2b (Fig. 1A, syn2b) isoform (GenBank accession #s CK301417 and CK303619) were also identified. The EST CK303619 contains a poly-A tail, indicating we have identified the complete syn2b 3′UTR.

PCR primers for syn3 (Fig. 1B) were designed based on conserved domains within synapsin 3 (syn3) mRNA sequences from several species available in GenBank for exons 2 and 13 (forward330: 5′ccaggggaagaaggtgaatg3′, reverse1728: 5′cagaaaacaggctagcaaatgat3′). PCR amplification and cloning of the resulting fragment (GenBank accession # FJ004639) were performed as described above for syn2. Three additional cDNA clones representing mostly the 5′UTR and 3′UTR regions of the zebra finch syn3 homologue (GenBank accession #s DV949224, CK305874 and CK305733) were also identified in ESTIMA. Importantly, clone CK305733 had a poly-A tail, confirming this region as the likely 3′ end of the transcript.

We used the sequences derived from the PCR-amplified clones and from ESTIMA clones to assemble full-length transcript sequences for all 3 synapsin isoforms. These sequences were then used for blast searches of the zebra finch genomic trace archives, which were then assembled to reconstruct the complete syn2 and syn3 genes. We also amplified a syn2a-specific fragment (grey bar over exons 12 and 13 on Fig. 1A, syn2a) using a forward primer based on the 3′ end of the shared region of syn2a and b (grey portion of exon 11 on Fig. 1A, syn2 gene; 5′agccaaacaaaatcccacctcag3′) and a reverse primer based on exon 13 (5′ggactgcgacttgaaagctgtg3′), which is present in the syn2a isoform only. Sequence from one EST (GenBank’s CK301417) was used to PCR-amplify a 200 bp syn2b-specific fragment (grey bar over exon 11 on Fig. 1A, syn2b). These isoform-specific fragments were cloned into PCRScript and used to generate isoform-specific riboprobes for Northern and in situ hybridization. GenBank’s clone AY494948 was used to generate a non-discriminating syn2 probe. For syn3, we used riboprobes derived from GenBank’s clone DV949224 for Northern analysis and from clones DV949224 and FJ004639 for in situs (grey bars on Fig. 1B, syn3); probes from both clones gave essentially the same results. We note that both clones are very distant from the 3′UTR end of clone CK305733, which has a partial overlap with Fbox7; thus, our syn3 riboprobes did not overlap with Fbox7.

Probe labeling

Riboprobes were used for in situ hybridization and Northern blot analyses. Plasmid DNA was isolated using Qiagen Miniprep Kit (Qiagen Inc. Valencia, CA, USA), linearized with the appropriate restriction enzymes, and purified with Qiagen PCR Purification Kit (Qiagen Inc., Valencia, CA, USA). Sense and antisense 33P-labeled riboprobes for all genes analyzed in this study were synthesized as described elsewhere (Mello et al., 1997). The hat2 probe was derived from the previously described canary homologue (George and Clayton, 1992). For digoxigenin-(DIG-)labeled riboprobes, we added 1.0 μl of DIG labeling mix (Roche Diagnostics Corp., Mannheim, Germany) to a 10 μl reaction containing 1 μg of linear plasmid DNA, 10 μg of BSA, 10 mM of DTT, 20 units of RNAse inhibitor, 8-10 units of RNA polymerase, and 2.0 μl of a transcription buffer consisting of 50 mM DTT, 250 mM Tris-HCl pH 7.4, 30 mM MgCl2, 50 mM NaCl, and 10 mM spermidine in DEPC-treated water; otherwise, we followed Mello et al. (1997). All riboprobes were purified in Sephadex G-50 columns and analyzed using a liquid scintillation counter or by visual inspection of a denaturing formaldehyde-agarose gel.

Northern blot analysis

Total RNA from adult zebra finch brain was extracted using the Trizol method (Life Technologies Inc., Rockville, MD, USA) and quantified by spectrophotometry. Ten μg of total RNA were separated by electrophoresis in 1% MOPS/formaldehyde agarose gel, and transferred with 10X SCC to nylon membranes (Hybond-N+ Amersham Pharmacia Biotech Inc., Piscataway, NJ, USA) as described in detail elsewhere (Mello et al., 1997). The membranes were incubated overnight in hybridization solution containing 33P-labeled antisense riboprobes for syn2, syn2a, syn2b or syn3 (106 cpm/ml), followed by washes at 65°C and exposure to a KODAK storage phosphorscreen (Molecular Dynamics Inc., Sunnyvale, CA, USA), which was read by a phosphorimager (Typhoon 8600, Molecular Dynamics Inc., Sunnyvale, CA, USA).

Birds and song stimulation

All birds in this study were adult zebra finches (Taeniopygia guttata) from our own breeding colony or obtained from local breeders. For song stimulation, females were first isolated overnight (16-20 hr) in sound-attenuated chambers (≈76 × 31 × 28 cm) under a 12:12 light:dark cycle (same as the aviary; lights on at 7:00 AM). On the following day, birds were exposed to a playback of a recorded stimulus consisting of a medley of three representative non-familiar conspecific songs presented in blocks of 15 seconds followed by a 45-second silent interval. For ISH (see below), birds were either exposed to this stimulus for 30 min and killed after varying survival intervals (Fig. 3A), or exposed to different stimulus durations followed by immediate sacrifice (Fig. 4A). For Western blots, birds were stimulated for 30 min and sacrificed at 6 hr after stimulus onset. For ChIP assays, birds were stimulated for 30 min and sacrificed 2 hr after stimulus onset. All stimuli were presented at comparable intensities (average 70 dB mean SPL at 35 cm from the speaker). Females were used in all quantitative song stimulation experiments to avoid the confound of singing behavior in males; controls consisted of birds that were not stimulated. We also analyzed the general brain expression of synapsins in a separate set of adult males (n=3). All procedures involving birds were approved by OHSU’s Institutional Animal Care Use Committee (IACUC) and are in accordance with NIH guidelines.

Fig 3
Song regulation of the expression of synapsins in NCM. A) Schematic representation of the experimental design, arrows indicate time of sacrifice. B) Left: camera lucida drawing of caudal portion of a parasagittal brain section at the level of NCM (~800 ...
Fig 4
Expression of synapsins in birds exposed to increasing periods of stimulation. A) Schematic representation of the experimental design, arrows indicate time of sacrifice. B-C) Fold-induction values of syn2a (B) and syn3 (C) in the NCM of birds stimulated ...

Stereotaxic microinjections of cycloheximide

We performed intracerebral injections in awake restrained birds essentially as described in Velho et al. (2005), with some modifications. Briefly, the birds were first anesthetized with 50 μg/g of sodium pentobarbital, and placed in a stereotaxic apparatus containing a bird skull pin slide adapter (MyNeuroLab, Saint Louis, MO, USA). A metal fixation pin was affixed to the skull using Tylok-Plus dental cement (Dentsply International Inc., Milford, DE, USA), and a window was partially opened by removal of the superficial layer of bone over NCM. Birds were allowed to recover for at least 48 hr. The birds were then restrained within a plastic tube and fixed to the stereotaxic apparatus by inserting the implanted metal pin into the pin adapter. The remaining layer of bone was removed, a glass pipette lowered into NCM (AP: 0.5 mm; ML: 0.65 mm; DV: 1.2 and 1.6 mm), and 2 μg/μl of cycloheximide (CYC), a dose previously proven to effectively block protein expression in NCM (Chew et al., 1995), were injected (50 nl/site over 2 min) into one hemisphere and vehicle (VEH) in the contralateral hemisphere, using a microinjector (Narishige International Inc., Long Island, NY, USA). To facilitate the identification of the injection site, the pipettes were coated with fluorescent latex beads (Lumafluor Corp., Naples, FL, USA.).

