pmc logo image
Logo of nihpaNIHPA bannerabout author manuscriptssubmit a manuscript

Formats:

Cell Signal. Author manuscript; available in PMC 2009 September 1.
Published in final edited form as:
Published online 2008 May 25. doi: 10.1016/j.cellsig.2008.05.009.
PMCID: PMC2602840
NIHMSID: NIHMS63416
Vasopressin up-regulates the expression of growth-related immediate-early genes via two distinct EGF receptor transactivation pathways
Lida Q. Fuentes,* Carlos E. Reyes,* José M. Sarmiento,* Carolina I. Villanueva,* Carlos D. Figueroa,§ Javier Navarro,# and Carlos B. González*#
*Department of Physiology, Universidad Austral de Chile, Valdivia, Chile
§Department of Histology & Pathology, Universidad Austral de Chile, Valdivia, Chile
#Department of Neuroscience and Cell Biology, University of Texas Medical Branch, Galveston TX 77555.
Correspondence and reprint requests to: Dr. Carlos B. González, Departamento de Fisiología, Universidad Austral de Chile, Casilla 567, Isla Teja, Valdivia 509-9200, Chile. Email: cbgonzal/at/uach.cl, Fax: 56-63-221513
Activation of V1a receptor triggers the expression of growth-related immediate-early genes (IEGs), including c-Fos and Egr-1. Here we found that pre-treatment of rat vascular smooth muscle A-10 cell line with the EGF receptor inhibitor AG1478 or the over-expression of an EGFR dominant negative mutant (HEBCD533) blocked the vasopressin-induced expression of IEGs, suggesting that activation of these early genes mediated by V1a receptor is via transactivation of the EGF receptor. Importantly, the inhibition of the metalloproteinases, which catalyzed the shedding of the EGF receptor agonist HB-EGF, selectively blocked the vasopressin-induced expression c-Fos. On the other hand, the inhibition of c-Src selectively blocked the vasopressin-induced expression of Egr-1. Interestingly, in contrast to the expression of c-Fos, the expression of Egr-1 was mediated via the Ras/MEK/MAPK-dependent signalling pathway. Vasopressin-triggered expression of both genes required the release of intracellular calcium, activation of PKC and β-arrestin 2. These findings demonstrated that vasopressin up-regulated the expression of c-Fos and Erg-1 via transactivation of two distinct EGF receptor-dependent signalling pathways.
Keywords: Vasopressin, PKC, mitogen-activated kinases, immediate early genes, EGFR transactivation, metalloproteinases
Arginine vasopressin (AVP) plays a central role in the mechanisms regulating blood pressure by stimulating the contraction of vascular smooth muscle cells and water reabsorption in the kidney [17]. Importantly, AVP acts as a growth factor inducing hypertrophy and cell growth in a variety of cell types [813]. AVP-stimulated cellular responses are mediated by three AVP receptors subtypes (V1, V2 and V3), which belong to the superfamily of G-protein-coupled receptors (GPCRs). Like many GPCRs, the V1 receptor transactivates the EGF receptor (EGFR) to induce the expression of immediate early genes leading to the cell cycle progression and growth [1419]. GPCRs transactivate EGFR via several mechanisms [20, 21]. One mechanism involves the activation of a membrane-bound metalloproteinase that catalyzes the extracellular shedding of HB-EGF, which then actives the EGFR [2225]. A second mechanism involves the activation of c-Src, which leads to the phosphorylation and activation of EGFR [2628]. Additionally, tyrosine kinase receptors can use GPCR-mediated signalling pathways to stimulate downstream effectors, such as ERK1/2 [29]. This mechanism of cross-talk between tyrosine kinase receptors and the GPGRs has been designated as integrative signalling [29, 30]. Since the growth of the smooth muscle cell is important for the arterial wall stiffness and for the onset of hypertension, we investigated the mechanisms of the AVP triggered-expression of two growth-related genes c-Fos and the early growth response gene 1 (Egr-1) in A-10 cells. This cell line is derived from rat smooth muscle cells, which endogenously express both V1 and EGF receptors. In this work we showed that AVP-induced up-regulation of c-Fos and Egr-1 is mediated by the stimulation of two distinct EGFR transactivation mechanisms.
2.1 Materials
Dulbecco’s modified Eagle’s medium (DMEM), penicillin, streptomycin, glutamine, and fungizone were from Invitrogen. Phorbol, 12-myristate, 13-acetate, GF109203X, PD98059, Y27632, PP1 and AG 1478 were from Calbiochem. GM6001 was from Chemicon. MMP Inhibitor III was from Merck. Ultraspec was from Biotecx. Pertussis toxin was from Biomol International. Antibody against phospho-retinoblastoma protein was from Cell Signaling Technology, anti-Egr-1 and anti c-Fos were from Santa Cruz Biotechnology. The V1 antagonist d(CH2)5[Tyr2(Me)Tyr9(NH2)]AVP was kindly provided by Prof. M. Manning (Medical College of Ohio, Toledo, USA). The siRNA for β-arrestin 2 was purchased from Invitrogen.
2.2. Expression vectors
Plasmids encoding wild type c-Src and c-SrcK295R/Y527F were a generous gift from Dr. Joan S. Brugge (Harvard Medical School, USA). The plasmid encoding L61S186Ras was generously provided by Dr. Kun-Liang Guan (University of Michigan Medical School, USA). The EGFR dominant negative mutant HERCD533 was generously provided by Dr. S Meloche (University of Montreal, Quebec, Canada). The plasmid encoding the C-terminus of β-adrenergic receptor kinase (CT-βGRK2) was a generous gift from Dr. Juan Olate (Universidad de Concepción, Chile). The plasmid encoding the S1 catalytic subunit of Pertussis toxin was kindly provided by Dr. Halvard Bonig (University of Washington, USA)
2.3. Cell culture and transfections
The smooth muscle cell line A-10 (ATCC CRL 1476) was cultured to subconfluency on 35 mm dishes in DMEM containing 10% FBS. Serum starved cells were treated with vasopressin in the absence and presence of inhibitors. The reaction was stopped by addition of 100 µl of ice-cold RIPA buffer (150 mM NaCl, Tris/ HCl pH 8.0, 1% deoxycholic acid, 1% Nonidet P40, 0.1% SDS, 4 mM EDTA, 1 mM Na3VO4, 250 µg/ml p-nitrophenyl phosphate, 1 mM phenylmethane-sulphonyl fluoride, 1 µg/ml each of leupeptin, pepstatin A and aprotinin). Cells were lysed and proteins were precipitated by addition of trichloroacetic acid and resuspended in electrophoresis sample buffer containing 1 mM Na3VO4. In some experiments, cells were incubated with the V1 antagonist d(CH2)5[Tyr2(Me)Tyr9(NH2)]AVP, GF109203X or with PD98059 or with AG 1478 or with MMP or GM6001 inhibitors prior the stimulation with AVP. Transient transfections were carried out using FuGENE 6 Transfection Reagent (Roche Diagnostics). The siRNA for β arrestin 2 was transfected using Block-iT Transfection Kit (Invitrogen).
2.4 Western blotting
Cell extracts were fractionated using SDS-PAGE, and the proteins were electrotransferred onto nitrocellulose filters using 0.05% SDS in the transfer buffer (20 mM Tris-glicine pH 8.3 and 20% methanol). Blots were incubated with anti c-Fos or anti Egr-1 or anti phospho-retinoblastoma protein antibodies at a dilution of 1:1,000. The blots were then incubated with peroxidase-labeled secondary antibody at a dilution of 1:50,000 followed by chemiluminescence.
2.5. Reverse Transcription and Polymerase Chain Reaction
Total RNA from A-10 cells was prepared using Ultraspec (Biotecx). cDNAs were synthesized using oligo dt primers and SuperScript II (Gibco BRL). PCR were carried out using the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene as an internal non-competitive standard to normalize the expression of the gene to be studied. The pair of primers for the c-Fos were the sense 5′GCCAACTTTATCCCCACG3′ and the anti-sense 5′TAGAAGGAACCAGACAGGTCC3′ which should generate a fragment of 725 bp, for the Egr-1 were the sense 5′-CTTCAGTCGTAGTGACCACCT-3′ and the anti-sense 5′-ATGTCTGAAAGACCAGTTGAG-3′which should generate a fragment of 441 bp, and for the GAPDH were the sense 5′TCCCTCAAGATTGTCAGCAA-3 and the anti-sense 5′-AGATCCACAACGGATACATT-3″ which should generate a fragment of 309 bp. The ratio of the co-amplification of products was estimated at the exponential phase of the PCR. The PCR reaction mixture contained 50 pMol of each primer for gene to be studied and for GAPDH, 1 mM deoxynucleotides 1x Taq polymerase reaction buffer, 1.5 mM MgCl2 and 2.5 U Taq polymerase. PCR products were fractionated by electrophoresis on 1.6 % agarose gel, stained with ethidium bromide and the bands visualized with a UV transilluminator.