Injected birds were divided into two sets: song stimulated and unstimulated controls. Song-stimulated birds were injected with CYC into one hemisphere and VEH into the other, and then stimulated with song and killed at 6 hr after stimulation onset. Unstimulated controls were also injected CYC and VEH into the NCMs but did not receive any auditory stimulation. The drugs assigned to each hemisphere were alternated across birds.

Acclimation sessions

In order to minimize procedural induction of activity-dependent genes in the brain for the brain microinjections, the birds were subjected to several acclimation sessions after recovering from the pin implant surgery for at least 24 hr. Each session consisted of gently restraining a bird, fixing it through the attached pin to the adapter in the stereotaxic apparatus, maintaining it in the apparatus for 10 min (in the presence of a researcher), and returning it to the isolation box. Typically we performed 4 such sessions (once every 2 hr) on the day preceding the brain microinjections and one last session on the day of the injections. In addition, the birds were kept in acoustic attenuation boxes at all times after the pin implants, except during the acclimation sessions and during microinjections. Both the acclimation and microinjections were performed in a sound-attenuated room with minimal sound exposure.

Tissue preparation

For in situ hybridization and Western blots, birds were sacrificed by decapitation. Their brains were quickly dissected from the skull, frozen in Tissue-tek (Sakura Finetek Inc., Torrance, CA, U.S.A) in a dry ice/isopropanol bath, and stored at −80°C. Parasagittal 10 μm brain sections were cut on a cryostat, thaw-mounted onto slides, and stored at −80°C until use. For ChIP assays, sound-stimulated birds (n=3) were killed with an overdose of Nembutal and perfused transcardially with freshly prepared 1% paraformaldehyde in 0.1 M phosphate buffer, pH 7.4. The brains were then removed from the skull and the caudomedial telencephalic auditory lobules (including the caudomedial nidopallium and mesopallium - NCM and CMM - and medial field L2a) dissected and frozen.

Radioactive in situ hybridization (ISH)

ISH was performed using 33P-labelled sense and antisense riboprobes followed by exposure to a KODAK phosphorimager screen, autoradiography with X-ray film (Kodak’s BioMax MS), or emulsion autoradiography and Nissl counterstaining. The hybridizations and washes for all probes analyzed were performed at 65°C, using essentially the same procedure as previously described (Mello et al., 1997). Syn3 ISH sections were treated with RNAse A (1 μg/mL) as previously described (Mello et al., 1997).

Double ISH and Fluorescent in situ hybridization (FISH)

We used a double-labeling procedure combining ISH (for syn2a) and FISH (for syn2b or for the GABAergic marker gad65), followed by nuclear counterstaining (Hoechst). We followed the double-labeling procedures described in Velho et al. (2005) and Jeong et al. (2005).

Densitometry

Phosphorimager files were quantified using NIH’s Image software. The slide background was subtracted from optical density (O.D.) measurements taken over specific brain regions, and the resulting values averaged for two adjacent sections. For normalization, all densitometric values were divided by the average values from unstimulated controls. To examine the effect of post-stimulation survival time, stimulus duration and drug treatment, we used ANOVA followed by Fisher’s PSDL posthoc tests for pair-wise comparisons, and a probability level of <0.05 for significance.

Cell counts

For quantitative analysis of our double ISH and FISH experiment, we used Neurolucida software (MicroBrightField Inc., Colchester, VT) and estimated the number of labeled cells in specific areas of brain sections through lateral NCM (~800 μm from the midline) of song-stimulated birds and unstimulated controls (n=3-6 per group). We first placed a counting square of 200 × 200 μm over dorsal or ventral NCM, equidistant from NCM’s rostral and the caudal boundaries (L2a and the ventricle, respectively), or over the hippocampus. We then centered a counting circle (12 μm diameter) over each cell nucleus, identified based on the nuclear (Hoechst) counterstaining and excluding cells with clearly non-neuronal staining (small, homogeneously and strongly labeled nuclei). We next counted the number of emulsion autoradiography grains per labeled cell. We note that the typical nuclear diameter of most cells counted was in the 6-10 μm range and that the diameter of the counting circle was determined to be inclusive of the majority of grains associated with the cells. Cells with grain counts of at least 2 standard deviations above background levels (measured over the glass or over the neuropil between labeled somata — see Fig. 4 for example) were considered syn2a-positive. Finally, we examined the mapped field under the appropriate fluorescence filter to determine how many syn2a-positive (emulsion autoradiography signal) cells were also labeled for syn2b or gad65 (fluorescence signal). We did not observe evidence of regional differences in the number of cells in NCM, thus dorsal and ventral measurements were averaged.

Western blots

The auditory lobules of song-stimulated or unstimulated control birds (2 adult females per group) were separately homogenized in lysis buffer (25 mM Tris-HCl, pH 7.5, 1 mM EDTA, 10 mM DTT, and 0.5% Triton X-100) plus 1X proteinase inhibitor (Calbiochem, NJ) and 30 μg of protein per sample were separated by SDS-PAGE and transferred to nylon membranes (Novax Inc., San Diego, CA, USA). The membranes were then incubated for 1 hr in blocking buffer (BB, consisting of 5% dry milk in TBST: 25 mM Tris, pH 7.4, 3.0 mM KCl, 140 mM NaCl and 0.05% Tween 20), incubated overnight at 4°C with a mouse anti-synapsin 2 antibody raised against amino acid 348-449 of the human Syn2 (1:500 dilution in BB, Novus Biologicals Inc., CO, USA) or a mouse anti-actin antibody (1:500 dilution, Chemicon Inc.), washed 3 × 10 min in TBST buffer, incubated for 2 hr with a peroxidase conjugated goat anti-mouse IgG antibody (1:10000 dilution in BB, Kirkegaard & Perry Laboratories, Inc.), and washed 3 × 10 min in TBST buffer. Incubations and washes were all performed at room temperature. Protein expression was detected by chemiluminescence (Pierce Biotechnology; IL) autoradiography. The resulting autoradiograms were analyzed by densitometry (integrated optical density measurements using ImageJ) and results expressed as ratios of values obtained for individual bands from song-stimulated birds divided by values obtained from unstimulated controls.

Promoter Analysis

The syn3 promoter was assembled by sequentially retrieving and assembling sequences from the zebra finch genomic trace archives (NCBI, Genomic Biology) using Seqman software (DNAStar Inc., WI, USA). We reconstructed a genomic region of about 2.0 kB corresponding to the 5′ end of the syn3 transcript and the upstream promoter region. The presence of putative transcription factor binding sites was examined based on matrix analysis (Transfac 8.0) using MatInspector software (Genomatix, Denmark). A comparable region could not be retrieved from the trace archives for the syn2 gene.