3.1. The V1a Receptor Mediated the Expression of IEGs
Because AVP triggers cell proliferation in several cell types, we initially tested the AVP-induced expression of genes regulating cell growth in the aorta smooth muscle derived A-10 cell line. Western blot analysis showed that AVP up-regulated the expression of genes regulating cell growth, including cyclin D1 and the immediate early genes c-Fos and Egr-1 (Fig. 1Figure 1). In addition, we showed the AVP-dependant phosphorylation of the retinoblastoma protein (Rb), which is a essential in the cell cycle progression. RT-PCR assays demonstrated that the AVP-dependant expression of c-Fos was transient, reaching a maximum level at 30 min; whereas the expression of Egr-1 was sustained for up to 3h (Fig. 2AFigure 2). Interestingly, EGF–triggered expression of both c-Fos and Egr-1 was fast and transient (Fig. 2BFigure 2). To identify the AVP receptor subtype responsible for the up-regulation of these early immediate genes we employed AVP receptor-specific antagonists. We found that the V1a antagonist d(CH2)5[Tyr2(Me)Tyr9(NH2)]AVP blocked the AVP-induced up-regulation of both IEGs (Fig. 3Figure 3), suggesting that their expression is mediated via the V1a receptor subtype. The V2 specific agonist, desmopressin, did not affect the expression of IEGs in A-10 cells (Data not shown).
Figure 1
Figure 1
Figure 1
Time-course of retinoblastoma protein (Rb) phosphorylation and protein expression of early immediate genes (c-Fos and Egr-1) and cyclin D 1 after AVP stimulation
Figure 2
Figure 2
Figure 2
Time-course of transcriptional up-regulation of IEG after AVP or EGF stimulation of A-10 cells
Figure 3
Figure 3
Figure 3
The transcriptional up-regulation of IEG is mediated the V1a vasopressin receptor
3.2. AVP-induced up-regulation of IEGs required activation of PKC, intracellular calcium and β-arrestin 2
A-10 cells depleted of PKC by the long-treatment with phorbol esters failed to elicit AVP-dependant expression of both c-Fos and Erg-1 (Fig. 4AFigure 4). Similarly, the PKC inhibitor Gö6983 blocked the AVP-induced up-regulation of both genes (Fig. 4BFigure 4). In contrast, the PKC inhibitor GF109203X (GFX) was a weak inhibitor of the AVP-dependent up regulation of these genes (Data not shown). Further, cells treated with the intracellular calcium chelator BAPTA failed to respond to AVP-induced up-regulation of IEGs (Fig. 4CFigure 4), suggesting that the release of intracellular calcium is required for the AVP effect.
Figure 4
Figure 4
Figure 4
PKC, intracellular Ca+2 and β-arrestin 2 are involved in the transcriptional up-regulation of IEGs by transactivation of EGFR
Since the activated and phosphorylated V1 receptor binds β-arrestin 2, desensitizing the responses mediated by the receptor and stimulating non-G protein signalling pathways [31, 32], we examined the role of β-arrestin 2 in the AVP-induced expression of IEG. We showed that A-10 cells depleted of β-arrestin 2 by specific siRNA failed to elicit AVP-induced up-regulation of both IEGs (Fig. 4DFigure 4). This finding indicates that β-arrestin 2 is required in the AVP-induced up-regulation of IEG.
3.3. AVP-induced up-regulation of c-Fos and Egr-1 via two distinct EGFR transactivation pathways
We employed the EGFR kinase inhibitor AG1478 and cells over-expressing the EGFR dominant negative mutant HERCD533 to determine whether AVP-stimulated the expression of c-Fos and Egr-1 involves activation of the EGF receptor. Fig 5A and 5BFigure 5 showed that AG1478 or the over-expression of HERCD533 blocked the AVP-induced up-regulation c-Fos and Egr-1. These results indicate that AVP-induced expression of both genes required activation of the EGF receptor in A-10 cells.
Figure 5
Figure 5
Figure 5
The AVP-induced up-regulation of the IEGs is due to the transactivation of the EGFR
To determine whether the mechanism of EGFR transactivation mediated by the V1a receptor is via the shedding of the EGF receptor agonist HB-EGF, we employed two different metalloproteinase inhibitors (MMPII and GM6001) of the A Disintegrin And Metalloproteinase (ADAM), which cleaves the pro-HB-EGF to release HB-EGF [33]. We showed that MMPII (Fig. 6AFigure 6) and GM6001 (Fig. 6BFigure 6) blocked selectively the AVP-induced up-regulation of c-Fos. These inhibitors did not affect the expression of Egr-1. Similarly, we found that the Rho kinase (ROCK) inhibitor Y27632 abrogated the AVP-mediated up-regulation of c-Fos without affecting the expression of Egr 1 (Fig. 6CFigure 6). This result is in good agreement with previous studies indicating that RhoA/ROCK induces MMP activation [34, 35], and that the over-expression of Rho activates the EGFR via a MMP-dependent mechanism [36, 37].
Figure 6
Figure 6
Figure 6
AVP-induced EGFR transactivation and transcriptional up-regulation of c-Fos is dependent upon the metalloproteinase and Rho kinase activities
To investigate the mechanism of up-regulation of Egr-1 by AVP we examined the role of additional intracellular signalling proteins. We found that the c-Src inhibitor PP1 selectively blocked the AVP-induced expression of Egr-1, without any effect on the expression of c-Fos (Fig 7AFigure 7). Similarly, A-10 cells transfected with the c-Src dominant negative mutant (SrcK295R/Y527F) [38] failed to trigger AVP-dependant Egr-1 up regulation (Fig 7BFigure 7), whereas cells transfected with the wild-type c-Src responded as the untransfected cells. Moreover, A10 cells, transfected with a cDNA encoding a dominant negative mutant of Ras (L61S186Ras) [39] or treated with the MEK inhibitor PD98059, failed to elicit AVP- induced expression of Egr-1 without affecting the expression of c-Fos (Fig 7C and 7DFigure 7).
Figure 7
Figure 7
Figure 7
AVP-induced EGFR transactivation and transcriptional up-regulation of Egr-1 is dependent of the c-Src kinase activity and RAS/MEK pathway
We further explored the role of G protein signalling by blocking the coupling of Gi proteins to GPCRs via Pertussis toxin-catalyzed the ADP ribosylation of G, and by blocking the G protein βγ-dependant signalling pathways by overexpression of CT-βGRK2 [40]. We found that A-10 cells pre-treated with Pertussis toxin or cells over-expressing the Pertussis toxin catalytic subunit did not affect the AVP-induced expression of c-Fos or Egr-1 (Fig. 8A, BFigure 8). These findings agree with the coupling of V1 receptors to Pertussis toxin insensitive G proteins [41]. Similarly, we found that cells over-expressing CT-GRK2 also failed to block the AVP-induced expression of both genes (Fig. 8CFigure 8). Interestingly, we showed that AVP induced the formation of V1 receptor/EGFR complexes as shown by expression of the V1 receptor fused to GFP in A10 cells, and co-immunoprecipitation of V1 receptor fused to GFP and the endogenous EGFR (Fig. 9Figure 9).