Chromatin immunoprecipitation assay (ChIP)

The microdissected auditory lobules (n=3 song stimulated adult females) were processed using a commercial ChIP kit (Upstate, Temecula, CA), following manufacturer’s instructions. Briefly, the tissue samples (typically 20 mg wet weight per bird) were homogenized in SDS lysis buffer (at a 10-to-1 buffer-to-tissue volume ratio) containing a protease inhibitor mix (Complete Mini mix at 1X concentration; Roche Diagnostics, USA) with a microtube pestle, and incubated on ice for 10 min. Chromatin shearing was then performed by sonicating the samples in 6 × 15 sec bursts at 35% power, a protocol we previously determined to result in ~1-2 kB average DNA size in our samples. The homogenates were spun at 17000 g for 10 min and the supernatants were separated, diluted further and pre-cleared by agitation for 30 min with the proteinA/agarose/salmon sperm DNA slurry. The samples were then immunoprecipitated overnight with 10 μg of goat anti-Egr-1 (ZENK) sc-189 or mouse anti-parvalbumin antibodies (Santa Cruz Biotechnology, Inc, CA), followed by incubation for 1 hr with the proteinA/agarose/salmon sperm DNA slurry. After washes, the immunoprecipitated chromatin was eluted, decrosslinked by incubation in 0.2 M NaCl for 4 hr, and treated with proteinase K for 1 hr at 45°C. The resulting DNA samples were then isolated using QIAGEN’s PCR purification kit (QIAGEN, Inc, CA). All steps up to the elution were performed at 4°C; further details were performed according to the manufacturer’s recommendations. The immunoprecipitation was verified by spectrophotometric analysis of the resulting DNA product. Further analysis was carried out by performing PCR amplification with primers for the promoter regions of syn3 (forward: 5′ggaggaagggcagaaaagtgtcat3′, reverse: 5′gtgggaagagaatcaaagaaat3′, corresponding to a 523 bp fragment between positions −508 and +15 of the promoter sequence relative to the putative transcription start site) and eno2 (forward: 5′ggtctccctcccctgctgtctgt3′; reverse: 5′ttcccctttcactgccctcttctg3′, corresponding to a 498 fragment within the promoter region). ChIP specificity was determined by comparing the products of DNA precipitated with the different antibodies used.

RESULTS

Identification of zebra finch synapsins

The zebra finch syn2 homologue contains 13 exons and a timp4 gene nested between exons 5 and 6 (Fig 1A), thus resembling closely the structure of its mammalian counterparts. We have identified transcripts corresponding to two isoforms, syn2a and syn2b (Fig. 1A). Similarly to mammals, these transcripts are likely derived through a combination of alternative termination and differential splicing from a common gene. The syn2a mRNA includes all 13 exons, whereas syn2b contains a longer exon 11 but lacks exons 12 and 13 (Fig 1A). In spite of the longer coding sequence of syn2a, the 3’UTR is much shorter in syn2a than in syn2b. Thus, the predicted sizes of these transcripts are ~2.9 and 3.9 Kb respectively. The predicted aminoacid residue composition in comparison with chicken, human and rat homologues respectively shows 92.7, 76.1 and 75.1% identity for syn2a (Fig. S1A), and 97.1, 83, and 81.5% identity for syn2b (Fig. S1A-B). Interestingly, syn2a shows low conservation in the proline-rich domain (between residues 464 and 526 on Fig. S1A).

The zebra finch syn3 gene also had a conserved organization compared to mammals, consisting of 13 exons and including a timp3 gene nested between exons 5 and 6 (Fig. 1B). This gene encodes a long transcript (predicted at ~8.8 kb) with a very long (~6 kb) 3′UTR (Fig. 1B). Interestingly, ESTs representing Fbox7, a gene located in the opposite orientation in the genomic sequence of both zebra finch and chicken, show partial overlap with the 3′ end of clone CK305733, suggesting that a small domain may be shared between these two transcripts (not shown). The predicted Syn3a protein shows 93.1, 78.6, and 77.9% identity with the chicken (based on genomic sequence), human and rat homologues respectively (Fig. S2).

Northern blot analysis using a riboprobe that targets the common region of the syn2a and 2b isoforms (clone AY494948) revealed two transcripts (of ~2.6 and ~3.6 Kb), with higher expression of the longer one (Fig 1C). The syn2a- and syn2b-specific probes, however, recognized respectively the shorter and longer transcripts, consistent with the sizes predicted from their sequences (Fig. 1A). Northern analysis for syn3 revealed a single transcript of ~8.8 kb (Fig. 1D), consistent with the prediction of a single large transcript.

Comparative analysis between avian (zebra finch and chicken) and mammalian genomic sequences revealed high conservation in the regions adjacent to syn2 and 3, including large sinteny groups for both genes (not shown), supporting the conclusion that we have identified their true homologues. In contrast, despite extensive searches of chicken and zebra finch genomic sequences with coding and non-coding sequences from several species, we did not obtain any significant hits for syn1, strongly suggesting that birds may lack this gene (Velho and Mello, in preparation). In support of this possibility, the syn1 gene is typically around 40-50 kB in other species, and it seems highly unlikely that such a large fragment is missing from the completed genomic sequences of two different organisms. Furthermore, a group of genes adjacent to the syn1 locus and comprising a sintenyc group in mammals and lizards also appear to be missing in avian genomes. For example, searches for the timp1 and a-raf1 genes, which are respectively nested within and in close proximity to the syn1 locus in all other vertebrates studied to date, had no hits in both avian genomes available.

Expression of synapsins in the zebra finch brain

We next examined the regional and cellular expression of synapsins in the brain of adult zebra finches, the first such analysis in an avian species. We observed broad distributions for syn2a and 2b (Fig 2B and C, respectively), including pallial areas (nidopallium, mesopallium and hyperpallium)and granule cell layer of the cerebellum, but much lower expression in the striatum and arcopallium, as well as in the auditory thalamo-recipient zone field L2a and the magnocellular nucleus of the lateral nidopallium (LMAN) compared to the surrounds (Fig 2B and C, bottom panels). The two isoforms had similar distributions, but syn2b expression was higher than syn2a, consistent with the Northern analysis. The syn3 transcript had lower expression than syn2, and also had a broad but largely uniform distribution (Fig 2). Sense probes for all transcripts did not yield detectable hybridization.

Fig 2
Expression of synapsins in the zebra finch brain. A) Camera lucida drawings of parasagittal brain sections at the level of NCM (top panel, ~800 μm from the midline) and at the level of the song control system (bottom panel, ~1800 ...

Cellular analysis in NCM demonstrated syn2a and 2b expression in cells with neuronal-like features such as large nucleus, clear nucleolus and Nissl substance (Fig 2E-G, arrows), whereas smaller cells with dark, homogeneously staining nuclei that represent glial and blood cells were clearly negative (Fig. 2E, arrowheads), as were also the cells in the ventricular ependyma and in the subventricular zone (Fig 2G, arrowheads). Double-labeling ISH revealed that the majority of cells (~67%; n=3 females) co-express syn2a and 2b (Fig 2H, white arrows), but single-labeled cells could also be seen (Fig. 2H, red arrow). For syn3, we also observed both positive and negative neuronal cells (Fig 2I, respectively small and large arrows), whereas glial-like cells were clearly negative (Fig. 2I, arrowheads).