Figure 8
Figure 8
Figure 8
Neither pertussis toxin nor CT-βGRK2 has any affect on the AVP-mediated IEG up-regulation
Figure 9
Figure 9
Figure 9
AVP-induced association of the V1a vasopressin receptor and the EGFR
We demonstrated that activation of the V1 receptor up-regulated the expression of proliferation related genes, including c-Fos, Egr-1 and Cyclin D1, and increased the phosphorylation of the Rb protein. Further, we found that AVP-induced up-regulation of c-Fos and Egr-1 genes were mediated by the cross-talk of V1 receptor and the EGFR signalling systems, which is in good agreement with previous studies indicating that AVP-stimulated cell proliferation via transactivation of the EGFR [11, 42, 43]. We also showed that AVP-up-regulated c-Fos and Egr-1 required the activation of PKC, the release of intracellular calcium and β-arrestin 2. These results are consistent with previous experiments indicating that V1 receptor mutants lacking PKC phosphorylation sites failed to mediate DNA synthesis and progression through the cell cycle [44]. Most importantly, we showed that AVP-up-regulated c-Fos and Egr-1 by activation of two distinct EGFR transactivation signalling pathways. The expression of c-Fos was mediated by metalloproteinase-released HB-EGF; whereas the expression of Egr-1 was mediated by an AVP-activated a non-receptor tyrosine kinase, c-Src. It is likely that these two modes of EGFR transactivations are elicited by the differential phosphorylation of the EGFR. Indeed, the c-Src inhibitor PP1, inhibited the AVP-induced phosphorylation EGFR at residue 845, whereas the metalloprotease inhibitor GM6001 did not affect the phosphorylation of EGFR at that residue (unpublished results). Similar mechanisms of EGFR transactivation have been previously reported with other GPCR systems [27, 4549]. On the basis of our co-immunoprecipitation studies we argue that V1a mediated EGFR transactivation involves the formation of V1a/EGFR complex assembled with β-arrestin 2 and intracellular proteins of the trafficking mechanisms [50].
Interestingly, AVP-induced up-regulation of Egr-1, but not the c-Fos up-regulation, was mediated by a Ras/MEK-dependent signalling pathway. These results are in agreement with previous studies indicating that the GPCR-dependent expression of Egr-1 is via the activation of MEK/ERK signalling pathway [5055]. Although ERK activation enhances transcription of c-Fos and Egr-1 [53, 5659], we found that AVP-induced expression of c-Fos is via an ERK-independent signalling pathway, indicating that c-Fos transcription is activated via multiple signalling pathways. Our data are consistent with a signalling model in which the activated and phosphorylated V1 receptor binds β-arrestin to trigger the activation of Rho/ROCK- and c-Src-dependent signalling pathways. The Rho/ROCK pathway activates MMP to release HB-EGF, which then triggers the expression of c-Fos via the activation of the EGF receptor. On the other hand, the c-Src pathway catalyzes the phosphorylation of the EGFR, which elicit the activation of the Ras/MEK/ERK signalling mechanism to induce the expression of Erg-1 (Fig. 10Figure 10). The novel mechanism of the AVP-triggered transactivation of EGFR provides the basis for regulating the selective expression of EIGs, as Egr-1 is a major vascular transcription factor involved in atherosclerosis and restenosis [60, 61].
Figure 10
Figure 10
Figure 10
Diagrammatic representation of the pathways involved in the IEG transcriptional up-regulation by the AVP-mediated EGFR transactivation
Acknowledgments
We would like to thank the expert technical assistance of E. Oyarzun and to G. Perdomo for preliminary experiments. This work was supported by grants 1030261 and 1060158 from FONDECYT (CBG) and 2005-19 (LQF) and (CER) from DIUACH; and Welch Foundation and NIH grants (R01 EY014218 and GM064855) to JN.