Song stimulation increases synapsin expression in NCM

To determine whether synapsins are regulated by song, we examined their expression in parasagittal sections through medial and lateral NCM (~0.4 and 0.8 mm from the midline) from birds stimulated for 30 min and sacrificed at different post-stimulation times (Fig. 3A), using isoform-specific probes. Birds stimulated with conspecific song showed higher expression of synapsins when compared to unstimulated controls (Fig. 3B, representative example of syn2a in lateral NCM). Quantitative autoradiography showed that syn2a is significantly induced in lateral NCM (ANOVA, p<0.01; n=4-6 per group) at 2, 4, 6 and 8 hr after the start of a 30-min song stimulation period compared to unstimulated controls (Fig 3C, right; Fisher’s PLSD, p<0.05, <0.01, <0.01, and <0.001, respectively). In contrast, we observed considerable variability that did not reach significance in medial NCM (Fig 3C, left; ANOVA p=0.50). Similarly, syn2b was significantly induced in lateral NCM (ANOVA p<0.01) at 2, 4, 6, and 8 hr after the start of the song stimulation compared to controls (Fig. 3D right; Fisher’s PLSD, p<0.01, <0.05, <0.001 and <0.05, respectively) but not in medial NCM (Fig 3D, left; ANOVA p=0.11). The expression of syn3 also increased in lateral NCM (Fig 3E, right; ANOVA p<0.05), but was significantly higher than controls only at 6 and 8 hr after stimulation onset (Fisher’s PLSD, p<0.05 and <001, respectively); a similar trend in medial NCM did not reach significance (Fig 3E, left; ANOVA p=0.06). In sum, song induces the expression of synapsins primarily in lateral NCM, with a protracted time course in comparison with early inducible genes.

We also examined birds killed immediately after hearing song for various time durations compared to unstimulated controls (Fig. 4A). We observed significant increases in syn2a expression in lateral NCM (Fig 4B, right; ANOVA p<0.01, n=4-6 per group) after stimulation for 0.5, 2, 4, 6 and 8 hr (Fisher’s PSLD, p<0.05, p<0.05, p<0.05, p<0.001, and p<0.018, respectively) but again not in medial NCM (Fig. 4B left; ANOVA p=0.76). These results resembled closely those of the previous experiment where all birds were stimulated for the same duration (0.5 hr; Fig. 3C), suggesting that stimulus duration has little or no effect on syn2a expression levels. Indeed, we detected no significant effect of stimulation protocol (fixed vs. variable stimulus duration) when the data from both experiments were analyzed together (ANOVA, p=0.63). Thus, syn2a expression levels in lateral NCM are primarily determined by the first 30 min of song stimulation. In contrast, analysis of these birds showed no significant induction of syn2b mRNA in either medial or lateral NCM (Fig. 4C; ANOVA p=0.65 and p=0.15 respectively), although a trend to higher levels could be observed in lateral NCM of birds that heard song for 4 hours. Finally, syn3 expression did not significantly increase or show such a trend after prolonged stimulation periods when compared to unstimulated controls in either medial or lateral NCM (Fig. 4D; ANOVA p=0.76 and p=0.79 respectively). This observation indicated a difference in syn3 regulation related to the stimulation protocol. Indeed, we observed an effect of stimulation protocol (fixed vs. variable stimulus duration) when the syn3 data for lateral NCM from both experiments (compare Figs. Figs.3E3E right and and4D4D right) were analyzed together (ANOVA, p<0.05). Thus, while syn3 is clearly induced with a protracted time course by a short (30 min) stimulation period, further stimulation appears to suppress the initial inductive effect of song. Finally, in accordance to the known lack of hat2 induction by song, we observed no evidence of regulation of that transcript in either the time course or differential duration experiments (not shown).

Song induces synapsin changes in a specific cell population

To examine the neurochemical identity of the cells in which synapsins are induced, we performed double ISH for syn2a and the GABAergic marker gad65 in sections from birds killed at different times after the start of a 30-min stimulation period (n=4-6 per group). We first determined that there was a significant effect of song stimulation on the number of syn2a-positive cells in NCM (ANOVA, p< 0.05). We then found that the number of syn2a-positive cells that were also gad65-positive (presumably GABAergic neurons) did not change significantly with stimulation (Fig 5B; ANOVA, p=0.53). In contrast, the number of syn2a-positive cells that were gad65-negative increased significantly in song-stimulated birds compared to unstimulated controls (Fig 5A; ANOVA, p<0.01) at 6 hr (Fisher’s PLSD, p<0.01); we have repeated this analysis (double in situ hybridization followed by cell counts of emulsion autoradiography sections) three times and obtained essentially the same results. Thus, the increased synapsin expression in NCM appears to occur predominantly in gad65-negative cells. A molecular probe for excitatory neurons is currently unavailable in songbirds. We note, however, that gad65-positive cells likely account for the majority of GABAergic cells in NCM (Pinaud et al 2004; Pinaud et al 2006; Pinaud et al 2008b) and that gad67, the other major GABAergic cell marker, usually represents a small population that largely overlaps with gad65 expression. In addition, glycinergic transmission might occur in NCM, but the most likely source of this transmitter is in the brainstem, as occurs in other vertebrates. Thus, we consider it reasonable to assume that the gad65-negative cell population showing increased synapsin expression is composed primarily of excitatory (glutamatergic) neurons. The number of syn2a-expressing neurons, regardless of their neurochemical identity, did not change in the adjacent hippocampus (Fig 5C and D; ANOVA p=0.89 and 0.21, respectively), indicating a regional specificity for the effect observed in NCM.

Fig 5
Changes in syn2a-expressing cells after song stimulation. A-B) The number of syn2a-expressing in NCM cells that were gad65-negative (A) or — positive (B) counted in birds killed after several intervals after the onset of a 30-min song stimulation ...

Synapsin proteins are induced by song

To investigate whether synapsin proteins are regulated by song stimulation, we examined Syn2 expression on a Western blot of microdissected auditory lobules with an anti-synapsin 2 antibody. We detected two bands (~70 and ~58 kDa), likely representing the polypeptides encoded by syn2a and syn2b respectively. A comparison of unstimulated and song-stimulated birds showed an apparent increase in both isoforms in the samples from song-stimulated birds, indicating an increase in synapsin proteins (Fig. 6A) and consistent with our findings at the mRNA level. Such a marked effect was not apparent for actin on the same blots (Fig 6B), arguing against a systematic difference in gel loading. A densitometric analysis of our duplicate samples revealed an average 1.98-fold difference for Syn2a and 1.55-fold difference for Syn2b between samples from song-stimulated birds over unstimulated controls, whereas there was only a 1.18-fold group difference for actin, providing support for our qualitative observations. We note that a recent study utilizing a proteomics approach (Pinaud et al., 2008a) also found evidence of song regulation of one synapsin peptide, which we interpret to have been Syn2a, based on molecular weight.

Fig 6
Song-induced changes in Syn2 proteins. Western blot of protein extracts from dissected auditory lobules from unstimulated controls and birds stimulated for 30 min and sacrificed 6 hr after stimulus onset, immunostained using anti-synapsin (A) and anti-actin ...

Synapsins expression in NCM is regulated by early song-induced gene expression

The song-induced regulation of synapsins is delayed compared to the expression kinetics of known early song-induced transcription factors (which peak 30 min after stimulus onset; Mello and Clayton, 1994; Velho et al., 2005), consistent with the hypothesis that the expression of synapsins in NCM might be under the regulatory control of early song-induced genes. To test this hypothesis, we examined whether the protein synthesis inhibitor cycloheximide (CYC) injected locally into NCM before a 30-min song stimulation period would affect song-induced synapsin expression in birds killed 6 hr after the start of the stimulation (Fig. 7A). We targeted the injections to medial NCM (~500 μm from the midline) since this region shows a very robust expression of early song-inducible genes. We observed significant effects of drug treatment (higher expression in CYC- than VEH-injected hemispheres) for both syn2a and syn3 in song-stimulated birds (Fig. 7B and C, right columns; Anova, p<0.05, and paired t-test, p<0.01, n=5 birds per group), but not in unstimulated controls (Fig. 7B and C, left columns; Anova, p=0.36). Consistent with the previous data (Fig. 3D, left), we did not observe an effect on syn3 expression at a very medial NCM level (~200 μm from the midline; Fig. 7D), arguing for the regional specificity of the CYC effect (Fig. 7C). Importantly, the early song-responsive gene Arc was induced in NCM of both cycloheximide- and vehicle-injected hemispheres (Fig. 7E; Anova p=0.01 and p=0.03 respectively), indicating that the early mRNA induction response to song was undisturbed by the local CYC injection and suggesting that the observed effects were specific for late song-regulated genes. In sum, the early genomic response to song appears to have a suppressive effect on the song-induced expression of synapsins in NCM.

Fig 7
The regulation of synapsins by song is protein synthesis-dependent. A) Schematic representation of the experimental design, arrow points to time of sacrifice. B-E) Fold induction values of syn2a (B), syn3 (C and D), and Arc (E) in vehicle- and cycloheximide-injected ...

ZENK binds to the synapsin 3 promoter

To further investigate the regulation of synapsins, we examined the promoter region of syn3 (the promoter sequence for syn2 is currently unavailable) for the presence of conserved binding sites for known transcription factors using a matrix-based analysis (Genomatix’s MatInspector). Based on the 5′-most zebra finch mRNA sequence available (clone DV949224 in Fig. 1B) and comparisons with sequences from chicken and mammals, we identified a putative transcription start site (TSS; position 0 on Fig. 8A). We did not find a canonical TATA element, but found a CAAT box and a CEBP (CAAT/enhancing binding protein) upstream of the TSS. We noted that the promoter region is decorated with multiple occurrences of the consensus binding sites for various factors, including general ones (e.g. SMARCA3, EVI1, Oct1, ETS1) as well as tissue-specific ones (e.g. HOXF/CRX, TAL1, LEF1). We also found that syn3 contains 2 binding sites for ZENK at positions +276 and +444, and 2 for AP-1 (c-Fos/c-Jun complex) at positions −39 and −790 relative to the TSS (Fig 8A; one ZENK site coincides with the translation start site). We also noticed several occurrences of the binding site for E4BP4, a member of the CREB family that is generally considered to have an inhibitory effect on transcription, and the presence of neural-restrictive silencer elements (NRSE and NRSF) within the first exon.

Fig 8
Structure and in vivo interactions of the syn3 promoter in the zebra finch. A) Schematic drawing of the syn3 promoter region depicting the location of selected consensus motifs. Small arrow at bp 0 indicates putative transcription start site. B) Chromatin ...

To determine whether ZENK actually binds to its putative sites in the syn3 promoter in vivo, we performed chromatin immunoprecipitation (ChIP) with an anti-ZENK antibody on dissected auditory lobules from song-stimulated birds (n=3) perfused 2 hr after the start of a 30 min stimulation with conspecific song. This time corresponds to the peak of ZENK protein induction by song (Mello and Ribeiro, 1998). We then PCR-amplified the immunoprecipitated DNA with syn3-specific primers and obtained a fragment of the predicted size within the syn3 promoter region in all birds examined (Fig 8B, left panel, syn3/Zenk-IP lanes). In contrast, these primers yielded no product when used to PCR amplify DNA immunoprecipitated using an anti-parvalbumin antibody (Fig. 8B, right panel, syn3/Parv-IP lane), establishing the specificity of the immunoprecipitation with the anti-ZENK antibody. In both cases, the same fragment could be amplified from the input samples isolated prior to the immunoprecipitation (Fig 8B, Input lanes). To further determine the specificity of the immunoprecipitation with the anti-ZENK antibody, we designed primers targeting the reconstructed promoter region of the neuronal specific enolase gene (eno2), which we determined to lack conserved ZENK binding sites (not shown). PCR amplification using the eno2-specific primers resulted in no amplification product from the DNA immunoprecipitated with the anti-ZENK antibody, but robust amplification from the input sample (Fig 8B, left panel, eno2 lanes).

DISCUSSION

We have shown that the genes encoding synapsins, a family of phosphoproteins associated with synaptic vesicles and thought to regulate their availability for synaptic release, are induced by song stimulation in a higher-order auditory brain area of songbirds. This induction is protracted relative to early song-inducible genes, occurs primarily in excitatory cells, and is under a suppressive action of early song-induced proteins. Our results support the hypothesis that synapsins are an integral part of the genomic response to sensory stimulation. More generally, synapsins appear to represent late effectors that could mediate the long-term effects of sensory experience on the regulation of neuronal properties.

Regulation of synapsins

The expression of synapsins increases in brain tissue after tetanic electrical stimulation, or prolonged sensory stimulation and behavioral training (Morimoto et al., 1998a; Gomez-Pinilla et al., 2001; Pinaud et al., 2002). It is unclear, however, whether such changes are directly associated with the sensory activation of responsive neurons, or secondary to the chronic stimulation or overtraining. In our paradigm, synapsins were induced after a brief auditory stimulation with birdsong, a natural learned vocal communication signal. Song processing and memorization is essential for songbirds to learn their own song and to identify other individuals during territorial defense and courtship (Kroodsma and Miller, 1996). Thus, our data show that synapsins can be transcriptionally regulated in the brain of freely-behaving animals, by a stimulus of established behavioral relevance.

Our data also imply that synapsins can be regulated by activation of cortical-like circuitry. NCM, a telencephalic region, receives input from the primary thalamo-recipient field L and is interconnected with other auditory areas (Vates et al., 1996), its position in the auditory pathways being analogous to supragranular layers of the auditory cortex. NCM is part of the avian pallium, considered homologous to the mammalian neocortex and parts of the amygdala and claustrum (Reiner et al., 2004; Jarvis et al., 2005). Electrophysiological, gene expression, and lesion studies indicate that NCM plays central roles in song perceptual processing and memorization (Mello et al., 1992; Mello et al., 1995; Velho et al., 2005; Phan et al., 2006; Gobes and Bolhuis, 2007; London and Clayton, 2008), akin to postulated roles of the mammalian auditory cortex (Ghazanfar and Hauser, 2001). We predict that synapsins may also be regulated by complex, behaviorally relevant stimuli in the auditory cortex, and/or by other sensory modalities in the corresponding cortical areas.

Synapsins are late song-induced genes

We have found that synapsins are constitutively expressed at high levels, and significantly induced only hours after the onset of song stimulation. This contrasts with the early song-induced transcription factors (ITFs) zenk, c-fos and c-jun, and the early effector Arc, which have low basal expression and an early induction peak at 30 min after stimulus onset (Mello and Clayton, 1994; Nastiuk et al., 1994; Mello and Ribeiro, 1998; Velho et al., 2005) and singing-induced genes (Poopatanapong et al., 2006; Wada et al., 2006). Thus, syn2 and syn3 are late song-induced genes, regulated by both constitutive and modulatory components.

The induction of synapsins by song occurred primarily in lateral NCM, in contrast to ITFs, whose induction is most pronounced medially. This suggested that synapsin induction does not simply reflect the up-regulation of early genes. Indeed, the evidence from CYC injections indicates that: 1) song stimulation exerts a positive effect on synapsin expression that is independent of early song-induced proteins; and 2) early song-induced proteins appear to have a suppressive effect over the song-induced synapsin expression. Importantly, the lack of CYC effects on synapsin expression in unstimulated birds indicates that the suppressive effect in song-stimulated birds is over the song-regulated component rather than on the constitutive expression of synapsins. In sum, song appears to exert a direct, positive action on synapsin expression, and an indirect, suppressive action through early-inducible genes (Fig. 9). Our evidence adds to an increased awareness of anatomical and functional NCM subdomains (Terpstra et al., 2004; Pinaud et al., 2006).