Footnotes
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
1. Hirsch AT, Dzau VJ, Majzoub JA, Creager MA. J Clin Invest. 1989;84:418–426. [PubMed]
2. Gonzalez CB, Figueroa CD. Biol Res. 1999;32:63–76. [PubMed]
3. Sarmiento JM, Ehrenfeld P, Anazco CC, Reyes CE, Troncoso S, Figueroa CD, Muller-Esterl W, Gonzalez CB. Kidney Int. 2005;68:487–496. [PubMed]
4. Kreisberg JI, Venkatachalam M, Troyer D. Am J Physiol. 1985;249:F457–F463. [PubMed]
5. Segarra G, Medina P, Vila JM, Chuan P, Domenech C, Lluch S. J Hypertens. 2002;20:1373–1379. [PubMed]
6. Medina P, Acuna A, Martinez-Leon JB, Otero E, Vila JM, Aldasoro M, Lluch S. Circulation. 1998;97:865–870. [PubMed]
7. Altura BM, Altura BT. Fed Proc. 1977;36:1853–1860. [PubMed]
8. Bhora FY, Kothary PC, Imanishi H, Eckhauser FE, Raper SE. J Surg Res. 1994;57:706–710. [PubMed]
9. Serradeil-Le Gal C, Bourrie B, Raufaste D, Carayon P, Garcia C, Maffrand JP, Le Fur G, Casellas P. Biochem Pharmacol. 1994;47:633–641. [PubMed]
10. Serradeil-Le Gal C, Herbert JM, Delisee C, Schaeffer P, Raufaste D, Garcia C, Dol F, Marty E, Maffrand JP, Le Fur G. Am J Physiol. 1995;268:H404–H410. [PubMed]
11. Chiu T, Wu SS, Santiskulvong C, Tangkijvanich P, Yee HF, Jr, Rozengurt E. Am J Physiol Cell Physiol. 2002;282:C434–C450. [PubMed]
12. Rozengurt E, Rodriguez-Pena A, Sinnett-Smith J. Ciba Found Symp. 1985;116:66–86. [PubMed]
13. Santiskulvong C, Rozengurt E. Exp Cell Res. 2003;290:437–446. [PubMed]
14. Brinton RD, Yamazaki R, Gonzalez CM, O'Neill K, Schreiber SS. Brain Res Mol Brain Res. 1998;57:73–85. [PubMed]
15. Cortner J, Farnham PJ. Cell Growth Differ. 1991;2:465–473. [PubMed]
16. Dey A, She H, Kim L, Boruch A, Guris DL, Carlberg K, Sebti SM, Woodley DT, Imamoto A, Li W. Mol Biol Cell. 2000;11:3835–3848. [PubMed]
17. Gomez-Lechon MJ, Guillen I, Ponsoda X, Fabra R, Trullenque R, Nakamura T, Castell JV. Hepatology. 1996;23:1012–1019. [PubMed]
18. Hallahan DE, Dunphy E, Virudachalam S, Sukhatme VP, Kufe DW, Weichselbaum RR. J Biol Chem. 1995;270:30303–30309. [PubMed]
19. Roussel MF. Mol Reprod Dev. 1997;46:11–18. [PubMed]
20. Gschwind A, Zwick E, Prenzel N, Leserer M, Ullrich A. Oncogene. 2001;20:1594–1600. [PubMed]
21. Wetzker R, Bohmer FD. Nat Rev Mol Cell Biol. 2003;4:651–657. [PubMed]
22. Schafer B, Marg B, Gschwind A, Ullrich A. J Biol Chem. 2004;279:47929–47938. [PubMed]
23. Pierce KL, Tohgo A, Ahn S, Field ME, Luttrell LM, Lefkowitz RJ. J Biol Chem. 2001;276:23155–23160. [PubMed]
24. Gallet C, Blaie S, Levy-Toledano S, Habib A. Biochem J. 2003;371:733–742. [PubMed]
25. Itoh Y, Joh T, Tanida S, Sasaki M, Kataoka H, Itoh K, Oshima T, Ogasawara N, Togawa S, Wada T, Kubota H, Mori Y, Ohara H, Nomura T, Higashiyama S, Itoh M. Cytokine. 2005;29:275–282. [PubMed]
26. Luttrell LM, Della Rocca GJ, van Biesen T, Luttrell DK, Lefkowitz RJ. J Biol Chem. 1997;272:4637–4644. [PubMed]
27. Wu W, Graves LM, Gill GN, Parsons SJ, Samet JM. J Biol Chem. 2002;277:24252–24257. [PubMed]
28. Samet JM, Dewar BJ, Wu W, Graves LM. Toxicol Appl Pharmacol. 2003;191:86–93. [PubMed]
29. Pyne NJ, Waters C, Moughal NA, Sambi B, Connell M, Pyne S. Methods Enzymol. 2004;390:451–475. [PubMed]