Fig. 9
Cellular model of song-regulated synapsin expression in NCM, depicting direct and indirect pathways of synapsin regulation. The activation of song-responsive auditory neurons in NCM triggers the activation of intracellular signaling cascades (arrows) ...

Several syn3 promoter elements may relate to its regulated expression, in particular the binding motifs for the early ITFs ZENK/EGR-1 and AP1. We show that ZENK protein binds to this promoter in song-stimulated birds, consistent with a direct regulatory action. This is important, given that the presence of binding sites does not guarantee that a given transcription factor binds to a promoter in vivo (Cha-Molstad et al., 2004; Impey et al., 2004). Indeed, we observed no evidence of song-induced regulation of other candidate late genes such as NF-M and Kv3.1 (not shown), whose promoters contain ITF binding sites (Velho et al., 2007). We also note that mammalian syn1 and 2 promoters contain ZENK/EGR-1 binding sites and are responsive to ZENK/EGR1 over-expression in PC12 cells (Thiel et al., 1994; Petersohn et al., 1995). However, whereas syn1 and 2 are up-regulated based on a gene reporter assay (Petersohn et al., 1995), the native syn2 gene is down-regulated by ~30% in a similar paradigm, based on microarray analysis (James et al., 2006). This suggests that the construct used in the reporter assay did not include all regulatory elements, and that ZENK actually exerts a suppressive effect on synapsin promoters in a normal cell context. Our finding that song-induced synapsin expression is least apparent where ZENK induction is most robust (i.e. medial NCM), and vice-versa, is consistent with this emerging view of ZENK action.

Other ITFs like AP-1 may also modulate the induced expression of synapsins. In contrast, constitutive factors like the activity-regulated Elk-family factor ETS1 are more likely to mediate the positive effect of song on synapsin expression, since the latter persists under CYC. Finally, the suppressive effect of prolonged stimulation on syn3 but not syn2 suggests different promoter organizations, a possibility that awaits the syn2 promoter sequence. In sum, the induced expression of synapsins is under complex regulation, including transcriptional activators and suppressors; ZENK is most likely among the latter.

Potential roles for synapsin regulation

The time-course of synapsin upregulation overlaps with the late phase (5-7 hr after song) of NCM’s long-term habituation dependence on song-induced gene expression (Chew et al., 1995). This contrasts with the early dependence phase, which largely coincides with the induction of early ITFs like zenk and c-fos (Mello et al., 1992; Velho et al., 2005). Thus, synapsins could be a late component of the gene expression program associated with long-lasting habituation. However, based on the apparent suppressive effect of early song-inducible proteins, it seems unlikely that synapsins simply mediate the effect of early ITFs on long-term habituation.

Synapsins are associated with the synaptic vesicle membrane and thus locate to pre-synaptic terminals. Their over-expression leads to an increase in the frequency of synaptic contacts (Han et al., 1991; Zhong et al., 1999), whereas their knockout decreases the number of synaptic vesicles (Gitler et al., 2004; Gaffield and Betz, 2007), suggesting that synapsins are important determinants of synapse formation and/or maintenance. By inference, synapsin upregulation by song may increase the number of synaptic contacts and/or vesicles in song-responsive neurons, thus potentially modifying the synaptic interactions of these neurons. Both GABAergic and non-GABAergic NCM neurons are song-responsive (Pinaud et al, 2004), but the present data indicate that the induced synapsin expression occurs primarily in non-GABAergic (presumably excitatory) cells. We thus predict that the effects of synapsin upregulation will be associated mainly with excitatory cells. These could include local interneurons or projection neurons, resulting in predicted modulation of excitatory synapses locally or at NCM’s projection targets like CMM. A combined approach with tract-tracing will be required to settle this issue.

Current evidence indicates that synapsins modulate different aspects of synaptic transmission, such as the recruitment of synaptic vesicles to a reserve pool, the modulation of the kinetics of membrane fusion, the stabilization of synaptic vesicles, and/or the regulation of the late steps of endocytosis (Li et al., 1995; Rosahl et al., 1995; Hilfiker et al., 1999; Humeau et al., 2001 Bloom et al., 2003). Thus, although increased synapsin proteins will likely accumulate in pre-synaptic terminals of activated neurons, it is difficult to predict the exact consequences to synaptic physiology in vivo. Interestingly, injections of synapsin proteins to goldfish Mauthner axons result in reduced quantal release (Hackett et al., 1990), suggesting that synapsin overexpression might actually downregulate synaptic efficacy. Such an effect, if occurring in interneurons, would be consistent with a role of synapsins in the habituation of NCM’s response to song.

The consolidation of experience-dependent changes underlying long-term memory requires the activation of gene expression programs in different models and organisms (Goelet et al., 1986; Bailey et al., 1996). In songbirds, recent evidence implicates MAP kinase signaling in NCM and adjacent areas in the acquisition of tutor song memory during song learning (London and Clayton, 2008). Since the expression of early song-induced genes depends on MAP kinase activation (Cheng and Clayton, 2004; Velho et al., 2005), song-inducible genes in NCM may be involved in the memorization of tutor song. Our current data establish that synapsins are an integral part of NCM’s genomic response to song, suggesting that they could also participate in the formation and/or consolidation of song-related memories, a hypothesis requiring future tests.

Supplementary Material

Supp1

Supp2

Acknowledgements

The authors would like to thank Maria Manczak for technical assistance with the protein blots and Anne Cherry for helping with the neuronal cell counts. This work was supported by NIH grant NIDCD02853.

References

  • Alfonso J, Frick LR, Silberman DM, Palumbo ML, Genaro AM, Frasch AC. Regulation of hippocampal gene expression is conserved in two species subjected to different stressors and antidepressant treatments. Biol Psychiatry. 2006;59:244–251. [PubMed]
  • Bailey CH, Bartsch D, Kandel ER. Toward a molecular definition of long-term memory storage. Proceedings of the National Academy of Sciences U S A. 1996;93:13445–13452. [PMC free article] [PubMed]
  • Bloom O, Evergren E, Tomilin N, Kjaerulff O, Low P, Brodin L, Pieribone VA, Greengard P, Shupliakov O. Colocalization of synapsin and actin during synaptic vesicle recycling. J Cell Biol. 2003;161:737–747. [PMC free article] [PubMed]
  • Bolhuis JJ, Zijlstra GG, den Boer-Visser AM, Van Der Zee EA. Localized neuronal activation in the zebra finch brain is related to the strength of song learning. Proc Natl Acad Sci U S A. 2000;97:2282–2285. [PMC free article] [PubMed]
  • Cavalleri GL, Weale ME, Shianna KV, Singh R, Lynch JM, Grinton B, Szoeke C, Murphy K, Kinirons P, O’Rourke D, Ge D, Depondt C, Claeys KG, Pandolfo M, Gumbs C, Walley N, McNamara J, Mulley JC, Linney KN, Sheffield LJ, Radtke RA, Tate SK, Chissoe SL, Gibson RA, Hosford D, Stanton A, Graves TD, Hanna MG, Eriksson K, Kantanen AM, Kalviainen R, O’Brien TJ, Sander JW, Duncan JS, Scheffer IE, Berkovic SF, Wood NW, Doherty CP, Delanty N, Sisodiya SM, Goldstein DB. Multicentre search for genetic susceptibility loci in sporadic epilepsy syndrome and seizure types: a case-control study. Lancet Neurol. 2007;6:970–980. [PubMed]
  • Cha-Molstad H, Keller DM, Yochum GS, Impey S, Goodman RH. Cell-type-specific binding of the transcription factor CREB to the cAMP-response element. Proc Natl Acad Sci U S A. 2004;101:13572–13577. [PMC free article] [PubMed]
  • Chaudhuri A. Neural activity mapping with inducible transcription factors. Neuroreport. 1997;8:v–ix. [PubMed]
  • Chen Q, He G, Qin W, Chen QY, Zhao XZ, Duan SW, Liu XM, Feng GY, Xu YF, Clair D, Li M, Wang JH, Xing YL, Shi JG, He L. Family-based association study of synapsin II and schizophrenia. Am J Hum Genet. 2004;75:873–877. [PMC free article] [PubMed]
  • Cheng HY, Clayton DF. Activation and habituation of extracellular signal-regulated kinase phosphorylation in zebra finch auditory forebrain during song presentation. J Neurosci. 2004;24:7503–7513. [PubMed]
  • Chew SJ, Mello C, Nottebohm F, Jarvis E, Vicario DS. Decrements in auditory responses to a repeated conspecific song are long-lasting and require two periods of protein synthesis in the songbird forebrain. Proc Natl Acad Sci U S A. 1995;92:3406–3410. [PMC free article] [PubMed]
  • Clayton DF. The genomic action potential. Neurobiol Learn Mem. 2000;74:185–216. [PubMed]
  • Curran T, Morgan JI. Superinduction of c-fos by nerve growth factor in the presence of peripherally active benzodiazepines. Science. 1985;229:1265–1268. [PubMed]
  • Denisenko-Nehrbass NI, Jarvis E, Scharff C, Nottebohm F, Mello CV. Site-specific retinoic acid production in the brain of adult songbirds. Neuron. 2000;27:359–370. [PubMed]
  • Gaffield MA, Betz WJ. Synaptic vesicle mobility in mouse motor nerve terminals with and without synapsin. J Neurosci. 2007;27:13691–13700. [PubMed]
  • George JM, Clayton DF. Differential regulation in the avian song control circuit of an mRNA predicting a highly conserved protein related to protein kinase C and the bcr oncogene. Molecular Brain Research. 1992;12:323–329. [PubMed]
  • Ghazanfar AA, Hauser MD. The auditory behaviour of primates: a neuroethological perspective. Curr Opin Neurobiol. 2001;11:712–720. [PubMed]
  • Gitler D, Takagishi Y, Feng J, Ren Y, Rodriguiz RM, Wetsel WC, Greengard P, Augustine GJ. Different presynaptic roles of synapsins at excitatory and inhibitory synapses. J Neurosci. 2004;24:11368–11380. [PubMed]
  • Gobes SM, Bolhuis JJ. Birdsong memory: a neural dissociation between song recognition and production. Curr Biol. 2007;17:789–793. [PubMed]
  • Goelet P, Castellucci VF, Schacher S, Kandel ER. The long and the short of long-term memory--a molecular framework. Nature. 1986;322:419–422. [PubMed]
  • Gomez-Pinilla F, So V, Kesslak JP. Spatial learning induces neurotrophin receptor and synapsin I in the hippocampus. Brain Res. 2001;904:13–19. [PubMed]
  • Greengard P, Valtorta F, Czernik AJ, Benfenati F. Synaptic vesicle phosphoproteins and regulation of synaptic function. Science. 1993;259:780–785. [PubMed]
  • Hackett JT, Cochran SL, Greenfield LJ, Jr., Brosius DC, Ueda T. Synapsin I injected presynaptically into goldfish mauthner axons reduces quantal synaptic transmission. J Neurophysiol. 1990;63:701–706. [PubMed]
  • Han HQ, Nichols RA, Rubin MR, Bahler M, Greengard P. Induction of formation of presynaptic terminals in neuroblastoma cells by synapsin IIb. Nature. 1991;349:697–700. [PubMed]
  • Hilfiker S, Pieribone VA, Czernik AJ, Kao HT, Augustine GJ, Greengard P. Synapsins as regulators of neurotransmitter release. Philos Trans R Soc Lond B Biol Sci. 1999;354:269–279. [PMC free article] [PubMed]
  • Holzenberger M, Jarvis ED, Chong C, Grossman M, Nottebohm F, Scharff C. Selective expression of insulin-like growth factor II in the songbird brain. Journal of Neuroscience. 1997;17:6974–6987. [PubMed]
  • Humeau Y, Doussau F, Vitiello F, Greengard P, Benfenati F, Poulain B. Synapsin controls both reserve and releasable synaptic vesicle pools during neuronal activity and short-term plasticity in Aplysia. J Neurosci. 2001;21:4195–4206. [PubMed]
  • Impey S, McCorkle SR, Cha-Molstad H, Dwyer JM, Yochum GS, Boss JM, McWeeney S, Dunn JJ, Mandel G, Goodman RH. Defining the CREB regulon: a genome-wide analysis of transcription factor regulatory regions. Cell. 2004;119:1041–1054. [PubMed]
  • Iwata M, Shirayama Y, Ishida H, Kawahara R. Hippocampal synapsin I, growth-associated protein-43, and microtubule-associated protein-2 immunoreactivity in learned helplessness rats and antidepressant-treated rats. Neuroscience. 2006;141:1301–1313. [PubMed]
  • James AB, Conway AM, Morris BJ. Regulation of the neuronal proteasome by Zif268 (Egr1) J Neurosci. 2006;26:1624–1634. [PubMed]
  • Jarvis ED, Gunturkun O, Bruce L, Csillag A, Karten H, Kuenzel W, Medina L, Paxinos G, Perkel DJ, Shimizu T, Striedter G, Wild JM, Ball GF, Dugas-Ford J, Durand SE, Hough GE, Husband S, Kubikova L, Lee DW, Mello CV, Powers A, Siang C, Smulders TV, Wada K, White SA, Yamamoto K, Yu J, Reiner A, Butler AB. Avian brains and a new understanding of vertebrate brain evolution. Nat Rev Neurosci. 2005;6:151–159. [PMC free article] [PubMed]
  • Jeong JK, Velho TA, Mello CV. Cloning and expression analysis of retinoic acid receptors in the zebra finch brain. J Comp Neurol. 2005;489:23–41. [PubMed]
  • Kao HT, Porton B, Hilfiker S, Stefani G, Pieribone VA, DeSalle R, Greengard P. Molecular evolution of the synapsin gene family. J Exp Zool. 1999;285:360–377. [PubMed]
  • Kroodsma DE, Miller EH. Ecology and Evolution of Acoustic Communication in Birds. Cornell University Press; Ithaca, NY: 1996.