30. Pyne NJ, Waters C, Moughal NA, Sambi BS, Pyne S. Biochem Soc Trans. 2003;31:1220–1225. [PubMed]
31. Terrillon S, Bouvier M. Embo J. 2004;23:3950–3961. [PubMed]
32. Terrillon S, Barberis C, Bouvier M. Proc Natl Acad Sci U S A. 2004;101:1548–1553. [PubMed]
33. Prenzel N, Zwick E, Daub H, Leserer M, Abraham R, Wallasch C, Ullrich A. Nature. 1999;402:884–888. [PubMed]
34. Abecassis I, Olofsson B, Schmid M, Zalcman G, Karniguian A. Exp Cell Res. 2003;291:363–376. [PubMed]
35. Desai B, Rogers MJ, Chellaiah MA. Mol Cancer. 2007;6:18. [PubMed]
36. Caceres M, Guerrero J, Martinez J. Exp Cell Res. 2005;309:229–238. [PubMed]
37. Guerrero J, Santibanez JF, Gonzalez A, Martinez J. Exp Cell Res. 2004;292:201–208. [PubMed]
38. Mukhopadhyay D, Tsiokas L, Zhou XM, Foster D, Brugge JS, Sukhatme VP. Nature. 1995;375:577–581. [PubMed]
39. Stewart S, Guan KL. J Biol Chem. 2000;275:8854–8862. [PubMed]
40. Daaka Y, Pitcher JA, Richardson M, Stoffel RH, Robishaw JD, Lefkowitz RJ. Proc Natl Acad Sci U S A. 1997;94:2180–2185. [PubMed]
41. Grillone LR, Clark MA, Godfrey RW, Stassen F, Crooke ST. J Biol Chem. 1988;263:2658–2663. [PubMed]
42. Ghosh PM, Bedolla R, Thomas CA, Kreisberg JI. J Cell Biochem. 2004;91:1109–1129. [PubMed]
43. Ghosh PM, Mikhailova M, Bedolla R, Kreisberg JI. Am J Physiol Renal Physiol. 2001;280:F972–F979. [PubMed]
44. Thibonnier M, Plesnicher CL, Berrada K, Berti-Mattera L. Am J Physiol Endocrinol Metab. 2001;281:E81–E92. [PubMed]
45. Andreev J, Galisteo ML, Kranenburg O, Logan SK, Chiu ES, Okigaki M, Cary LA, Moolenaar WH, Schlessinger J. J Biol Chem. 2001;276:20130–20135. [PubMed]
46. Cheng-Hsien C, Yung-Ho H, Yuh-Mou S, Chun-Cheng H, Horng-Mo L, Huei-Mei H, Tso-Hsiao C. Pflugers Arch. 2006;452:16–24. [PubMed]
47. Alexander LD, Ding Y, Alagarsamy S, Cui XL, Douglas JG. Kidney Int. 2006
48. Drube S, Stirnweiss J, Valkova C, Liebmann C. Cell Signal. 2006
49. Slomiany BL, Slomiany A. Inflammopharmacology. 2004;12:233–245. [PubMed]
50. Keates S, Keates AC, Katchar K, Peek RM, Jr, Kelly CP. J Infect Dis. 2007;196:95–103. [PubMed]
51. Al-Sarraj A, Thiel G. Neurosci Lett. 2002;332:111–114. [PubMed]
52. Wiiger MT, Prydz H. Thromb Haemost. 2004;92:13–22. [PubMed]
53. Zhao D, Letterman J, Schreiber BM. J Biol Chem. 2001;276:30579–30588. [PubMed]
54. Zhao D, Zhan Y, Zeng H, Koon HW, Moyer MP, Pothoulakis C. Int J Cancer. 2007;120:1652–1656. [PubMed]
55. Zhao H, Tian W, Xu H, Cohen DM. Biochem J. 2003;370:479–487. [PubMed]
56. Dieckgraefe BK, Weems DM. Am J Physiol. 1999;276:G322–G330. [PubMed]
57. Hodge C, Liao J, Stofega M, Guan K, Carter-Su C, Schwartz J. J Biol Chem. 1998;273:31327–31336. [PubMed]
58. De Sousa LP, Brasil BS, Silva BM, Freitas MH, Nogueira SV, Ferreira PC, Kroon EG, Bonjardim CA. Biochem Biophys Res Commun. 2005;329:237–245. [PubMed]
59. Goetze S, Kintscher U, Kaneshiro K, Meehan WP, Collins A, Fleck E, Hsueh WA, Law RE. Atherosclerosis. 2001;159:93–101. [PubMed]
60. Blaschke F, Bruemmer D, Law RE. Rev Endocr Metab Disord. 2004;5:249–254. [PubMed]
61. Khachigian LM. Circ Res. 2006;98:186–191. [PubMed]

See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph
See more articles cited in this paragraph