  • Lachman HM, Stopkova P, Rafael MA, Saito T. Association of schizophrenia in African Americans to polymorphism in synapsin III gene. Psychiatr Genet. 2005;15:127–132. [PubMed]
  • Lanahan A, Worley P. Immediate-early genes and synaptic function. Neurobiol Learn Mem. 1998;70:37–43. [PubMed]
  • Li L, Chin LS, Shupliakov O, Brodin L, Sihra TS, Hvalby O, Jensen V, Zheng D, McNamara JO, Greengard P, et al. Impairment of synaptic vesicle clustering and of synaptic transmission, and increased seizure propensity, in synapsin I-deficient mice. Proc Natl Acad Sci U S A. 1995;92:9235–9239. [PMC free article] [PubMed]
  • London SE, Clayton DF. Functional identification of sensory mechanisms required for developmental song learning. Nat Neurosci. 2008;11:579–586. [PMC free article] [PubMed]
  • Mello C, Nottebohm F, Clayton D. Repeated exposure to one song leads to a rapid and persistent decline in an immediate early gene’s response to that song in zebra finch telencephalon. J Neurosci. 1995;15:6919–6925. [PubMed]
  • Mello CV. Mapping vocal communication pathways in birds with inducible gene expression. J Comp Physiol A Neuroethol Sens Neural Behav Physiol. 2002;188:943–959. [PubMed]
  • Mello CV, Clayton DF. Song-induced ZENK gene expression in auditory pathways of songbird brain and its relation to the song control system. J Neurosci. 1994;14:6652–6666. [PubMed]
  • Mello CV, Ribeiro S. ZENK protein regulation by song in the brain of songbirds. Journal of Comparative Neurology. 1998;393:426–438. [PubMed]
  • Mello CV, Vicario DS, Clayton DF. Song presentation induces gene expression in the songbird forebrain. Proc Natl Acad Sci U S A. 1992;89:6818–6822. [PMC free article] [PubMed]
  • Mello CV, Velho TA, Pinaud R. Song-induced gene expression: a window on song auditory processing and perception. Ann N Y Acad Sci. 2004;1016:263–281. [PubMed]
  • Mello CV, Jarvis ED, Denisenko N, Rivas M. Isolation of song-regulated genes in the brain of songbirds. Methods Mol Biol. 1997;85:205–217. [PubMed]
  • Morimoto K, Sato K, Sato S, Yamada N, Hayabara T. Time-dependent changes in rat hippocampal synapsin I mRNA expression during long-term potentiation. Brain Res. 1998a;783:57–62. [PubMed]
  • Morimoto K, Sato K, Sato S, Suemaru S, Sato T, Yamada N, Hayabara T. Increases in mRNA levels for synapsin I but not synapsin II in the hippocampus of the rat kindling model of epilepsy. Seizure. 1998b;7:229–235. [PubMed]
  • Nastiuk KL, Mello CV, George JM, Clayton DF. Immediate-early gene responses in the avian song control system: cloning and expression analysis of the canary c-jun cDNA. Brain Res Mol Brain Res. 1994;27:299–309. [PubMed]
  • Nedivi E, Hevroni D, Naot D, Israeli D, Citri Y. Numerous candidate plasticity-related genes revealed by differential cDNA cloning. Nature. 1993;363:718–722. [PubMed]
  • Petersohn D, Schoch S, Brinkmann DR, Thiel G. The human synapsin II gene promoter. Possible role for the transcription factor zif268/egr-1, polyoma enhancer activator 3, and AP2. J Biol Chem. 1995;270:24361–24369. [PubMed]
  • Phan ML, Pytte CL, Vicario DS. Early auditory experience generates long-lasting memories that may subserve vocal learning in songbirds. Proc Natl Acad Sci U S A. 2006;103:1088–1093. [PMC free article] [PubMed]
  • Pinaud R, Fortes AF, Lovell P, Mello CV. Calbindin-positive neurons reveal a sexual dimorphism within the songbird analogue of the mammalian auditory cortex. J Neurobiol. 2006;66:182–195. [PubMed]
  • Pinaud R, Osorio C, Alzate O, Jarvis ED. Profiling of experience-regulated proteins in the songbird auditory forebrain using quantitative proteomics. Eur J Neurosci. 2008a;27:1409–1422. [PMC free article] [PubMed]
  • Pianud R, Terleph TA, Tremere LA, Phan ML, Dagostin AA, Leao RM, Mello CV, Vicario DS. Inhibitory Network Interactions Shape the Auditory Processing of Natural Communication Signals in the Songbird Auditory Forebrain. J Neurophysiol. 2008b [PMC free article] [PubMed]
  • Pinaud R, Tremere LA, Penner MR, Hess FF, Barnes S, Robertson HA, Currie RW. Plasticity-driven gene expression in the rat retina. Brain Res Mol Brain Res. 2002;98:93–101. [PubMed]
  • Pinaud R, Velho TA, Jeong JK, Tremere LA, Leao RM, von Gersdorff H, Mello CV. GABAergic neurons participate in the brain’s response to birdsong auditory stimulation. Eur J Neurosci. 2004;20:1318–1330. [PubMed]
  • Poopatanapong A, Teramitsu I, Byun JS, Vician LJ, Herschman HR, White SA. Singing, but not seizure, induces synaptotagmin IV in zebra finch song circuit nuclei. J Neurobiol. 2006;66:1613–1629. [PMC free article] [PubMed]
  • Reiner A, Perkel DJ, Bruce LL, Butler AB, Csillag A, Kuenzel W, Medina L, Paxinos G, Shimizu T, Striedter G, Wild M, Ball GF, Durand S, Gunturkun O, Lee DW, Mello CV, Powers A, White SA, Hough G, Kubikova L, Smulders TV, Wada K, Dugas-Ford J, Husband S, Yamamoto K, Yu J, Siang C, Jarvis ED. Revised nomenclature for avian telencephalon and some related brainstem nuclei. J Comp Neurol. 2004;473:377–414. [PMC free article] [PubMed]
  • Rosahl TW, Spillane D, Missler M, Herz J, Selig DK, Wolff JR, Hammer RE, Malenka RC, Sudhof TC. Essential functions of synapsins I and II in synaptic vesicle regulation. Nature. 1995;375:488–493. [PubMed]
  • Sheng M, Greenberg ME. The regulation and function of c-fos and other immediate early genes in the nervous system. Neuron. 1990;4:477–485. [PubMed]
  • Terpstra NJ, Bolhuis JJ, den Boer-Visser AM. An analysis of the neural representation of birdsong memory. J Neurosci. 2004;24:4971–4977. [PubMed]
  • Thiel G, Schoch S, Petersohn D. Regulation of synapsin I gene expression by the zinc finger transcription factor zif268/egr-1. J Biol Chem. 1994;269:15294–15301. [PubMed]
  • Vates GE, Broome BM, Mello CV, Nottebohm F. Auditory pathways of caudal telencephalon and their relation to the song system of adult male zebra finches. J Comp Neurol. 1996;366:613–642. [PubMed]
  • Velho TA, Lovell P, Mello CV. Enriched expression and developmental regulation of the middle-weight neurofilament (NF-M) gene in song control nuclei of the zebra finch. J Comp Neurol. 2007;500:477–497. [PMC free article] [PubMed]
  • Velho TA, Pinaud R, Rodrigues PV, Mello CV. Co-induction of activity-dependent genes in songbirds. Eur J Neurosci. 2005;22:1667–1678. [PubMed]
  • Velho TAF, Mello CV. Transcriptional regulation of activity-dependent genes by birdsong. In: Dudek S, editor. Transcriptional Regulation by Neuronal Activity. 1st Springer; 2007. pp. 3–26.
  • Wada K, Howard JT, McConnell P, Whitney O, Lints T, Rivas MV, Horita H, Patterson MA, White SA, Scharff C, Haesler S, Zhao S, Sakaguchi H, Hagiwara M, Shiraki T, Hirozane-Kishikawa T, Skene P, Hayashizaki Y, Carninci P, Jarvis ED. A molecular neuroethological approach for identifying and characterizing a cascade of behaviorally regulated genes. Proc Natl Acad Sci U S A. 2006;103:15212–15217. [PMC free article] [PubMed]
  • Zhong ZG, Noda M, Takahashi H, Higashida H. Overexpression of rat synapsins in NG108-15 neuronal cells enhances functional synapse formation with myotubes. Neurosci Lett. 1999;260:93–96. [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...